INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Sexual transmission is the predominant route of human immunodeficiency virus type 1 (HIV-1) infection worldwide (45). For an AIDS vaccine to be effective, it must be able to prevent infection or disease resulting from mucosal as well as blood-borne transmissions. Although protection has been demonstrated for a number of vaccine approaches (1, 39), most of the evidence to date has come from intravenous challenge models. The requirements for an effective immunization regimen and the correlates of protection against mucosal transmission of HIV have yet to be adequately addressed.

Protection against mucosal transmission was first demonstrated experimentally in simian immunodeficiency virus (SIV) models. Macaques have been protected against intrarectal challenge with formalin-inactivated whole-virion vaccines (10). The use of microencapsulated whole inactivated virus vaccine in a regimen consisting of intramuscular priming and mucosal boosting has provided protection against vaginal challenge (25). However, because of the potential complications caused by cellular antigens associated with whole inactivated virus vaccines (2, 38), the mechanism of protection and the applicability of these findings to HIV vaccine development remain unclear.

Several investigators have also reported partial or complete protection against intravaginal or intrarectal challenge in macaques previously infected with live "attenuated" SIV (11, 24). In a few instances, protection against heterologous virus challenge was achieved. Cross-protection was observed in seronegative HIV-2-exposed animals against intrarectal SIVsm infection (33), in SIV-infected animals against intrarectal simian/human immunodeficiency virus (SHIV) infection (34), and in SHIV-infected animals against intravaginal SIV infection (26). Protection appears to be independent of virus-specific antibodies in some cases (33) or of immunity against viral envelope antigens in others (26, 34). Protection against intrarectal challenge by SIVmne E11S was also observed in macaques previously inoculated intravenously with low, subinfectious doses of the same virus (9). Protection in this case was associated only with SIV-specific T-cell proliferative responses.

Protection against intrarectal challenge was recently achieved with recombinant vaccines. Immunization with subunit envelope and core antigens targeted to the iliac lymph nodes protected macaques against intrarectal infection with the SIVmac32H clone J5 (22). Protection was associated with a significant increase in the iliac lymph node cells that secrete CD8-suppressor factor,  chemokines, and immunoglobulin A (IgA) antibodies to p27. A protective effect was observed in animals immunized with an attenuated recombinant vaccinia virus vector (NYVAC) expressing SIV gag, pol, and env genes (3). Transient infection was observed in a significant proportion of animals after intrarectal challenge with a highly virulent virus, SIVmac251. However, protection in this case was not attributable to any of the measured immunological parameters.

We previously reported that immunization with recombinant SIVmne envelope (gp160) vaccines in a "prime and boost" regimen protected macaques against an intravenous infection by the homologous pathogenic virus, clone E11S (16). However, only partial protection was achieved against the uncloned parental virus SIVmne (31). In the present study, we sought to determine the protective efficacy of this immunization regimen against infection by the same viruses through a mucosal route. The results indicate that parenteral immunization with gp160-based vaccines was highly effective against intrarectal infection not only by the E11S clone but also by the uncloned SIVmne. Analysis of viral sequences recovered from infected animals indicates that the enhanced efficacy of the vaccines against challenge with the uncloned virus by the intrarectal route, compared with the intravenous route, may be due in part to preferential transmission or amplification of the E11S-type viruses after mucosal exposure.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Immunogens and immunization regimen. Recombinant vaccinia virus vac-gp160 (v-SE5) contains the coding sequence of the full-length gp160 of SIVmne molecular clone 8 (GenBank accession number M32741 [7, 14]) in a New York City Board of Health strain (v-NY) of vaccinia virus (16, 17). v-SE5 was plaque purified and propagated on African green monkey kidney cells (BSC-40) (17). Cynomolgus macaques (Macaca fascicularis) were inoculated with 10⁸ PFU of the recombinant virus by skin scarification at two or three sites along opposite sides of the midline of the back. Booster immunizations at 2.5, 20, and 22 months were done via intramuscular injections of gp160 produced in BSC-40 cells infected with recombinant vaccinia virus (19). Each booster dose contained 250 µg of total protein (corresponding to approximately 125 µg of gp160) formulated in Freund incomplete adjuvant.

Challenge virus and conditions. SIVmne was isolated from a pig-tailed macaque (M. nemestrina) with lymphoma and was propagated on HuT 78 cells (4). E11S is a single-cell clone of SIVmne-infected HuT 78 cells that produces large amounts of envelope glycoproteins (7). Challenge was performed by an intrarectal inoculation 4 weeks after the last immunization with 2 to 20 animal infectious doses (AID) of SIVmne clone E11S. The in vivo infectivity of the virus was determined previously by a separate intrarectal titration experiment. Intrarectal inoculation was performed as described previously (21). The animals protected from the E11S challenge were held for 2 years to confirm their virus-negative status before they were boosted again with gp160 and rechallenged intrarectally 4 weeks later with 2 to 20 AID of uncloned SIVmne grown on HuT 78 cells. Blood samples were collected on the day of challenge; at 2, 4, 6, and 8 weeks after challenge; and monthly thereafter. Plasma and serum samples were collected and stored at 70 and 20°C, respectively, until used. Lymph node biopsy specimens were obtained at the indicated times after challenge and were frozen at 70°C for DNA analysis or fixed for in situ hybridization and histological analyses. Animals were housed in the Washington Regional Primate Research Center and were under the care of licensed veterinarians. All macaques were also tested negative for the presence of simian type D retrovirus by serology, PCR, and virus isolation. Euthanasia was performed on the basis of the following criteria: AIDS, termination of experiment, or deteriorating physical condition for reasons unrelated to infection. Euthanasia was considered to be AIDS-related if the animal exhibited peripheral blood CD4⁺ cell depletion and two or more of the following conditions: wasting, untreatable diarrhea, opportunistic infections, proliferative diseases (e.g., lymphoma), and abnormal hematology (e.g., anemia, thrombocytopenia, or leukopenia).

Virus isolation. Peripheral blood mononuclear cells (PBMC) were isolated over Histopaque-1077 (Sigma Chemical Co., St. Louis, Mo.) as described previously (6, 8). Briefly, 4 × 10⁶ PBMC were cocultivated with 5 × 10⁶ AA-2CL5 cells, and cultures were maintained for 8 to 9 weeks. Virus was detected by reverse transcriptase (RT) assays performed as described previously (4). A positive value means positive results in RT assays, and a negative value means no RT activity was detected after 8 to 9 weeks of cocultivation.

ISH analysis. In situ hybridization (ISH) was performed essentially as described previously for SIVagm (15). Digoxigenin-labeled RNA probes were generated by SP6 or T7 polymerase transcription reactions by using subclones of SIVmac239 as templates that spanned the entire genome in 1- to 2-kb fragments (Lofstrand Laboratories, Gaithersburg, Md.). Formalin-fixed, paraffin-embedded tissue sections were hybridized with 1.75 ng of SIVmac239 riboprobe (sense or anti-sense) per ml at 52°C overnight, washed sequentially in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-50% formamide solution and then 2× SSC, and treated for 30 min at 37°C in a solution containing RNase T1 and RNase A. The slides were blocked with a buffer containing 2% horse serum, 150 mM NaCl, and 100 mM Tris (pH 7.4) for 1 h. After the serum block, the slides were incubated for 1 h with sheep anti-digoxigenin alkaline phosphatase conjugate (Boehringer Mannheim) at 1:500 dilution, rinsed in Tris (pH 7.4), and incubated with nitroblue tetrazolium-5-bromo-4-chloro-3-imdolyl phosphate (Vector Laboratories, Burlingame, Calif.) substrate in the dark at room temperature overnight. The stained slides were rinsed in water, counterstained with nuclear fast red, dehydrated, and mounted with coverslips. All of the stained samples were viewed and photographed with a Zeiss Axiophot microscope. Controls included SIVmac239 sense probe hybridized on SIVmne-infected tissue, anti-sense SIVmac239 probe on uninfected tissues, and substitution of the sheep antibody conjugate with phosphate-buffered saline.

Serum neutralization assays. Neutralizing antibodies against uncloned SIVmne and SIVmne clone E11S were measured in CEM-X174 cells by methods similar to those described previously (28). The uncloned SIVmne used for neutralization studies was grown on HuT 78 cells and was identical to the challenge stock but was prepared at different times. The E11S virus used for neutralization assays was derived from the same stock as the challenge virus but was grown on macaque (M. fascicularis) PBMC. Twofold serum dilutions (heat-inactivated at 56°C for 30 min) were tested in 96-well plates. The neutralization titer is expressed as the reciprocal serum dilution that inhibits 50% of SIVmne-induced cytopathic effect in CEM-X174 cells.

ELISA. SIV-specific antibodies were measured by enzyme-linked immunosorbent assay (ELISA) as described earlier (16), except that the gradient-purified and disrupted whole SIVmne clone E11S virion was used as an antigen in the ELISA. Endpoint titers were determined as the reciprocal of the highest serum dilution that resulted in an optical density reading threefold greater than that obtained with negative control sera.

Immunoblot assay. Proteins from sucrose gradient-purified SIVmne Cl E11S grown in HuT 78 cells were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to Immobilon paper (Millipore Corp., Bedford, Mass.), and processed as described earlier (5). Macaque plasma was diluted 1:100 before the assay.

Nested PCR analysis. PBMC were isolated from EDTA-treated blood by Hypaque-Ficoll gradient centrifugation, and nucleic acid was extracted by standard techniques. One microgram of total nucleic acid was used as a template for a two-step amplification by PCR by using a nested set of oligonucleotide primers specific for the env region. The conditions for the first and second rounds of amplification were as described previously (16). The final amplified fragment was approximately 642 bp in length. Amplified products were resolved by agarose gel electrophoresis and visualized by ethidium-bromide staining. Results for a subset of samples were also confirmed by PCR with primers from env and long terminal repeat (LTR)-gag regions.

Semiquantitative PCR analysis of proviral DNA load. Proviral DNA in PBMC was measured by PCR with the use of radiolabeled primer incorporation for quantification (32) and was expressed as copies of proviral genome detected per million PBMC. Briefly, 1 µg of DNA from each sample was amplified in a PCR mixture that contained 0.2 µM concentrations of each primers, 200 µM concentrations of each of four deoxynucleoside triphosphates, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl₂, and 1.0 U of Taq polymerase (Perkin-Elmer Cetus, Branchburg, N.J.) in a volume of 50 µl. The reaction was subjected to 30 cycles of denaturation for 1 min at 94°C, annealing for 2 min at 60°C, and elongation for 3 min at 70°C. The oligonucleotide primers used were derived from the nucleotide sequence of SIVmne (GenBank accession number M32741 [14]). They consist of a primer pair specific for the envelope region, env10 (nucleotides 7191 to 7211 [sense]) and env12 (nucleotides 7541 to 7561 [antisense]), and a pair of primers specific for the LTR-gag region, S1 (nucleotides 228 to 251 [sense]) and S8 (nucleotides 536 to 559 [antisense]). The amplified products for the env and the LTR-gag sequences are 370 and 330 bp, respectively. One oligonucleotide of each complementary pair was 5' end labeled with [³²P]ATP by using polynucleotide kinase (New England Biolabs, Inc., Beverly, Mass.). The ³²P-labeled PCR products obtained by amplification were analyzed by electrophoresis on 8% nondenaturing polyacrylamide gels and quantified by autoradiography with PhosphorImager (PIA) analysis (32). Quantification of SIV-DNA was determined with a standard curve generated by known quantities of a plasmid clone of E11S.

RT-QC-PCR determination of plasma viral RNA. Plasma viral RNA was prepared as described earlier (42). The viral RNA samples were serially diluted in a 96-well PCR microplate into a reaction buffer containing a fixed copy number of a competitor RNA with an internal deletion. The template and the competitor were subjected to reverse transcription followed by quantitative competitive-PCR (QC-PCR). The primers used are from the SIVmne gag sequence: 5' primer (5G) from nucleotides 675 to 698 (AAAGCCTGTTGGAGAACAAAGAAG) and 3' primer (3Diii) from nucleotides 993 to 1011 (AATTTTACCCAGGCATTTA). The internal RNA control contains a deletion of 82 bp which enables the discrimination between products amplified from the viral (336-bp) and the control (254-bp) templates. The conditions for the RT and QC-PCR reactions were as described by Watson et al. (42).

Analysis of the proviral DNA sequence in PBMC or lymph node cells from animals infected with uncloned SIVmne. Proviral DNA sequences in infected macaques were analyzed by PCR amplification with radiolabeled primers as described earlier (31). Two oligonucleotide probes (nucleotides 6471 to 6499) were used, one specific for the E11S-like sequence (E11Sp, 5'-TTTATTGCCTCTGCTTTTGTTGGTATTGC-3' [antisense]) and the other for the variant-type sequences (Variantp, 5'-TCTATTTTCTTTGTTGTTGGTTTTGGTGT-3' [antisense]). The E11Sp probe hybridizes with the proviral cDNA of E11S and uncloned SIVmne, while the Variantp probe hybridizes only to the latter. By using primers specific for the E11S- or the variant-type sequences, we amplified V1 sequences in the PBMC or the lymph node cells of infected macaques. A radiolabeled primer specific for the V1 region (Env71, nucleotides 6097 to 6120, 5'-TTATCGCCATCTTGTTTCTAAGTC-3' [sense]) was used in combination with the antisense primers specific for the E11S or the variant sequences. The amplified product, which was 397 bp in length, was resolved by electrophoresis on 8% nondenaturing polyacrylamide gels, and the relative abundance of the E11S-type and the variant-type sequences was determined by autoradiography by using PIA analysis as described above. For each PCR amplification, DNA from E11S-infected and uncloned SIVmne-infected cells were used as controls.

Lymphocyte subset analysis. Cell surface immunofluorescence was quantified by use of a FACScan flow cytometer and Lysis II software (Becton Dickinson Immunocytometry Systems, San Jose, Calif.). Lymphocyte subsets (CD4, CD8, CD2, and CD20) of whole heparinized blood samples were evaluated by conventional methods.

Statistical analysis. Differences in proportions were tested by Fisher's exact test. Differences in SIV-specific antibody titers in infected versus protected animals were tested by constructing a 95% confidence interval for the mean of the protected animals and determining whether the antibody level of the infected animal fell within that interval. The mean percentage of E11S-like sequences in intrarectally challenged animals was compared with the mean percentage of E11S-like sequences in intravenously challenged animals (31) by nonparametric permutation tests. Finally, declines in CD4⁺ cell counts were compared between groups using repeated measures analysis of variance with fixed group and time factors. The statistical significance of a decline within a group was tested using group by time interaction terms in the analysis of variance.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Protection against intrarectal challenge with homologous clone E11S. To determine the protective efficacy of envelope-based vaccines against mucosal challenge, we used a combination immunization strategy that was shown previously to protect macaques against intravenous infections (16, 31). Briefly, we immunized four cynomolgus macaques first with a live recombinant vaccinia virus expressing the full-length envelope protein gp160 of SIVmne and then with subunit gp160 as a booster immunogen. As observed previously, all animals developed low levels of SIV-specific antibody responses (as determined by ELISA, immunoblots, and serum neutralization assays) after the recombinant vaccinia virus immunization. However, levels of SIV-specific antibodies increased 10- to 30-fold after the first subunit protein immunization (references 16 and 31 and data not shown). Four weeks after the last booster immunization, all four immunized animals, together with three naive controls, were challenged intrarectally with the homologous pathogenic virus clone E11S grown on HuT 78 cells. Infection was monitored by nested PCR, virus isolation by coculture, anamnestic response, and seroconversion to nonvaccine antigens.

View larger version (34K): [in this window] [in a new window]   FIG. 1.   Viral load in macaques challenged intrarectally with E11S clone (a and b) or uncloned SIVmne (c to f). The proviral load in PBMC was determined by PCR analysis by using radiolabeled primer incorporation (a to d). Values are expressed as copies of proviral genome per 106 PBMC. Quantification of proviral DNA was determined by using an external standard containing a known copy number of SIVmne E11S proviral DNA. Plasma viral load was determined by RT-QC-PCR (e and f) with an internally controlled template as described in Materials and Methods.

View larger version (28K): [in this window] [in a new window]   FIG. 2.   SIV-specific antibody responses in immunized and control macaques after challenge. Dilutions of macaque sera collected at the indicated times were incubated with disrupted, gradient-purified SIVmne virion proteins immobilized on microtiter plates. Endpoint titers were defined as the reciprocal of the highest dilution that gave an optical absorbance value at least threefold higher than the average values obtained with SIV-negative macaque sera. Panels (a) and (b), immunized and control animals challenged with SIVmne E11S; panels (c) and (d), immunized and control animals challenged with uncloned SIVmne. Arrows indicate the time of challenge.

View larger version (49K): [in this window] [in a new window]   FIG. 3.   Immunoblot analysis of SIV-specific antibody responses in macaques challenged with SIVmne clone E11S (A) or uncloned SIVmne (B). Macaque plasma (diluted 100-fold) was reacted with SDS-PAGE-separated proteins from disrupted, sucrose gradient-purified SIVmne clone E11S as described earlier (5). At various times after SIV challenge, antibodies were detected in infected animals to envelope surface (gp120) and transmembrane (gp32) proteins; to the Gag proteins p28, p16, and p6; and to the Vpx protein p14. Antibodies to gp120 and gp32 were evident in all immunized macaques on the day of challenge (week 0). A weak antibody that cross-reacts with p28 was also present in one control animal at week 0 (animal 92169 [panel A]). This has occasionally been observed in naive M. fascicularis. The source of this cross-reactive antibody is unknown.

Protection against intrarectal challenge with uncloned SIVmne. To examine the breadth of the protective immunity, we rechallenged all three protected animals with uncloned SIVmne by the intrarectal route. In this experiment, we included three additional animals (macaques 90090, 90108, and 91074) that were immunized in parallel with the same gp160 vaccines but were protected against E11S challenge by the intravenous route (31). All of these animals met the following criteria for inclusion in the study: they had been virus negative for >2 years after challenge, as determined by nested PCR analysis and by virus isolation from PBMC coculture, and they had shown no anamnestic response and seroconversion to nonvaccine antigens (reference 31 and data not shown). Lymph nodes from these animals were also examined by nested PCR and by in situ hybridization and were shown to be virus negative (Table 1 and data not shown). All six animals were boosted again with recombinant gp160 approximately 2 years after the initial E11S challenge. Although none of these animals received any SIV antigen for >2 years, all of them showed significant recall responses upon receiving the booster immunization (Fig. 2c).

View larger version (93K): [in this window] [in a new window]   FIG. 4.   In situ hybridization analysis of lymph nodes from macaques challenged intrarectally with uncloned SIVmne. Peripheral lymph node samples from control (a to f) and immunized (g to i) animals were collected on day 14 (a to c) or day 26 or 27 (d to i) after challenge. Samples were examined with SIV-specific digoxigenin-labeled riboprobes as described in Materials and Methods. Panels: a and b, macaque 93191; c, macaque 93080; d, macaque 93204; e, macaque 93205; f, macaque 93206; g, macaque 90099; h, macaque 90108; and i, macaque 91074. Magnifications in panels a to i are, respectively, ×25, ×25, ×31.2, ×10, ×15, ×31.2, ×31.2, ×12.5, and ×12.5. The sample in panel a was hybridized with a "sense" probe as a control. All other samples shown were hybridized with "anti-sense" probes.

SIV-specific antibody responses in immunized animals. To determine whether SIV-specific antibodies correlated with protection, we analyzed sera from immunized animals by ELISA and by virus neutralization assays. On the day of challenge with E11S, all four immunized animals showed moderate levels of SIV-specific antibodies, with titers ranging from 10- to 100-fold lower than a pooled serum sample from SIV-infected macaques (Fig. 3 and 5 and unpublished data). The three animals protected against E11S challenge had significantly higher serum antibody titers than the one that was not protected (Fig. 5b). Although none of the four animals developed an appreciable level of serum neutralizing antibodies against the homologous challenge virus E11S (Fig. 5a), their sera showed significant neutralizing activities against a heterologous virus, SIVmac251, passaged in HuT 78 cells (21a). However, there was no apparent correlation between the challenge outcome and the level of serum neutralizing antibodies in either assay.

View larger version (40K): [in this window] [in a new window]   FIG. 5.   SIV-specific antibody responses in immunized macaques. Sera collected on the day of challenge were analyzed for neutralizing activities against the homologous challenge virus (E11S or uncloned SIVmne). Neutralizing titers are expressed as the reciprocal serum dilutions that resulted in >50% cytopathicity of E11S or uncloned SIVmne infection in CEMx174 cells (a and c). Serum reactivity with disrupted SIVmne E11S virion proteins was analyzed by ELISA, and the results are expressed as endpoint titers (b and d). Top panels (a and b), animals challenged with SIVmne E11S; bottom panels (c and d), animals challenged with uncloned SIVmne. Solid symbols denote persistently infected animals; open symbols show the protected animals. The shaded areas denote the 95% confidence interval for the mean titer of the protected animals. The upper and lower dotted lines represent, respectively, the titers of positive and negative control serum samples in each assay.

Analysis of viral sequences recovered from intrarectally infected animals. To gain a better understanding of the basis for vaccine success or failure, we examined proviral sequences recovered from naive control animals infected intrarectally by the uncloned SIVmne. In an earlier study (31), we showed that the majority (85%) of the uncloned SIVmne challenge stock contained V1 sequences homologous to the molecular clone from which the vaccines were made (E11S type), with the remainder (15%) containing multiple conserved changes (the variant types). We used labeled-primer amplification analyses to identify and quantify the proportion of E11S-like and "variant"-like sequences present in infected macaques. Both PBMC and lymph node samples were analyzed. First, we focused on the earliest samples from which we were able to detect >50 copies of viral sequences per microgram of total DNA (approximately 2 × 10⁵ cells). These also represent preseroconversion samples, thus minimizing potential complications due to immune selection. In contrast to intravenously infected animals, from which either E11S-type or the variant-type V1 sequences could be recovered in significant proportions (31), all five intrarectally infected control animals had predominantly E11S-like sequences at 2 weeks after infection (Fig. 6A). The percentage of E11S-like sequences in the latter animals ranged from 84 to 99.5%, with a median of 96.5%. The mean percentage of E11S-like sequences in intrarectally infected animals was significantly higher than that in the PBMC of animals infected intravenously with the same virus (31) (P = 0.027). Both PBMC and lymph node samples collected concurrently from the same animal showed similar percentages of E11S-like and variant-like sequences (results not shown). These findings indicate preferential transmission and/or early amplification of viruses with E11S-like V1 sequences after intrarectal exposure.

View larger version (43K): [in this window] [in a new window]   FIG. 6.   Analysis of env V1 sequences recovered from the PBMC of macaques infected intrarectally with uncloned SIVmne. (A) Percentages of E11S-like (solid area) and variant-like (stippled area) V1 sequences in each of the six intrarectally infected control macaques are represented in individual pie charts. For comparison, the composition of the uncloned challenge virus and the results of a similar analysis (31) of intravenously infected animals are included. Analyses of PBMC were done on samples collected 2 weeks after infection. (B) Change of V1 genotype in the PBMC of animals 93204 and 93205 during the acute phase of infection. Percentages of E11S-like (solid bar) and variant-like (stippled bar) V1 sequences are as indicated.

Clinical outcome of infection. Infected animals were monitored for 3 or more years after challenge to determine the clinical outcome of infection and the effects of immunization. They were checked periodically for lymphocyte subsets, hematology, blood chemistry, body weight, opportunistic infections, and proliferative diseases. Figure 7 summarizes their peripheral blood CD4⁺ cell levels and survival time after challenge.

View larger version (28K): [in this window] [in a new window]   FIG. 7.   Peripheral blood CD4+ T-lymphocyte numbers in immunized and control macaques after intrarectal challenge with SIVmne E11S (a and b, respectively) or uncloned SIVmne (c and d, respectively). Animals euthanatized because of AIDS are labeled A; animals sacrificed at the end of the experimentation period are labeled E; and animals that died of causes unrelated to AIDS are labeled U. The last datum point for each animal represents the time of death or the termination of the experiment (euthanatized, alive, or rechallenged [Rech]).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

We have shown that a "prime and boost" immunization regimen with recombinant SIVmne gp160 vaccines is highly effective against intrarectal challenge by the homologous virus. Our findings thus support and extend earlier observations that protection against mucosal infection by a primate lentivirus is possible through parenteral immunizations. Such protection has been obtained with live attenuated virus (11, 24, 26, 33, 34), whole killed virus (10, 25), or complex immunogens (3). Our results show that protection is also achievable with parenterally administered envelope-based vaccines. It is possible that mucosally administered vaccines may be more desirable or effective than parenteral immunizations against mucosal infection under certain conditions (see reference 25), including natural transmission. However, this remains to be demonstrated in comparative studies.

Results from the present study also support the notion that protection against mucosal infection may be more readily achievable than that against blood-borne infection. The gp160 vaccines protected macaques against intrarectal infection by the homologous E11S clone as well as the uncloned SIVmne. This is in contrast to our previous finding that the same immunization regimen protected macaques against the E11S clone significantly better than the uncloned SIVmne given intravenously. Our findings are in agreement with the result of Benson et al. (3), who observed a better clinical outcome in a significant proportion of immunized macaques after intrarectal, but not after intravenous, infection with SIVmac251. It is therefore possible that vaccine strategies that fail to protect against intravenous challenge may still have some efficacy against mucosal infection. Since mucosal infection is the primary mode of natural transmission of HIV, such findings are potentially of significance.

Several mechanisms may contribute to the enhanced efficacy of the vaccines against the uncloned virus infection by the intrarectal route compared with the intravenous route. The relative inefficiency of mucosal transmission is not likely to account for such a difference because we compensated for the low efficiency by using 500- to 1,000-fold larger virus inocula for intrarectal challenges so that the same AID was used as for intravenous challenges. It is possible that, for a finite but significant time after the initial exposure, the infection is restricted locally in animals challenged through mucosal routes (37) and the process of dissemination is delayed compared with those challenged intravenously. The recall response in immunized animals would be better able to control and perhaps eradicate localized infection after mucosal exposure and before disseminated infection could be established.

Alternatively, the enhanced efficacy of the vaccines against intrarectal challenge by the uncloned SIVmne may be due to selective transmission and amplification of E11S-like virus after intrarectal exposure. Selective transmission and/or amplification has been proposed to account for the genotype restriction observed after natural infection with HIV-1 (36, 43, 44, 46, 47). However, due to the difficulties in obtaining both the inocula and early tissue samples (prior to seroconversion), it remains unclear to what extent such restriction is caused by sequestration of the donor's virus (12, 48) and/or selection by the recipient's immune responses (20). Although results from different investigators vary, studies in animal models have provided the most definitive evidence for selective transmission and/or amplification after intravaginal (13, 23, 27, 29) or intrarectal infection (40, 41) with SIV or SHIV chimeras. Our present findings are in agreement with these earlier reports and provide a strong indication for the preferential transmission and amplification of E11S-like viruses after intrarectal exposure. At present, we cannot distinguish between these two possible mechanisms for the enrichment of E11S-like viruses. However, since two of the six control macaques showed a rapid reversal from E11S-like viruses to variant types during the first month of infection, preferential amplification alone is not likely to account for the predominance of E11S-like viruses at 2 weeks after intrarectal exposure. It is possible that differential selective processes exist in the mucosa versus the peripheral lymph nodes, such that different viral genotypes are selected immediately after mucosal exposure or after disseminated infection has occurred. In HIV-infected individuals, viruses recovered early after infection often exhibit macrophage-tropic, "non-syncytium-inducing" phenotypes. Although there is as yet no evidence supporting preferential transmission of macrophage-tropic viruses in animals, it is of interest that a molecular clone derived from E11S (SIVmne CL8) was recently shown to be macrophage-tropic, whereas variants that evolved from CL8 and shared the same canonical variant V1 sequences as reported here were not (35). In any case, preferential transmission and/or amplification of E11S-like viruses, if confirmed, would at least partially account for the greater efficacy of the vaccine against the uncloned virus after intrarectal versus intravenous challenge. Our results therefore also point to the importance of selecting the relevant and appropriate isolates of HIV-1 for the development of candidate vaccines.

To conserve animals in the present study, we used macaques previously protected against E11S infection for the rechallenge with uncloned SIVmne. It is possible that prior exposure to virus inoculum, without resulting in an ongoing infection, may nevertheless contribute to protection against the rechallenge (9, 18, 30). We cannot exclude this possibility without a direct comparative study. However, it should be noted that we have not been able to demonstrate any sign of E11S infection in these animals by multiple and stringent assays, and we have confirmed their virus-negative status for over 2 years. Any such effect, if present, would have to be elicited by very transient and limited infection below the limit of our detection, which in itself would lend further support to the efficacy of the vaccination regimen described here. In any case, it is unlikely that any effect of prior exposure alone could account for the differential protective efficacy of vaccination against intrarectal versus intravenous challenge, since reduced efficacy was observed in intravenously challenged animals regardless of whether they were challenged for the first time or were protected against E11S and rechallenged (31).

Although we are not able to address the mechanism of protection in this relatively small study, it is of interest to note that in both challenge studies the only immunized animal that became infected had the lowest titer of SIV-specific serum antibodies as determined by ELISA. The only animal infected after the uncloned SIVmne challenge also had significantly lower serum neutralizing antibodies than the protected animals. However, there was no significant difference in the serum neutralizing titers between the protected animal and those infected with E11S, perhaps due to the relative insensitivity of this assay. The apparent correlation between SIV-specific antibody titers (and perhaps serum neutralizing activities) and protection contradicts findings from our previous studies in which no such correlation was observed with the intravenous route of challenge (31). The basis for such a discrepancy is not clear. However, it is possible that the kinetics and the initial events after intravenous or intrarectal infection are sufficiently different that the quantitative or qualitative requirements for immune protection may also differ. In this context, it is of interest to note that the only immunized animal from which the vaginal washes were analyzed had levels of SIV-specific IgG and IgA comparable to those present in chronically infected animals (21). It is possible that SIV-specific antibodies, including neutralizing antibodies, could be present in mucosal sites such as vaginal and rectal surfaces as a result of transudation and, if so, may contribute to protection against challenge at these sites. It is also possible that other effector mechanisms (such as T-helper cells, cytotoxic T lymphocytes, and antibody-dependent cellular cytotoxicity) may contribute to protection, especially in those animals with no apparent neutralizing antibodies.

Over the past decade, a number of clinical trials have been undertaken to examine the safety and immunogenicity of envelope-based vaccines, including those in combination regimens similar to those described here. The potential efficacy of these vaccines is unknown, but it has been the subject of much controversy. Results from the present study are therefore of potential importance in this regard. They indicate that parenterally administered envelope-based vaccines, when given in a combination immunization regimen, may elicit protection against mucosal infection by a pathogenic uncloned virus. Furthermore, contrary to some previous indications, protection may be achieved more easily against mucosal infections than against blood-borne infections. Although it remains to be determined whether and to what extent these findings will be applicable to the development of HIV-1 vaccines, our results provide a strong basis for further improvements and testing of recombinant vaccines in combination immunization strategies.