Previous Article | Next Article ![]()
Journal of Virology, April 1999, p. 3134-3146, Vol. 73, No. 4
Regional Primate Research
Center1 and Department of
Biostatistics,
Received 20 October 1998/Accepted 3 January 1999
We previously reported that immunization with recombinant simian
immunodeficiency virus SIVmne envelope (gp160) vaccines protected macaques against intravenous challenge by the cloned homologous virus
E11S but that this protection was only partially effective against the
uncloned virus, SIVmne. In the present study, we examine the protective
efficacy of this immunization regimen against infection by a mucosal
route. We found that the same gp160-based vaccines were highly
effective against intrarectal infection not only with the E11S clone
but also with the uncloned SIVmne. Protection against mucosal infection
is therefore achievable by parenteral immunization with recombinant
envelope vaccines. Protection appears to correlate with high levels of
SIV-specific antibodies and, in animals protected against the uncloned
virus, the presence of serum-neutralizing activities. To understand the
basis for the differential efficacies against the uncloned virus by the
intravenous versus the intrarectal routes, we examined viral sequences
recovered from the peripheral blood mononuclear cells of animals early
after infection by both routes. We previously showed that the majority
(85%) of the uncloned SIVmne challenge stock contained V1 sequences
homologous to the molecular clone from which the vaccines were made
(E11S type), with the remainder (15%) containing multiple conserved
changes (the variant types). In contrast to intravenously infected
animals, from which either E11S-type or the variant type V1 sequences
could be recovered in significant proportions, animals infected
intrarectally had predominantly E11S-type sequences. Preferential
transmission or amplification of the E11S-type viruses may therefore
account in part for the enhanced efficacy of the recombinant gp160
vaccines against the uncloned virus challenge by the intrarectal route compared with the intravenous route.
Sexual transmission is the
predominant route of human immunodeficiency virus type 1 (HIV-1)
infection worldwide (45). For an AIDS vaccine to be
effective, it must be able to prevent infection or disease resulting
from mucosal as well as blood-borne transmissions. Although protection
has been demonstrated for a number of vaccine approaches (1,
39), most of the evidence to date has come from intravenous
challenge models. The requirements for an effective immunization
regimen and the correlates of protection against mucosal transmission
of HIV have yet to be adequately addressed.
Protection against mucosal transmission was first demonstrated
experimentally in simian immunodeficiency virus (SIV) models. Macaques
have been protected against intrarectal challenge with formalin-inactivated whole-virion vaccines (10). The use of microencapsulated whole inactivated virus vaccine in a regimen consisting of intramuscular priming and mucosal boosting has
provided protection against vaginal challenge (25).
However, because of the potential complications caused by
cellular antigens associated with whole inactivated virus vaccines
(2, 38), the mechanism of protection and the applicability
of these findings to HIV vaccine development remain unclear.
Several investigators have also reported partial or complete protection
against intravaginal or intrarectal challenge in macaques previously
infected with live "attenuated" SIV (11, 24). In a few
instances, protection against heterologous virus challenge was
achieved. Cross-protection was observed in seronegative HIV-2-exposed animals against intrarectal SIVsm infection (33), in
SIV-infected animals against intrarectal simian/human immunodeficiency
virus (SHIV) infection (34), and in SHIV-infected animals
against intravaginal SIV infection (26). Protection appears
to be independent of virus-specific antibodies in some cases
(33) or of immunity against viral envelope antigens in
others (26, 34). Protection against intrarectal challenge by
SIVmne E11S was also observed in macaques previously inoculated
intravenously with low, subinfectious doses of the same virus
(9). Protection in this case was associated only with
SIV-specific T-cell proliferative responses.
Protection against intrarectal challenge was recently
achieved with recombinant vaccines. Immunization with
subunit envelope and core antigens targeted to the iliac lymph nodes
protected macaques against intrarectal infection with the
SIVmac32H clone J5 (22). Protection was associated
with a significant increase in the iliac lymph node cells that secrete
CD8-suppressor factor, We previously reported that immunization with recombinant
SIVmne envelope (gp160) vaccines in a "prime and boost"
regimen protected macaques against an intravenous infection by the
homologous pathogenic virus, clone E11S (16). However, only
partial protection was achieved against the uncloned parental virus
SIVmne (31). In the present study, we sought to determine
the protective efficacy of this immunization regimen against infection
by the same viruses through a mucosal route. The results indicate that
parenteral immunization with gp160-based vaccines was highly effective
against intrarectal infection not only by the E11S clone but also by
the uncloned SIVmne. Analysis of viral sequences recovered from
infected animals indicates that the enhanced efficacy of the vaccines
against challenge with the uncloned virus by the intrarectal route,
compared with the intravenous route, may be due in part to preferential transmission or amplification of the E11S-type viruses after mucosal exposure.
Immunogens and immunization regimen.
Recombinant vaccinia
virus vac-gp160 (v-SE5) contains the coding sequence of the full-length
gp160 of SIVmne molecular clone 8 (GenBank accession number M32741
[7, 14]) in a New York City Board of Health strain
(v-NY) of vaccinia virus (16, 17). v-SE5 was plaque purified
and propagated on African green monkey kidney cells (BSC-40)
(17). Cynomolgus macaques (Macaca fascicularis) were inoculated with 108 PFU of the recombinant virus by
skin scarification at two or three sites along opposite sides of the
midline of the back. Booster immunizations at 2.5, 20, and 22 months
were done via intramuscular injections of gp160 produced in BSC-40
cells infected with recombinant vaccinia virus (19). Each
booster dose contained 250 µg of total protein (corresponding to
approximately 125 µg of gp160) formulated in Freund incomplete adjuvant.
Challenge virus and conditions.
SIVmne was isolated from a
pig-tailed macaque (M. nemestrina) with lymphoma and was
propagated on HuT 78 cells (4). E11S is a single-cell clone
of SIVmne-infected HuT 78 cells that produces large amounts of envelope
glycoproteins (7). Challenge was performed by an
intrarectal inoculation 4 weeks after the last immunization with 2 to 20 animal infectious doses (AID) of SIVmne clone E11S. The in vivo
infectivity of the virus was determined previously by a separate
intrarectal titration experiment. Intrarectal inoculation was performed
as described previously (21). The animals protected from the
E11S challenge were held for 2 years to confirm their virus-negative
status before they were boosted again with gp160 and rechallenged
intrarectally 4 weeks later with 2 to 20 AID of uncloned SIVmne grown
on HuT 78 cells. Blood samples were collected on the day of challenge;
at 2, 4, 6, and 8 weeks after challenge; and monthly thereafter. Plasma
and serum samples were collected and stored at Virus isolation.
Peripheral blood mononuclear cells (PBMC)
were isolated over Histopaque-1077 (Sigma Chemical Co., St. Louis, Mo.)
as described previously (6, 8). Briefly, 4 × 106 PBMC were cocultivated with 5 × 106
AA-2CL5 cells, and cultures were maintained for 8 to 9 weeks. Virus was
detected by reverse transcriptase (RT) assays performed as described
previously (4). A positive value means positive results in
RT assays, and a negative value means no RT activity was detected after
8 to 9 weeks of cocultivation.
ISH analysis.
In situ hybridization (ISH) was performed
essentially as described previously for SIVagm (15).
Digoxigenin-labeled RNA probes were generated by SP6 or T7 polymerase
transcription reactions by using subclones of SIVmac239 as templates
that spanned the entire genome in 1- to 2-kb fragments (Lofstrand
Laboratories, Gaithersburg, Md.). Formalin-fixed, paraffin-embedded
tissue sections were hybridized with 1.75 ng of SIVmac239 riboprobe
(sense or anti-sense) per ml at 52°C overnight, washed sequentially
in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-50%
formamide solution and then 2× SSC, and treated for 30 min at 37°C
in a solution containing RNase T1 and RNase A. The slides were blocked with a buffer containing 2% horse serum, 150 mM NaCl, and 100 mM Tris
(pH 7.4) for 1 h. After the serum block, the slides were incubated
for 1 h with sheep anti-digoxigenin alkaline phosphatase conjugate (Boehringer Mannheim) at 1:500 dilution, rinsed in
Tris (pH 7.4), and incubated with nitroblue
tetrazolium-5-bromo-4-chloro-3-imdolyl phosphate (Vector
Laboratories, Burlingame, Calif.) substrate in the dark at room
temperature overnight. The stained slides were rinsed in water,
counterstained with nuclear fast red, dehydrated, and mounted with
coverslips. All of the stained samples were viewed and photographed
with a Zeiss Axiophot microscope. Controls included SIVmac239 sense
probe hybridized on SIVmne-infected tissue, anti-sense SIVmac239 probe
on uninfected tissues, and substitution of the sheep antibody conjugate
with phosphate-buffered saline.
Serum neutralization assays.
Neutralizing antibodies
against uncloned SIVmne and SIVmne clone E11S were measured in
CEM-X174 cells by methods similar to those described previously
(28). The uncloned SIVmne used for neutralization studies
was grown on HuT 78 cells and was identical to the challenge stock but
was prepared at different times. The E11S virus used for neutralization
assays was derived from the same stock as the challenge virus but was
grown on macaque (M. fascicularis) PBMC. Twofold serum
dilutions (heat-inactivated at 56°C for 30 min) were tested in
96-well plates. The neutralization titer is expressed as the reciprocal
serum dilution that inhibits 50% of SIVmne-induced cytopathic effect
in CEM-X174 cells.
ELISA.
SIV-specific antibodies were measured by
enzyme-linked immunosorbent assay (ELISA) as described earlier
(16), except that the gradient-purified and disrupted whole
SIVmne clone E11S virion was used as an antigen in the ELISA. Endpoint
titers were determined as the reciprocal of the highest serum dilution
that resulted in an optical density reading threefold greater than that
obtained with negative control sera.
Immunoblot assay.
Proteins from sucrose gradient-purified
SIVmne Cl E11S grown in HuT 78 cells were separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to
Immobilon paper (Millipore Corp., Bedford, Mass.), and processed as
described earlier (5). Macaque plasma was diluted 1:100
before the assay.
Nested PCR analysis.
PBMC were isolated from EDTA-treated
blood by Hypaque-Ficoll gradient centrifugation, and nucleic acid was
extracted by standard techniques. One microgram of total nucleic acid
was used as a template for a two-step amplification by PCR by using a
nested set of oligonucleotide primers specific for the env
region. The conditions for the first and second rounds of amplification
were as described previously (16). The final amplified
fragment was approximately 642 bp in length. Amplified products were
resolved by agarose gel electrophoresis and visualized by
ethidium-bromide staining. Results for a subset of samples were also
confirmed by PCR with primers from env and long terminal
repeat (LTR)-gag regions.
Semiquantitative PCR analysis of proviral DNA load.
Proviral
DNA in PBMC was measured by PCR with the use of radiolabeled primer
incorporation for quantification (32) and was expressed as
copies of proviral genome detected per million PBMC. Briefly, 1 µg of
DNA from each sample was amplified in a PCR mixture that contained 0.2 µM concentrations of each primers, 200 µM concentrations of each of
four deoxynucleoside triphosphates, 10 mM Tris-HCl (pH 8.3), 50 mM KCl,
1.5 mM MgCl2, and 1.0 U of Taq polymerase (Perkin-Elmer Cetus, Branchburg, N.J.) in a volume of 50 µl. The reaction was subjected to 30 cycles of denaturation for 1 min at
94°C, annealing for 2 min at 60°C, and elongation for 3 min at
70°C. The oligonucleotide primers used were derived from the nucleotide sequence of SIVmne (GenBank accession number M32741 [14]). They consist of a primer pair specific for the
envelope region, env10 (nucleotides 7191 to 7211 [sense]) and env12
(nucleotides 7541 to 7561 [antisense]), and a pair of primers
specific for the LTR-gag region, S1 (nucleotides 228 to 251 [sense]) and S8 (nucleotides 536 to 559 [antisense]). The amplified
products for the env and the LTR-gag sequences
are 370 and 330 bp, respectively. One oligonucleotide of each
complementary pair was 5' end labeled with [32P]ATP by
using polynucleotide kinase (New England Biolabs, Inc., Beverly,
Mass.). The 32P-labeled PCR products obtained by
amplification were analyzed by electrophoresis on 8% nondenaturing
polyacrylamide gels and quantified by autoradiography with
PhosphorImager (PIA) analysis (32). Quantification of
SIV-DNA was determined with a standard curve generated by known
quantities of a plasmid clone of E11S.
RT-QC-PCR determination of plasma viral RNA.
Plasma viral
RNA was prepared as described earlier (42). The viral RNA
samples were serially diluted in a 96-well PCR microplate into a
reaction buffer containing a fixed copy number of a competitor RNA with
an internal deletion. The template and the competitor were subjected to
reverse transcription followed by quantitative competitive-PCR
(QC-PCR). The primers used are from the SIVmne gag sequence:
5' primer (5G) from nucleotides 675 to 698 (AAAGCCTGTTGGAGAACAAAGAAG) and 3' primer (3Diii) from
nucleotides 993 to 1011 (AATTTTACCCAGGCATTTA). The internal
RNA control contains a deletion of 82 bp which enables the
discrimination between products amplified from the viral (336-bp) and
the control (254-bp) templates. The conditions for the RT and QC-PCR
reactions were as described by Watson et al. (42).
Analysis of the proviral DNA sequence in PBMC or lymph node cells
from animals infected with uncloned SIVmne.
Proviral DNA sequences
in infected macaques were analyzed by PCR amplification with
radiolabeled primers as described earlier (31). Two
oligonucleotide probes (nucleotides 6471 to 6499) were used, one
specific for the E11S-like sequence (E11Sp,
5'-TTTATTGCCTCTGCTTTTGTTGGTATTGC-3' [antisense]) and the
other for the variant-type sequences (Variantp, 5'-TCTATTTTCTTTGTTGTTGGTTTTGGTGT-3' [antisense]). The
E11Sp probe hybridizes with the proviral cDNA of E11S and uncloned
SIVmne, while the Variantp probe hybridizes only to the latter. By
using primers specific for the E11S- or the variant-type sequences, we
amplified V1 sequences in the PBMC or the lymph node cells of infected
macaques. A radiolabeled primer specific for the V1 region (Env71,
nucleotides 6097 to 6120, 5'-TTATCGCCATCTTGTTTCTAAGTC-3' [sense]) was used in combination with the antisense primers
specific for the E11S or the variant sequences. The amplified product, which was 397 bp in length, was resolved by electrophoresis on 8%
nondenaturing polyacrylamide gels, and the relative abundance of the
E11S-type and the variant-type sequences was determined by
autoradiography by using PIA analysis as described above. For each PCR
amplification, DNA from E11S-infected and uncloned SIVmne-infected cells were used as controls.
Lymphocyte subset analysis.
Cell surface immunofluorescence
was quantified by use of a FACScan flow cytometer and Lysis II software
(Becton Dickinson Immunocytometry Systems, San Jose, Calif.).
Lymphocyte subsets (CD4, CD8, CD2, and CD20) of whole heparinized blood
samples were evaluated by conventional methods.
Statistical analysis.
Differences in proportions were tested
by Fisher's exact test. Differences in SIV-specific antibody titers in
infected versus protected animals were tested by constructing a 95%
confidence interval for the mean of the protected animals and
determining whether the antibody level of the infected animal fell
within that interval. The mean percentage of E11S-like sequences in
intrarectally challenged animals was compared with the mean percentage
of E11S-like sequences in intravenously challenged animals
(31) by nonparametric permutation tests. Finally, declines
in CD4+ cell counts were compared between groups using
repeated measures analysis of variance with fixed group and time
factors. The statistical significance of a decline within a group was
tested using group by time interaction terms in the analysis of variance.
Protection against intrarectal challenge with homologous clone
E11S.
To determine the protective efficacy of envelope-based
vaccines against mucosal challenge, we used a combination immunization strategy that was shown previously to protect macaques against intravenous infections (16, 31). Briefly, we immunized four cynomolgus macaques first with a live recombinant vaccinia virus expressing the full-length envelope protein gp160 of SIVmne and then
with subunit gp160 as a booster immunogen. As observed previously, all
animals developed low levels of SIV-specific antibody responses (as
determined by ELISA, immunoblots, and serum neutralization assays)
after the recombinant vaccinia virus immunization. However, levels
of SIV-specific antibodies increased 10- to 30-fold after the first
subunit protein immunization (references 16 and
31 and data not shown). Four weeks after the last
booster immunization, all four immunized animals, together with
three naive controls, were challenged intrarectally with the
homologous pathogenic virus clone E11S grown on HuT 78 cells.
Infection was monitored by nested PCR, virus isolation by
coculture, anamnestic response, and seroconversion to nonvaccine antigens.
Protection against intrarectal challenge with uncloned
SIVmne.
To examine the breadth of the protective immunity,
we rechallenged all three protected animals with uncloned
SIVmne by the intrarectal route. In this experiment, we included three
additional animals (macaques 90090, 90108, and 91074) that were
immunized in parallel with the same gp160 vaccines but were protected
against E11S challenge by the intravenous route (31). All of
these animals met the following criteria for inclusion in the study:
they had been virus negative for >2 years after challenge, as
determined by nested PCR analysis and by virus isolation from PBMC
coculture, and they had shown no anamnestic response and seroconversion
to nonvaccine antigens (reference 31 and data not
shown). Lymph nodes from these animals were also examined by nested PCR
and by in situ hybridization and were shown to be virus negative (Table 1 and data not shown). All six animals were boosted again with recombinant gp160 approximately 2 years after the initial E11S challenge. Although none of these animals received any SIV antigen for
>2 years, all of them showed significant recall responses upon
receiving the booster immunization (Fig. 2c).
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Protection of Macaques against Intrarectal Infection by a
Combination Immunization Regimen with Recombinant Simian
Immunodeficiency Virus SIVmne gp160 Vaccines


![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
chemokines, and immunoglobulin A (IgA)
antibodies to p27. A protective effect was observed in animals
immunized with an attenuated recombinant vaccinia virus vector (NYVAC)
expressing SIV gag, pol, and env genes
(3). Transient infection was observed in a significant
proportion of animals after intrarectal challenge with a highly
virulent virus, SIVmac251. However, protection in this case was not
attributable to any of the measured immunological parameters.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
70 and
20°C,
respectively, until used. Lymph node biopsy specimens were obtained at
the indicated times after challenge and were frozen at
70°C for DNA
analysis or fixed for in situ hybridization and histological analyses. Animals were housed in the Washington Regional Primate Research Center
and were under the care of licensed veterinarians. All macaques were
also tested negative for the presence of simian type D retrovirus by
serology, PCR, and virus isolation. Euthanasia was performed on the
basis of the following criteria: AIDS, termination of experiment, or
deteriorating physical condition for reasons unrelated to infection.
Euthanasia was considered to be AIDS-related if the animal exhibited
peripheral blood CD4+ cell depletion and two or more of the
following conditions: wasting, untreatable diarrhea, opportunistic
infections, proliferative diseases (e.g., lymphoma), and abnormal
hematology (e.g., anemia, thrombocytopenia, or leukopenia).
![]()
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Virus isolation and nested PCR analysis of PBMC and lymph
node cells from macaques after intrarectal challenge with E11S
clone or with uncloned SIVmne

View larger version (34K):
[in a new window]
FIG. 1.
Viral load in macaques challenged intrarectally with
E11S clone (a and b) or uncloned SIVmne (c to f). The proviral load in
PBMC was determined by PCR analysis by using radiolabeled primer
incorporation (a to d). Values are expressed as copies of proviral
genome per 106 PBMC. Quantification of proviral DNA was
determined by using an external standard containing a known copy number
of SIVmne E11S proviral DNA. Plasma viral load was determined by
RT-QC-PCR (e and f) with an internally controlled template as described
in Materials and Methods.

View larger version (28K):
[in a new window]
FIG. 2.
SIV-specific antibody responses in immunized and control
macaques after challenge. Dilutions of macaque sera collected at the
indicated times were incubated with disrupted, gradient-purified SIVmne
virion proteins immobilized on microtiter plates. Endpoint titers were
defined as the reciprocal of the highest dilution that gave an optical
absorbance value at least threefold higher than the average values
obtained with SIV-negative macaque sera. Panels (a) and (b), immunized
and control animals challenged with SIVmne E11S; panels (c) and (d),
immunized and control animals challenged with uncloned SIVmne. Arrows
indicate the time of challenge.

View larger version (49K):
[in a new window]
FIG. 3.
Immunoblot analysis of SIV-specific antibody responses
in macaques challenged with SIVmne clone E11S (A) or uncloned SIVmne
(B). Macaque plasma (diluted 100-fold) was reacted with
SDS-PAGE-separated proteins from disrupted, sucrose gradient-purified
SIVmne clone E11S as described earlier (5). At various times
after SIV challenge, antibodies were detected in infected animals to
envelope surface (gp120) and transmembrane (gp32) proteins; to the Gag
proteins p28, p16, and p6; and to the Vpx protein p14. Antibodies to
gp120 and gp32 were evident in all immunized macaques on the day of
challenge (week 0). A weak antibody that cross-reacts with p28 was also
present in one control animal at week 0 (animal 92169 [panel A]).
This has occasionally been observed in naive M. fascicularis. The source of this cross-reactive antibody is
unknown.
TABLE 2.
Summary of results from challenge studies
|
SIV-specific antibody responses in immunized animals. To determine whether SIV-specific antibodies correlated with protection, we analyzed sera from immunized animals by ELISA and by virus neutralization assays. On the day of challenge with E11S, all four immunized animals showed moderate levels of SIV-specific antibodies, with titers ranging from 10- to 100-fold lower than a pooled serum sample from SIV-infected macaques (Fig. 3 and 5 and unpublished data). The three animals protected against E11S challenge had significantly higher serum antibody titers than the one that was not protected (Fig. 5b). Although none of the four animals developed an appreciable level of serum neutralizing antibodies against the homologous challenge virus E11S (Fig. 5a), their sera showed significant neutralizing activities against a heterologous virus, SIVmac251, passaged in HuT 78 cells (21a). However, there was no apparent correlation between the challenge outcome and the level of serum neutralizing antibodies in either assay.
|
Analysis of viral sequences recovered from intrarectally infected animals. To gain a better understanding of the basis for vaccine success or failure, we examined proviral sequences recovered from naive control animals infected intrarectally by the uncloned SIVmne. In an earlier study (31), we showed that the majority (85%) of the uncloned SIVmne challenge stock contained V1 sequences homologous to the molecular clone from which the vaccines were made (E11S type), with the remainder (15%) containing multiple conserved changes (the variant types). We used labeled-primer amplification analyses to identify and quantify the proportion of E11S-like and "variant"-like sequences present in infected macaques. Both PBMC and lymph node samples were analyzed. First, we focused on the earliest samples from which we were able to detect >50 copies of viral sequences per microgram of total DNA (approximately 2 × 105 cells). These also represent preseroconversion samples, thus minimizing potential complications due to immune selection. In contrast to intravenously infected animals, from which either E11S-type or the variant-type V1 sequences could be recovered in significant proportions (31), all five intrarectally infected control animals had predominantly E11S-like sequences at 2 weeks after infection (Fig. 6A). The percentage of E11S-like sequences in the latter animals ranged from 84 to 99.5%, with a median of 96.5%. The mean percentage of E11S-like sequences in intrarectally infected animals was significantly higher than that in the PBMC of animals infected intravenously with the same virus (31) (P = 0.027). Both PBMC and lymph node samples collected concurrently from the same animal showed similar percentages of E11S-like and variant-like sequences (results not shown). These findings indicate preferential transmission and/or early amplification of viruses with E11S-like V1 sequences after intrarectal exposure.
|
Clinical outcome of infection. Infected animals were monitored for 3 or more years after challenge to determine the clinical outcome of infection and the effects of immunization. They were checked periodically for lymphocyte subsets, hematology, blood chemistry, body weight, opportunistic infections, and proliferative diseases. Figure 7 summarizes their peripheral blood CD4+ cell levels and survival time after challenge.
|
| |
DISCUSSION |
|---|
|
|
|---|
We have shown that a "prime and boost" immunization regimen with recombinant SIVmne gp160 vaccines is highly effective against intrarectal challenge by the homologous virus. Our findings thus support and extend earlier observations that protection against mucosal infection by a primate lentivirus is possible through parenteral immunizations. Such protection has been obtained with live attenuated virus (11, 24, 26, 33, 34), whole killed virus (10, 25), or complex immunogens (3). Our results show that protection is also achievable with parenterally administered envelope-based vaccines. It is possible that mucosally administered vaccines may be more desirable or effective than parenteral immunizations against mucosal infection under certain conditions (see reference 25), including natural transmission. However, this remains to be demonstrated in comparative studies.
Results from the present study also support the notion that protection against mucosal infection may be more readily achievable than that against blood-borne infection. The gp160 vaccines protected macaques against intrarectal infection by the homologous E11S clone as well as the uncloned SIVmne. This is in contrast to our previous finding that the same immunization regimen protected macaques against the E11S clone significantly better than the uncloned SIVmne given intravenously. Our findings are in agreement with the result of Benson et al. (3), who observed a better clinical outcome in a significant proportion of immunized macaques after intrarectal, but not after intravenous, infection with SIVmac251. It is therefore possible that vaccine strategies that fail to protect against intravenous challenge may still have some efficacy against mucosal infection. Since mucosal infection is the primary mode of natural transmission of HIV, such findings are potentially of significance.
Several mechanisms may contribute to the enhanced efficacy of the vaccines against the uncloned virus infection by the intrarectal route compared with the intravenous route. The relative inefficiency of mucosal transmission is not likely to account for such a difference because we compensated for the low efficiency by using 500- to 1,000-fold larger virus inocula for intrarectal challenges so that the same AID was used as for intravenous challenges. It is possible that, for a finite but significant time after the initial exposure, the infection is restricted locally in animals challenged through mucosal routes (37) and the process of dissemination is delayed compared with those challenged intravenously. The recall response in immunized animals would be better able to control and perhaps eradicate localized infection after mucosal exposure and before disseminated infection could be established.
Alternatively, the enhanced efficacy of the vaccines against intrarectal challenge by the uncloned SIVmne may be due to selective transmission and amplification of E11S-like virus after intrarectal exposure. Selective transmission and/or amplification has been proposed to account for the genotype restriction observed after natural infection with HIV-1 (36, 43, 44, 46, 47). However, due to the difficulties in obtaining both the inocula and early tissue samples (prior to seroconversion), it remains unclear to what extent such restriction is caused by sequestration of the donor's virus (12, 48) and/or selection by the recipient's immune responses (20). Although results from different investigators vary, studies in animal models have provided the most definitive evidence for selective transmission and/or amplification after intravaginal (13, 23, 27, 29) or intrarectal infection (40, 41) with SIV or SHIV chimeras. Our present findings are in agreement with these earlier reports and provide a strong indication for the preferential transmission and amplification of E11S-like viruses after intrarectal exposure. At present, we cannot distinguish between these two possible mechanisms for the enrichment of E11S-like viruses. However, since two of the six control macaques showed a rapid reversal from E11S-like viruses to variant types during the first month of infection, preferential amplification alone is not likely to account for the predominance of E11S-like viruses at 2 weeks after intrarectal exposure. It is possible that differential selective processes exist in the mucosa versus the peripheral lymph nodes, such that different viral genotypes are selected immediately after mucosal exposure or after disseminated infection has occurred. In HIV-infected individuals, viruses recovered early after infection often exhibit macrophage-tropic, "non-syncytium-inducing" phenotypes. Although there is as yet no evidence supporting preferential transmission of macrophage-tropic viruses in animals, it is of interest that a molecular clone derived from E11S (SIVmne CL8) was recently shown to be macrophage-tropic, whereas variants that evolved from CL8 and shared the same canonical variant V1 sequences as reported here were not (35). In any case, preferential transmission and/or amplification of E11S-like viruses, if confirmed, would at least partially account for the greater efficacy of the vaccine against the uncloned virus after intrarectal versus intravenous challenge. Our results therefore also point to the importance of selecting the relevant and appropriate isolates of HIV-1 for the development of candidate vaccines.
To conserve animals in the present study, we used macaques previously protected against E11S infection for the rechallenge with uncloned SIVmne. It is possible that prior exposure to virus inoculum, without resulting in an ongoing infection, may nevertheless contribute to protection against the rechallenge (9, 18, 30). We cannot exclude this possibility without a direct comparative study. However, it should be noted that we have not been able to demonstrate any sign of E11S infection in these animals by multiple and stringent assays, and we have confirmed their virus-negative status for over 2 years. Any such effect, if present, would have to be elicited by very transient and limited infection below the limit of our detection, which in itself would lend further support to the efficacy of the vaccination regimen described here. In any case, it is unlikely that any effect of prior exposure alone could account for the differential protective efficacy of vaccination against intrarectal versus intravenous challenge, since reduced efficacy was observed in intravenously challenged animals regardless of whether they were challenged for the first time or were protected against E11S and rechallenged (31).
Although we are not able to address the mechanism of protection in this relatively small study, it is of interest to note that in both challenge studies the only immunized animal that became infected had the lowest titer of SIV-specific serum antibodies as determined by ELISA. The only animal infected after the uncloned SIVmne challenge also had significantly lower serum neutralizing antibodies than the protected animals. However, there was no significant difference in the serum neutralizing titers between the protected animal and those infected with E11S, perhaps due to the relative insensitivity of this assay. The apparent correlation between SIV-specific antibody titers (and perhaps serum neutralizing activities) and protection contradicts findings from our previous studies in which no such correlation was observed with the intravenous route of challenge (31). The basis for such a discrepancy is not clear. However, it is possible that the kinetics and the initial events after intravenous or intrarectal infection are sufficiently different that the quantitative or qualitative requirements for immune protection may also differ. In this context, it is of interest to note that the only immunized animal from which the vaginal washes were analyzed had levels of SIV-specific IgG and IgA comparable to those present in chronically infected animals (21). It is possible that SIV-specific antibodies, including neutralizing antibodies, could be present in mucosal sites such as vaginal and rectal surfaces as a result of transudation and, if so, may contribute to protection against challenge at these sites. It is also possible that other effector mechanisms (such as T-helper cells, cytotoxic T lymphocytes, and antibody-dependent cellular cytotoxicity) may contribute to protection, especially in those animals with no apparent neutralizing antibodies.
Over the past decade, a number of clinical trials have been undertaken to examine the safety and immunogenicity of envelope-based vaccines, including those in combination regimens similar to those described here. The potential efficacy of these vaccines is unknown, but it has been the subject of much controversy. Results from the present study are therefore of potential importance in this regard. They indicate that parenterally administered envelope-based vaccines, when given in a combination immunization regimen, may elicit protection against mucosal infection by a pathogenic uncloned virus. Furthermore, contrary to some previous indications, protection may be achieved more easily against mucosal infections than against blood-borne infections. Although it remains to be determined whether and to what extent these findings will be applicable to the development of HIV-1 vaccines, our results provide a strong basis for further improvements and testing of recombinant vaccines in combination immunization strategies.
| |
ACKNOWLEDGMENTS |
|---|
We thank Randy Nolte, LaRene Kuller, and Tom Beck for assistance with veterinary studies; Susan Gallinger, Kia Kornas, Lynda Misher, Walter Knott, and Richard Hill for expert technical assistance; Bryan Kennedy for flow cytometry analysis; Sridhar Pennathur, Gail Sylva, and Jim Klaniecki for the preparation of immunogens; Bruce Travis and Andy Watson for advice on QC-PCR analyses; Li Wang for statistical analysis; Julie Overbaugh for critical reading of the manuscript; and Kate Elias and Marjorie Domenowske for manuscript preparation.
This work was supported in part by NIH grants AI26503 and RR00166 and by NIH contracts AI65302 and NCI-6S-1649.
| |
FOOTNOTES |
|---|
* Corresponding author. Present address: Department of Pharmaceutics and Regional Primate Research Center, Box 357331, University of Washington, Seattle, WA 98195. Phone: (206) 221-4939. Fax: (206) 543-3204. E-mail: hus{at}u.washington.edu.
Present address: Sequim, Wash.
Present address: NIAID, Rockville, Md.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Almond, N. M., and J. L. Heeney. 1998. AIDS vaccine development in primate models. AIDS 12:S133-S140. |
| 2. | Arthur, L. O., J. W. Bess, Jr., R. G. Urban, J. L. Strominger, W. R. Morton, D. L. Mann, L. E. Henderson, and R. E. Benveniste. 1995. Macaques immunized with HLA-DR are protected from challenge with simian immunodeficiency virus. J. Virol. 69:3117-3124[Abstract]. |
| 3. |
Benson, J.,
C. Chougnet,
M. Robert-Guroff,
D. Montefiori,
P. Markham,
G. Shearer,
R. C. Gallo,
M. Cranage,
E. Paoletti,
K. Limbach,
D. Venzon,
J. Tartaglia, and G. Franchini.
1998.
Recombinant vaccine-induced protection against highly pathogenic simian immunodeficiency virus SIVmac251 dependence on route of challenge exposure.
J. Virol.
72:4170-4182 |
| 4. |
Benveniste, R. E.,
L. O. Arthur,
C. C. Tsai,
R. Sowder,
T. D. Copeland,
L. E. Henderson, and S. Oroszlan.
1986.
Isolation of a lentivirus from a macaque with lymphoma: comparison with HTLV-III/LAV and other lentiviruses.
J. Virol.
60:483-490 |
| 5. |
Benveniste, R. E.,
W. R. Morton,
E. A. Clark,
C. C. Tsai,
H. D. Ochs,
J. M. Ward,
L. Kuller,
W. B. Knott,
R. W. Hill,
M. J. Gale, and M. E. Thouless.
1988.
Inoculations of baboons and macaques with simian immunodeficiency virus/Mne, a primate lentivirus closely related to human immunodeficiency virus type 2.
J. Virol.
62:2091-2101 |
| 6. | Benveniste, R. E., D. Raben, R. Hill, W. Knott, J. E. Drummond, L. O. Arthur, P. B. Jahrling, W. R. Morton, L. E. Henderson, and G. Heidecker. 1989. Molecular characterization and comparison of simian immunodeficiency virus isolates from macaques, mangabeys, and African green monkeys. J. Med. Primatol. 18:287-303[Medline]. |
| 7. | Benveniste, R. E., R. W. Hill, L. J. Eron, U. M. Csaikl, W. B. Knott, L. E. Henderson, R. C. Sowder, K. Nagashima, and M. A. Gonda. 1990. Characterization of clones of HIV-1 infected HuT78 cells defective in gag gene processing and of SIV clones producing large amounts of envelope glycoprotein. J. Med. Primatol. 19:351-366[Medline]. |
| 8. | Benveniste, R. E., L. Kuller, S. T. Rodman, S.-L. Hu, and W. R. Morton. 1993. Long-term protection of macaques against high-dose type D retrovirus challenge after immunization with recombinant vaccinia virus expressing envelope glycoproteins. J. Med Primatol. 22:74-79. |
| 9. | Clerici, M., E. A. Clark, P. Polacino, I. Axberg, N. I. Casey, W. R. Morton, G. M. Shearer, and R. E. Benveniste. 1994. T-cell proliferation to subinfectious SIV correlates with lack of infection after challenge of macaques. AIDS 8:1391-1395[Medline]. |
| 10. | Cranage, M. P., A. Baskerville, L. A. Asworth, M. Dennis, N. Cook, S. Sharpe, G. Farrar, J. Rose, P. A. Kitchin, and P. J. Greenaway. 1992. Intrarectal challenge of macaques vaccinated with formalin-inactivated simian immunodeficiency virus. Lancet 339:273-274[Medline]. |
| 11. | Cranage, M. P., A. M. Whatmore, S. A. Sharpe, N. Cook, N. Polyanskaya, S. Leech, J. D. Smith, E. W. Rud, M. J. Dennis, and G. A. Hall. 1997. Macaques infected with live attenuated SIVmac are protected against superinfection via the rectal mucosa. Virology 229:143-154[Medline]. |
| 12. |
Delwart, E. L.,
J. I. Mullins,
P. Gupta,
G. H. Learn, Jr.,
M. Holodniy,
D. Katzenstein,
B. D. Walker, and M. K. Singh.
1998.
Human immunodeficiency virus type 1 populations in blood and semen.
J. Virol.
72:617-623 |
| 13. | Enose, Y., M. Okada, T. Sata, W. Ma, T. Igarashi, K. Ibuki, E. Ido, and M. Hayami. 1997. Restriction of viral population by intravaginal infection of simian immunodeficiency viruses in macaque monkeys. Arch. Virol. 142:37-51[Medline]. |
| 14. | Heidecker, G., H. Muñoz, P. Lloyd, D. Hodge, F. W. Ruscetti, W. R. Morton, S.-L. Hu, and R. E. Benveniste. 1998. Macaques infected with cloned simian immunodeficiency virus show recurring nef gene alterations. Virology 249:260-274[Medline]. |
| 15. | Hirsch, V. M., G. Dapolito, P. R. Johnson, W. R. Elkins, W. T. London, S. Goldstein, R. Montali, and C. Brown. 1994. Induction of AIDS by simian immunodeficiency virus from an African green monkey: species-specific variation in pathogenicity correlates with extent of in vivo replication. J. Virol. 69:955-967[Abstract]. |
| 16. |
Hu, S.-L.,
K. Abrams,
G. N. Barber,
P. Moran,
J. M. Zarling,
A. J. Langlois,
L. Kuller,
W. R. Morton, and R. E. Benveniste.
1992.
Protection of macaques against SIV infection by subunit vaccines of SIV envelope glycoprotein gp160.
Science
255:456-459 |
| 17. | Hu, S.-L., V. Stallard, K. Abrams, G. N. Barber, L. Kuller, A. J. Langlois, W. R. Morton, and R. E. Benveniste. 1993. Protection of vaccinia-primed macaques against SIVmne infection by combination immunization with recombinant vaccinia virus and SIVmne gp160. J. Med. Primatol. 22:92-99[Medline]. |
| 18. |
Kent, S. J.,
S.-L. Hu,
L. Corey,
W. R. Morton, and P. D. Greenberg.
1996.
Detection of simian immunodeficiency virus (SIV)-specific CD8+ T cells in macaques protected from SIV challenge by prior SIV subunit vaccination.
J. Virol.
70:4941-4947 |
| 19. | Klaniecki, J., T. Dykers, B. M. Travis, R. Schmitt, M. Wain, A. J. Watson, P. Sridhar, J. McClure, B. Morein, J. T. Ulrich, S.-L. Hu, and J. B. Lewis. 1991. Cross-neutralizing antibodies in rabbits immunized with HIV-1 gp160 purified from simian cells infected with recombinant vaccinia virus. AIDS Res. Hum. Retroviruses 7:791-797[Medline]. |
| 20. |
Koup, R. A.,
J. T. Safrit,
Y. Cao,
C. A. Andrews,
G. McLeod,
W. Borkowsky,
C. Farthing, and D. D. Ho.
1994.
Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome.
J. Virol.
68:4650-4655 |
| 20a. | Kuller, L. R. Unpublished data. |
| 21. | Kuller, L. R., J. Thompson, R. Watanabe, D. Iskandriati, C. E. Alpers, W. R. Morton, and M. Agy. 1998. Mucosal antibody expression following rapid SIVmne dissemination in intrarectally infected Macaca nemestrina. AIDS Res. Hum. Retroviruses 14:1345-1356[Medline]. |
| 21a. | Langlois, A. J. Unpublished data. |
| 22. | Lehner, T., Y. Wang, M. Cranage, L. A. Bergmeier, E. Mitchell, L. Tao, G. Hall, M. Dennis, N. Cook, R. Brookes, L. Klavinskis, I. Jones, C. Doyle, and R. Ward. 1996. Protective mucosal immunity elicited by targeted iliac lymph node immunization with a subunit SIV envelope and core vaccine in macaques. Nat. Med. 2:767-775[Medline]. |
| 23. | Lu, Y., P. Brosio, M. Lafaile, J. Li, R. G. Collman, J. Sodroski, and C. J. Miller. 1996. Vaginal transmission of chimeric simian/human immunodeficiency viruses in rhesus macaques. J. Virol. 70:3045-3050[Abstract]. |
| 24. | Marthas, M. L., C. J. Miller, S. Sutjipto, J. Higgins, J. Torten, B. L. Lohman, R. E. Unger, R. A. Ramos, H. Kiyono, J. R. McGhee, P. A. Marx, and N. C. Pedersen. 1992. Efficacy of live-attenuated and whole-inactivated simian immunodeficiency virus vaccines against vaginal challenge with virulent SIV. J. Med. Primatol. 21:99-107[Medline]. |
| 25. |
Marx, P. A.,
R. W. Compans,
A. Gettie,
J. K. Stass,
R. M. Gilley,
M. J. Mulligan,
G. V. Yamschivock,
D. Chen, and J. H. Eldridge.
1993.
Protection against vaginal SIV transmission with microencapsulated vaccine.
Science
260:1323-1327 |
| 26. | Miller, C. J., M. B. McChesney, X. Lu, P. J. Dailey, C. Chutkowski, D. Lu, P. Brosio, B. Roberts, and Y. Lu. 1997. Rhesus macaques previously infected with simian/human immunodeficiency virus are protected from vaginal challenge with pathogenic SIVmac239. J. Virol. 71:1911-1921[Abstract]. |
| 27. |
Miller, C. J.,
M. Marthas,
J. Greenier,
D. Lu,
P. J. Dailey, and Y. Lu.
1998.
In vivo replication capacity rather than in vitro macrophage tropism predicts efficiency of vaginal transmission of simian immunodeficiency virus or simian/human immunodeficiency virus in rhesus macaques.
J. Virol.
72:3248-3258 |
| 28. |
Montefiori, D. C.,
W. E. Robinson,
S. S. Schuffman, and W. M. Mitchell.
1988.
Evaluation of antiviral drugs and neutralizing antibodies to human immunodeficiency virus by a rapid and sensitive microtiter infection assay.
J. Clin. Microbiol.
26:231-235 |
| 29. | Neildez, O., R. Le Grand, P. Caufour, B. Vaslin, A. Cheret, F. Matheux, F. Theodoro, P. Roques, and D. Dormont. 1998. Selective quasispecies transmission after systemic or mucosal exposure of macaques to simian immunodeficiency virus. Virology 243:12-20[Medline]. |
| 30. | Pauza, C. D., P. Emau, M. S. Salvato, P. Trivedi, D. MacKenzie, M. Malkovsky, H. Uno, and K. T. Schultz. 1993. Pathogenesis of SIVmac251 after atraumatic inoculation of the rectal mucosa in rhesus monkeys. J. Med. Primatol. 22:154-161[Medline]. |
| 31. |
Polacino, P.,
V. Stallard,
J. E. Klaniecki,
D. C. Montefiori,
A. J. Langlois,
B. A. Richardson,
J. Overbaugh,
W. R. Morton,
R. E. Benveniste, and S.-L. Hu.
1999.
Limited breadth of the protective immunity elicited by SIVmne gp160 vaccines in a combination immunization regimen.
J. Virol.
73:618-630 |
| 32. |
Polacino, P. S.,
H. A. Liang,
E. J. Firpo, and E. Clark.
1993.
T-cell activation influences initial DNA synthesis of simian immunodeficiency virus in resting T lymphocytes from macaques.
J. Virol.
67:7008-7016 |
| 33. | Putkonen, P., B. Makitalo, D. Bottinger, G. Biberfeld, and R. Thorstensson. 1997. Protection of human immunodeficiency virus type 2-exposed seronegative macaques from mucosal simian immunodeficiency virus transmission. J. Virol. 71:4981-4984[Abstract]. |
| 34. | Quesada-Rolander, M., B. Makitalo, R. Thorstensson, Y. J. Zhang, E. Castanos-Velez, G. Biberfeld, and P. Putkonen. 1996. Protection against mucosal SIVsm challenge in macaques infected with a chimeric SIV that expresses HIV type 1 envelope. AIDS Res. Hum. Retroviruses 12:993-999[Medline]. |
| 35. |
Rudensey, L.,
J. T. Kimata,
E. M. Long,
B. Chackerian, and J. Overbaugh.
1998.
Changes in the extracellular envelope glycoprotein of variants that evolve during the course of simian immunodeficiency virus SIVmne infection affect neutralizing antibody recognition, syncytium formation, and macrophage tropism but not replication, cytopathicity, or CCR-5 coreceptor recognition.
J. Virol.
72:209-217 |
| 36. | Soto-Ramirez, L. E., B. Renijifo, M. F. McLane, R. Marlick, C. O'Hara, R. Sutthent, C. Wasi, P. Vithayasai, V. Vithayasai, C. Apichartpiyakul, P. Auewarakul, V. P. Cruz, D. S. Chui, R. Osathanondh, K. Mayer, T. H. Lee, and M. Essex. 1996. HIV-1 Langerhans' cell tropism associated with heterosexual transmission of HIV. Science 271:1291-1293[Abstract]. |
| 37. |
Spira, A. I.,
P. A. Marx,
B. K. Patterson,
J. Mahoney,
R. A. Koup,
S. M. Wolinsky, and D. D. Ho.
1996.
Cellular targets of infection and route of viral dissemination after an intravaginal inoculation of simian immunodeficiency virus into rhesus macaques.
J. Exp. Med.
183:215-225 |
| 38. | Stott, E. J., P. A. Kitchin, M. Page, B. Flanagan, L. F. Taffs, W. L. Chan, K. H. G. Mills, P. Silvera, and A. Rodgers. 1991. Anti-cell antibody in macaques. Nature 353:393[Medline]. |
| 39. | Stott, E. J., S.-L. Hu, and N. Almond. 1998. Candidate vaccines protect macaques against primate immunodeficiency viruses. AIDS Res. Hum. Retroviruses 14:S265-S270. |
| 40. |
Trivedi, P.,
K. K. Meyer,
D. N. Streblow,
B. L. Preuninger,
K. T. Schultz, and C. D. Pauza.
1994.
Selective amplification of simian immunodeficiency virus genotypes after intrarectal inoculation of rhesus macaques.
J. Virol.
68:7649-7653 |
| 41. |
Trivedi, P.,
D. Horejsh,
S. B. Hinds,
P. W. Hinds II,
M. S. Wu,
M. S. Salvato, and C. D. Pauza.
1996.
Intrarectal transmission of simian immunodeficiency virus in rhesus macaques: selective amplification and host responses to transient or persistent viremia.
J. Virol.
70:6876-6883 |
| 42. | Watson, A., J. Ranchalis, B. Travis, J. McClure, W. Sutton, P. R. Johnson, S.-L. Hu, and N. L. Haigwood. 1997. Plasma viremia in macaques infected with simian immunodeficiency virus: plasma viral load early in infection predicts survival. J. Virol. 71:284-290[Abstract]. |
| 43. | Wolfs, T. F., G. Zwart, M. Bakker, and J. Goudsmit. 1992. HIV-1 genomic RNA diversification following sexual and parenteral virus transmission. Virology 189:103-110[Medline]. |
| 44. |
Wolinsky, S. M.,
C. M. Wike,
B. T. Korber,
C. Hutto,
W. P. Parks,
L. L. Rosemblum,
K. J. Kunstman,
M. R. Furtado, and J. L. Muñoz.
1992.
Selective transmission of human immunodeficiency virus type-1 variants from mothers to infants.
Science
255:1134-1137 |
| 45. | World Health Organization. 1998. WHO report on the global HIV/AIDS epidemic. World Health Organization, Geneva, Switzerland. |
| 46. |
Zhang, L. Q.,
P. MacKenzie,
A. Cleland,
E. C. Holmes,
A. J. L. Brown, and P. Simmonds.
1993.
Selection for specific sequences in the external envelope protein of human immunodeficiency virus type 1 upon primary infection.
J. Virol.
67:3345-3356 |
| 47. | Zhu, T., H. Mo, N. Wang, D. S. Nam, Y. Cao, R. A. Koup, and D. D. Ho. 1993. Genotypic and phenotypic characterization of HIV-1 in patients with primary infection. Science 261:1179-1181. |
| 48. | Zhu, T., N. Wang, A. Carr, D. S. Nam, R. Moor-Jankowski, D. A. Cooper, and D. D. Ho. 1996. Genetic characterization of human immunodeficiency virus type 1 in blood and genital secretions: evidence for viral compartmentalization and selection during sexual transmission. J. Virol. 70:3098-3107[Abstract]. |
This article has been cited by other articles: