Previous Article | Next Article 
Journal of Virology, April 1999, p. 3023-3031, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Human Immunodeficiency Virus Types 1 and 2 Differ in the
Predominant Mechanism Used for Selection of Genomic RNA for
Encapsidation
Jane F.
Kaye* and
Andrew M. L.
Lever
Department of Medicine, University of
Cambridge, Addenbrooke's Hospital, Cambridge, United Kingdom
Received 30 September 1998/Accepted 18 January 1999
 |
ABSTRACT |
Retroviral RNA encapsidation is a highly selective process mediated
through recognition by the viral Gag proteins of cis-acting RNA packaging signals in genomic RNA. This RNA species is also translated, producing the viral gag gene products. The
relationship between these processes is poorly understood. Unlike that
of human immunodeficiency virus type 1 (HIV-1), the dominant packaging signal of HIV-2 is upstream of the major splice donor and
present in both unspliced and spliced viral RNAs, necessitating
additional mechanisms for preferential packaging of unspliced genomic
RNA. Encapsidation studies of a series of HIV-2-based vectors showed efficient packaging of viral genomes only if the unspliced,
encapsidated RNA expressed full-length Gag protein, including
functional nucleocapsid. We propose a novel encapsidation initiation
mechanism, providing selectivity, in which unspliced HIV-2 RNA is
captured in cis by the Gag protein. This has implications
for the use of HIV-2 and other lentiviruses as vectors.
 |
INTRODUCTION |
Newly transcribed unspliced
retroviral RNA has two possible roles in the cytoplasm of the infected
cell: it has a coding function as message for translation of the viral
gag and (in all except foamy viruses) pol gene
products and it harbors cis-acting signals that allow it to
be encapsidated by Gag polyprotein during virus assembly. This latter
requires interactions between sequence- and structure-specific motifs
on the unspliced RNA (known as psi or E) and the Gag polyprotein.
Mutational analyses of the nucleocapsid (NC) domain of Gag have
demonstrated the pivotal importance of the zinc finger motifs and basic
flanking residues for encapsidation of the viral genomic RNA (6,
9, 11, 12, 36). However, newer data have implicated the P2 domain
of human immunodeficiency virus type 1 (HIV-1) as contributing to
RNA selection (18). In vitro binding studies have shown that
the Gag polyprotein and the NC domain bind to RNA containing HIV-1
packaging sequences (2, 3, 5, 6, 35).
Three possible models can be invoked to explain the relationship
between translation and encapsidation of unspliced retroviral RNA (Fig.
1). Model 1, any unspliced RNA can be
either translated or encapsidated. Model 2, unspliced RNA is sorted
into two nonequilibrating pools, one for translation and one for
encapsidation. Model 3, unspliced RNA can only be encapsidated after it
has been translated. Studies with Moloney murine leukemia virus
(M-MuLV) suggested that unspliced M-MuLV RNA exists in two
nonequilibrating pools (23, 24) (i.e., model 2). Recent
studies of the relationship between translation and encapsidation in
HIV-1 suggest that unspliced HIV-1 RNA can act as both mRNA and
genomic RNA (3a). McBride and coauthors reported that
translation of gag in cis was not necessary for
efficient encapsidation of HIV-1 RNA (27), and HIV-1
is successfully used as a vector (33, 32, 29). These results
indicate that unspliced HIV-1 RNA can act as both message and
genomic RNA (i.e., model 1).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Possible sorting mechanisms involved in translation and
encapsidation of full-length retroviral RNA.
|
|
The packaging signal region of HIV-1 has been extensively mapped by
deletion mutagenesis and secondary structure analysis (1, 4, 14,
16, 22, 26). The core packaging signal is composed of a series of
stem-loops spanning the major splice donor (15). One of
these (SL3) is essential for efficient encapsidation of HIV-1
genomic RNA. The packaging signal region of HIV-2 has been less
fully characterized. Deletion analyses of the 5' untranslated region of
HIV-2 showed that sequences upstream of the major splice donor were
required for efficient encapsidation of HIV-2 RNA, whereas
sequences downstream of the splice donor appeared to be less important
(28). Other studies of the HIV-2 packaging signal region
have suggested that sequences downstream of the major splice donor
function both in packaging (30) and as a negative regulatory element (10).
The packaging signal regions of HIV-1 and HIV-2 have little
sequence homology, although conserved GGNGR motifs can be identified (15). By contrast, the amino acid sequences of their NC
domains are very similar and they exhibit conservative substitutions. We previously demonstrated that there is a nonreciprocal
relationship between the RNA packaging of HIV-1 and HIV-2
(18). HIV-1 helper virus was able to
encapsidate both HIV-1- and HIV-2-based vectors. However, unspliced HIV-1 vector RNA was preferentially
packaged, whereas both unspliced and spliced HIV-2 vector RNAs were
packaged relative to their respective levels in the cell. This is
consistent with the HIV-2 packaging signal being present on both
species of RNA and that of HIV-1 being on the unspliced RNA alone.
HIV-2 helper virus did not package HIV-1 vector RNA but,
surprisingly, was also unable to act as a helper virus to package
HIV-2-based vectors. In the present study, we have further mapped
sequences required for efficient encapsidation of HIV-2 RNA and, in
addition, confirmed the lack of important cis-acting
functions at the 3' ends of the gag and pol
genes. We find that efficient encapsidation of HIV-2 RNA requires
cotranslation of Gag protein containing a functional NC domain. We
propose that efficient packaging of HIV-2 RNA begins via a
mechanism in which the unspliced RNA is translated and the nascent Gag
polyprotein binds to the packaging signal on the translated RNA.
Further Gag polyprotein recruitment then follows. This model, in which
selection of RNA for packaging occurs preferentially in cis,
would provide the required selectivity for unspliced RNA in a system in
which the packaging signal is present on all of the HIV-2 messages.
 |
MATERIALS AND METHODS |
Plasmid construction.
pSVR is an infectious proviral clone
of HIV-2 ROD containing a simian virus 40 origin of replication
(28). Restriction sites, where given, refer to the first
nucleotide of the viral RNA. Proviral constructs with deletions
in their 5' untranslated regions, pSVR
1, pSVR
2, pSVR
3, and
pSVR
4, have been previously described (28) and are shown
in Fig. 2A. pSVR
AX has been
previously described (18). Briefly, the sequences between
AccI (position 912) and XbaI (position 5067) were
deleted. This and other vectors are shown in Fig. 3A. pSVR
HX was
constructed by deleting the sequences between HindIII
(position 1458) and XbaI (position 5067). pSVR
pol was
constructed by deletion of the sequences between XhoI
(position 2032) and XbaI (position 5067). A translation stop
codon was introduced at the HindIII site (position 1458)
of pSVR
pol by filling in the 5' overhanging ends of the
HindIII site with Klenow polymerase and religating the
blunt ends. The resulting construct was called pSVR
H
pol. The NC
mutant, pSVR
polNCm, was constructed by oligonucleotide-directed mutagenesis (21) using the mutagenic oligonucleotides
5'
AGAAAGGCATTTAAAGCCTGGAACGCTGGAAAGGAAGGGGCCTCGGCAAGACAAGCCCGAGCACCTA 3' and 5'
GAAGGCAGGG CGCCTGGAAGGCTGGTAAGCCAGGAGCCATCATGACAAACGCCCC AGATAGACAGGCA
3'. The underlined sequences in the mutagenic oligonucleotides substituted alanines for cysteine and histidine residues in the two
zinc fingers of the HIV-2 NC domain. The resulting construct was
subjected to nucleotide sequencing to confirm the mutated sequences. All HIV-2-based plasmids were grown in TOP10F'
(Invitrogen) at 30°C to minimize recombination. All other plasmids
were grown in DH5
.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Sequences upstream of the splice donor are required for
efficient encapsidation of HIV-2 RNA. (A) Leader sequence of
HIV-2 showing sites of deletions: 1 (nt 359 to 385), 2 (nt
392 to 434), 3 (nt 499 to 526), and 4 (nt 494 to 533). SD, splice
donor. (B) Predicted sizes of the protected fragments in RPA of
wild-type and deletion mutant RNA. (C) RNase protection analysis, using
the KS2 KE riboprobe. Protection with control RNA (yeast RNA) and
with the riboprobe without RNase treatment (input probe) is shown
(lanes 9 and 10, respectively). The positions of RNA size markers (lane
11) are shown in nucleotides.
|
|
Plasmids used as templates for production of riboprobes were
constructed as follows. KS2ES and KS2
KE have been previously described (18). They contain HIV-2 sequences from
positions 4915 to 5284 and 306 to 751, respectively, cloned into the
polylinker of Bluescript KSII (Stratagene). Plasmid KS2HIV-2
contains the HIV-2 sequences from PstI (position
107)
to BglI (position 503) cloned into the polylinker site of
Bluescript KSII. In vitro transcription of the linearized plasmids
using T3 RNA polymerase yields antisense riboprobes for use in RNase
protection assays (RPA).
Cell culture and transfections.
COS-1 cells were maintained
in Dulbecco's modified Eagle's medium supplemented with 10% fetal
calf serum, penicillin, and streptomycin. Transient transfection of
COS-1 cells was performed by the DEAE-dextran method (37).
Cells and supernatants were harvested 48 to 72 h later. Viral
particle production was measured by reverse transcriptase assay
(31).
Protein analysis.
COS-1 cells were metabolically labelled
with [35S]methionine (>1,000 Ci/mmol) from 44 to 48 h after transfection. Labelled cells were lysed in
radioimmunoprecipitation assay (RIPA) buffer (140 mM NaCl, 8 mM
Na2HPO4, 2 mM NaH2PO4,
1% Nonidet P-40, 0.5% sodium deoxycholate, 0.05% sodium dodecyl
sulfate [SDS]). Virions released into the supernatant were pelleted
by centrifugation for 15 min at 4°C and 80,000 rpm in a Beckman
TLA-100 rotor. Pelleted virions were lysed in RIPA buffer, and cell and
virion lysates were immunoprecipitated with serum from a panel of
HIV-2-infected individuals (MRC AIDS Reagent Project) prior to
analysis through 5 to 20% acrylamide-SDS gradient gels (Bio-Rad).
RNA isolation.
Cytoplasmic RNA was obtained by rapid lysis
at 4°C in Nonidet P-40 buffer (50 mM Tris-Cl [pH 8.0], 100 mM NaCl,
5 mM MgCl2, 0.5% [vol/vol] Nonidet P-40). Cell debris
and nuclei were removed by a 2-min centrifugation step in a
microcentrifuge. The supernatant was adjusted to 0.2% SDS and 125 µg
of proteinase K per ml, incubated at 37°C for 15 min, and extracted
twice with acid-buffered phenol-chloroform (pH 4.7) and once with
chloroform. Nucleic acids were collected by ethanol precipitation, and
RNA was stored at
80°C. For RNA extraction from virions, particles
released from the cell culture supernatant were pelleted by
polyethylene glycol (PEG) precipitation by the addition of 0.5 volumes
of 30% PEG 8000 in 0.4 M NaCl for 16 h at 4°C. The precipitate
was collected by centrifugation at 2,000 rpm in an MSE 43124-129 rotor
at 4°C for 45 min and resuspended in 0.5 ml of TNE (10 mM Tris-Cl,
150 mM NaCl, 1 mM EDTA [pH 7.5]). This material was layered over an
equal volume of TNE containing 20% sucrose and centrifuged at
98,000 × g for 2 h at 4°C. Virus particles were
lysed in proteinase K buffer (50 mM Tris-Cl [pH 7.5], 100 mM NaCl, 10 mM EDTA, 1% SDS, 100 µg of proteinase K per ml, 100 µg of tRNA per
ml) for 30 min at 37°C. After two extractions with acid-buffered
phenol-chloroform and one extraction with the chloroform, the RNA
was precipitated with ethanol and stored at
80°C. The
isolated RNA was resuspended in 100 µl of a buffer containing 10 mM Tris-Cl (pH 8.0), 1 mM EDTA, 10 mM MgCl2, 1 mM dithiothreitol, 5 U of RNase-free DNase I (Promega), and 4 U of RNase
inhibitor (Promega) and incubated at 37°C for 15 min. The reaction
was stopped by the addition of 25 µl of a solution containing 50 mM
EDTA, 1.5 M sodium acetate, and 1% SDS, and the samples were extracted
once with acid-buffered phenol-chloroform and once with chloroform. The
RNA was precipitated with ethanol.
RPA.
32P-labelled riboprobes were synthesized by
in vitro transcription of linearized plasmids, using T3 RNA polymerase
(Promega). Riboprobes were purified from 5% polyacrylamide-8 M urea
gels prior to use in RPA.
Reagents for RPA were obtained from a commercially available kit
(Ambion, Austin, Tex.). Cytoplasmic RNA or RNA extracted from pelleted
particles representing 1/3 of the transfected cells was incubated with
2 × 105 cpm of 32P-labelled probe in 10 µl of hybridization buffer (Ambion) for 10 min at 68°C.
Unhybridized regions of the probe were then degraded by the addition of
0.5 U of RNase A and 20 U of RNase T1 in 100 µl of RNase
digestion buffer (Ambion). Protected fragments were precipitated in
ethanol, resuspended in RNA loading buffer, and separated on 5%
polyacrylamide-8 M urea gels. For size determination, 32P-labelled RNA markers synthesized with the RNA Century
Marker template set (Ambion) were run in parallel. The gels were
subjected to autoradiography, and the radioactivity was counted by
real-time analysis with an Instant Imager (Packard).
 |
RESULTS |
Sequences upstream of the splice donor of HIV-2 are required
for efficient genomic RNA encapsidation.
Deletion analyses of the
5' untranslated region of HIV-2 have previously identified
sequences that are required for efficient encapsidation of HIV-2
RNA (28). However, there remains controversy over the exact
location of the packaging signal in HIV-2 (10). Consequently, we further characterized the effect of deletions in the
HIV-2 5' untranslated region by using competitive RPA. Competitive
RPA measure the relative levels of encapsidation of coexpressed
vector and helper constructs and thus have the benefit of
controlling for intersample variations. Proviral clones containing mutated 5' untranslated regions (Fig. 2A) were cotransfected into COS-1
cells with wild-type virus as an internal control, and cytoplasmic and
virion RNAs were subjected to RPA to determine the effects of the
mutations on RNA encapsidation efficiency. The results are shown in
Fig. 2C and Table 1. The relative levels
of wild-type and mutant unspliced RNA in each virion sample were
normalized to the relative levels in the corresponding transfected
cells. Deletion of the region upstream of the splice donor is seen to cause a significantly greater packaging defect than that downstream. Although this has been demonstrated previously, the quantitative nature
of the RPA consolidates this observation. In addition, it is important
to observe that the presence of cotransfected helper virus does not
increase packaging of the deletion mutants nor does the presence of the
deletion mutants affect packaging of wild-type virus. This supports the
scheme outlined below that packaging initiation is occurring in
cis and is unaffected by the presence of Gag available in
trans.
HIV-2 vectors with deletions at the 3' end of gag
are not efficiently packaged in trans.
We have previously
reported the failure of an HIV-2-based vector lacking
gag and pol sequences to be encapsidated in
trans by wild-type HIV-2 helper virus (18).
To address the reason for the failure of encapsidation of such a
vector, we constructed a series of vectors containing increasing
amounts of gag coding sequence (Fig.
3A). The HIV-2-based vectors,
pSVR
AX, pSVR
HX, and pSVR
pol, were transfected either
alone or with a wild-type HIV-2 proviral construct,
pSVR, into COS-1 cells. Cytoplasmic and virion RNAs were extracted and
subjected to RPA (results shown in Fig. 3C and Table
2). The different vectors were expressed to similar levels in the cytoplasm of the transfected cells (compare lanes 2 to 7). The vectors with the largest truncations of
gag sequence, pSVR
AX and pSVR
HX, were not
efficiently packaged by HIV-2 helper virus (lanes 10 and 12).
However, virus-like particles produced from a vector containing
almost the entire gag gene, pSVR
pol, were able to
encapsidate the vector RNA efficiently (lane 13). In addition, the
level of vector packaged did not dramatically increase when
cotransfected HIV-2 helper virus (lane 14) was present. Therefore,
there was a requirement for the region between the HindIII and XhoI sites (positions 1458 and 2032) for efficient encapsidation of HIV-2 vector RNA.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
(A) Schematic representation of helper virus and vector
constructs. LTR, long terminal repeat; , encapsidation sequences.
(B) Predicted sizes of the protected fragments for riboprobe KS2ES. (C)
RNase protection analysis using riboprobe KS2ES. The positions of
unspliced helper virus RNA (nt 369) and unspliced vector RNA (nt 217)
are indicated. Protection with control RNA (yeast RNA) and with the
riboprobe without RNase treatment (input probe) is shown (lanes 15 and
16, respectively). The positions of RNA size markers (lane 17) are
shown in nucleotides.
|
|
Requirement for translation of the C terminus of gag
for efficient encapsidation of HIV-2 RNA.
Two possible
explanations exist for the failure of efficient encapsidation of
HIV-2 vectors lacking sequences at the 3' end of gag:
(i) the presence of cis-acting packaging sequences located at the 3' end of gag (between positions 1458 and 2032)
or (ii) a trans-acting requirement for
translation of the Gag protein. To address these issues, we constructed
an HIV-2 vector with a stop codon at the HindIII
site (see Materials and Methods). The resulting vector,
pSVR
H
pol (Fig. 3A), was transfected, along with pSVR
pol,
either alone or with HIV-2 helper virus. Cytoplasmic and
virion RNAs extracted from the transfectants were subjected to
RPA (results are shown in Fig. 4A and
Table 2). The different vectors were expressed to similar levels
in the cytoplasm of the transfected cells (lanes 2 to 5). As previously
observed, pSVR
pol was able to efficiently encapsidate its own RNA.
However, pSVR
H
pol did not package its RNA when transfected alone
(lane 7). This was not surprising, as the Gag protein produced from
this vector would not be expected to assemble into virion particles
(25). Unspliced pSVR
H
pol vector RNA was packaged to a
low level by HIV-2 helper virus; however, the level of
encapsidation was greatly reduced compared to that observed for
pSVR
pol (compare lanes 8 and 10). The ability of the various vectors
to produce virus-like particles was analyzed by
immunoprecipitation of cell and virion proteins using human
anti-sera to HIV-2 (Fig. 4B). The vectors were transfected either
alone or with HIV-2 helper virus. Only pSVR
pol was able to
produce virions (Fig. 4B, lanes 15 and 20). A truncated form of Gag was
expressed in the cytoplasm of cells transfected with pSVR
H
pol
(Fig. 4B, lanes 4 and 9); however, this was not released from the cell
(Fig. 4B, lanes 14 and 19). The vectors pSVR
H
pol and pSVR
pol
contain the same cis-acting sequences and differ only in
their ability to translate the C terminus of Gag, hence, the efficiency
of vector RNA encapsidation correlates with the ability of the vector
to produce particles. Expression of a truncated form of Gag protein did
not affect the formation of wild-type particles, as protein
expression, processing, and helper virus RNA encapsidation were normal
(Fig. 4A, lane 8, and 4B, lane 19).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 4.
(A) RNase protection analysis using riboprobe KS2ES of
cytoplasmic and virion RNAs from transfections of vector competent to
make viral particles (pSVR pol) against translational stop control
(pSVR H pol) with or without helper virus. The positions of
unspliced helper virus RNA (nt 369) and of unspliced vector RNA (nt
217) are indicated. Protection with control RNA (yeast RNA) and with
the riboprobe without RNase treatment (input probe) is shown (lanes 11 and 12, respectively). The positions of RNA size markers are shown (in
nucleotides) to the right of the figure. (B) Immunoprecipitation
analysis of cellular and virion proteins produced from vectors with and
without helper virus. The molecular mass markers are shown to the left
in kilodaltons. The predicted positions of uncleaved vector-derived Gag
and cleaved helper virus-derived Gag are indicated.
|
|
Translation of Gag protein containing a functional NC domain is
required for efficient encapsidation of HIV-2 RNA.
The
previous experiments compared the encapsidation efficiencies of a
vector which could produce virus-like particles with one which could
not. We wanted to compare two vectors which could both produce
virus-like particles, one of which would be able and another which
would be unable to package its own RNA. We therefore mutated the
cysteine and histidine residues in the two zinc fingers of HIV-2 NC
to alanines (Fig. 5A). This would be
expected to disrupt the formation of the zinc fingers and impair RNA
binding by the mutant NC (6, 9, 11, 12, 36). The ability of
a proviral construct containing a mutated NC domain to package its
unspliced viral RNA was studied by RPA of cells transfected with either wild-type or mutant proviral constructs (pSVR or pSVRNCm,
respectively), and the results are shown in Fig. 5C. Unspliced and
spliced RNAs were expressed in the cytoplasm of cells transfected with
either wild-type or NC mutant constructs (Fig. 5C, lanes 2 and 3).
Wild-type HIV-2 was able to efficiently encapsidate unspliced RNA;
however, as expected, the NC mutant was unable to package viral RNA
(Fig. 5C, lanes 5 and 6). Thus, mutation of the cysteine and histidine residues in the NC domain of HIV-2 Gag was sufficient to abrogate viral RNA packaging. The failure of the mutant to package its viral RNA
was not due to a failure to produce viral particles, as the NC mutant
produced levels of reverse transcriptase activity similar to those of
wild-type HIV-2 (data not shown).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Alanine substitution of cysteine and histidine
residues in the NC region of pSVR, producing pSVRNCm. LTR, long
terminal repeat; MA, matrix; CA, capsid; NC, nucleocapsid. (B)
Predicted sizes of protected fragments using KS2HIV-2
riboprobe. SD, splice donor. (C) RNase protection analysis of
cytoplasmic and virion RNA from cells transfected with wild-type virus
or pSVRNCm. The positions of unspliced RNA (nt 503) and
spliced RNA (nt 472) are shown. Protection with control RNA (yeast RNA)
and with the riboprobe without RNase treatment (input probe) is shown
(lanes 7 and 8, respectively). The positions of RNA size markers (lane
9) are shown in nucleotides.
|
|
To compare the ability of the NC mutant and pSVR
pol to be
encapsidated in trans by HIV-2 helper virus, we deleted
the sequences between the XhoI and XbaI sites
(positions 2032 and 5067) from pSVRNCm. The ability of the vectors to
produce virus-like particles was assessed by immunoprecipitation of
cell and virion proteins from cells transfected with pSVR
pol
or pSVR
polNCm either alone or with HIV-2 helper virus (Fig. 6A).
Uncleaved vector-derived Gag was expressed in the cell and
virion samples of cells transfected with either pSVR
pol or
pSVR
polNCm (Fig. 6A, lanes 2 to 5 and 7 to 10).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6.
(A) Immunoprecipitation of cell and virion proteins
produced from cells transfected with pSVR pol or pSVR polNCm with
or without helper virus. The positions of molecular mass markers are
shown to the left in kilodaltons. The positions of uncleaved
vector-derived Gag and cleaved helper virus-derived Gag are indicated.
(B) RNase protection analysis of cytoplasmic and virion RNA from cells
transfected with pSVR pol or pSVR polNCm with or without helper
virus using riboprobe KS2ES. The positions of unspliced helper virus
RNA (nt 369) and unspliced vector RNA (nt 217) are indicated.
Protection with control RNA (yeast RNA) and with riboprobe without
RNase treatment (input probe) is shown (lanes 11 and 12, respectively).
The positions of RNA size markers (lane 13) are shown in nucleotides.
|
|
The ability of HIV-2 to encapsidate in trans the NC
mutant vector and pSVR
pol RNAs was compared. These two constructs
were transfected either alone or with HIV-2 helper virus, and the
levels of RNA encapsidation were studied by RPA (Fig. 6B). A very low level of encapsidation of NC mutant vector RNA was observed when the
vector was transfected alone (Fig. 6B, lane 9), indicating that the NC
mutant packaged its viral RNA to a greatly reduced level compared to
wild-type NC (compare lanes 7 and 9). There was a low level of
encapsidation of NC mutant vector RNA in trans by HIV-2
helper virus (Fig. 6B, lane 10). Thus, efficient encapsidation of
HIV-2 RNA requires cotranslation of Gag protein containing a
functional NC domain.
 |
DISCUSSION |
There have been relatively few studies addressing how the
unspliced species of retroviral RNA is sorted to fulfill its two functions of coding and (uniquely) forming the viral genome. Packaging of subgenomic RNA would be highly disadvantageous for the virus and, in
some viruses, it is excluded from the packaging process by having
cis-acting signals spliced out. Some viral messages such as
that of the env mRNA are targeted by their leader
sequence to be translated on the rough endoplasmic reticulum,
sequestering them away from the site of production of Gag and from
viral assembly.
Levin et al. showed, in a simple retroviral system, that unspliced RNA
which was being actively translated was unable subsequently to be
encapsidated (23, 24), suggesting that two nonequilibrating pools of RNA exist (model 2, Fig. 1). These studies did not however exclude the possibility that the production of other cellular proteins
essential to the encapsidation process had been inhibited by
actinomycin D. Another study proposed that Gag polyproteins competed with ribosomes to determine the fate of the nascent
retroviral RNA (38). The competition model proposed for
avian sarcoma and leukosis virus (ASLV) (38) would be
consistent with the MuLV results, suggesting the existence of two pools
of unspliced RNA, one for translation and one for encapsidation
(23, 24).
The efficiency of MuLV as a vector would argue that encapsidation in
cis is not required. The fact that HIV-1-based vector systems also work implies that RNA encapsidation in
trans is possible, although many vector systems include
variable lengths of gag coding region in the vector to
enhance packaging efficiency and the effect of these in targeting the
RNA to polyribosomes when Gag protein is being produced has
not been evaluated. McBride et al. analyzed an HIV-1 construct
which contained a translation stop codon in the capsid domain of Gag
(27). The unspliced RNA produced from this construct was
encapsidated by helper virus with an efficiency of 0.93 compared to
that of wild-type RNA, indicating that translation of Gag in
cis was not essential for efficient encapsidation of HIV-1 RNA.
In addition to HIV-2, a notable example of a group of
retroviruses in which the packaging signal is located upstream of the major splice donor are the ASLV group retroviruses (17, 19, 20). The 5' leader region of ASLV RNA contains three short
open reading frames (ORFs) whose size and position are conserved
(13). These ORFs have been shown to be translated
(7), and translation and encapsidation appear to be
functionally linked (7, 8).
Unlike the ASLV family, HIV-2 does not possess ORFs upstream of the
gag initiation codon. The location of the packaging signal upstream of the major splice donor necessitates a mechanism for selection of unspliced viral RNA for encapsidation into progeny virions. We previously observed the failure of an HIV-2-based vector lacking gag and pol sequences to be
encapsidated by HIV-2 helper virus. Interestingly, both
unspliced and spliced HIV-2 vector RNAs were packaged by HIV-1
helper virus (18), confirming the existence of a fully
competent packaging signal in both species upstream of the splice
donor, and suggesting that the two viruses might use different
mechanisms to select unspliced RNA for encapsidation. In the
present study, we have further analyzed the requirements for
efficient encapsidation of HIV-2 RNA and propose that HIV-2 uses a previously undescribed mechanism for selection of unspliced viral RNA for encapsidation. Analysis of a series of HIV-2-based vectors which contained increasing amounts of gag sequence
revealed that until the 3' end of gag was included, vector
RNA was packaged only poorly in virus particles. To further exclude
cis-acting signals in these regions, we compared the
packaging efficiencies of two vectors which contained identical 3'
cis-acting sequences, one of which was able to produce
full-length Gag protein and the other which produced a truncated Gag
protein. The latter did not produce viral particles and was
packaged to a greatly reduced level compared to a vector, pSVR
pol,
which contained identical cis-acting sequences but
could produce full-length gag and export particles.
Efficient RNA encapsidation thus correlated with the ability to form
virus-like particles. Analysis of an HIV-2-based vector which
produced virus-like particles but which failed to package its own
RNA, pSVR
polNCm, confirmed that a functional NC domain was
required for efficient HIV-2 RNA encapsidation.
Translation per se was not responsible for efficient encapsidation of
HIV-2 RNA, as vectors with C-terminal truncations of Gag or a
translational stop codon, were translated but were not efficiently
encapsidated. Thus, directing the unspliced viral RNA to polyribosomes
for translation is not sufficient for its efficient selection for
encapsidation. The data are thus most consistent with the hypothesis
that HIV-2 uses a novel mechanism for selection of unspliced RNA in
which Gag polyprotein translated off the unspliced viral RNA binds to
the packaging signal on the unspliced RNA that is being translated and
then directs that RNA for encapsidation into progeny virions. This
model (model 3, Fig. 1) would provide an additional selectivity
for unspliced RNA in a system in which the packaging signal is located
on both unspliced and spliced viral RNA. The stoichiometry of the
interaction involving 2 genomes/~3,000 Gag proteins clearly would
not allow every full-length viral RNA to be encapsidated, and we
therefore propose a scheme in which an initial Gag-RNA interaction
occurs in cis and provides a nucleation site for further
assembly of Gag polyproteins. These would assemble on the initial
complex at an as yet undefined subcellular location between the
polyribosomes and the plasma membrane. The interaction would involve
Gag monomers binding to each other through their major homology
regions and aligning their NC subdomains, which are known to bind RNA
without sequence specificity, along the viral genome. A recent
study (30) suggests that HIV-2-based vectors can be
packaged in trans. These studies, however, did not compare
spliced and unspliced helper virus RNA packaging and did not quantitate
vector packaging directly but would be consistent with the low level of
packaging of Gag-deleted vectors that we have reported here.
One of the striking features of studies of lentivirus RNA encapsidation
has been the difficulty in precisely locating a single packaging signal
region. Deletion mutations of a magnitude shown to abolish
encapsidation in murine viruses rarely completely abrogate lentivirus
packaging, suggesting that there is functional redundancy in the system
and that more than one site can act to contribute to packaging.
Conceivably, this may be explained by the presence of a number of
similar motifs, for example the GGNGR motifs previously identified, any
one of which may act as a nucleation site for the Gag-RNA interaction.
Highly efficient encapsidation may therefore depend on a nucleation
event of a small number of Gag monomers on some or all of these
cis-acting sites. Close approximation of a number of
packaging signal sequences could occur by their being present in
adjacent locations on the same RNA strand but would also be achieved by
the close association of two RNA strands, each of which has one or more
of these sequences. This model would explain the intimate association
between retroviral RNA dimerization and encapsidation which has been
documented so frequently and also why disrupting RNA dimerization in
lentiviruses almost inevitably leads to impaired encapsidation
efficiency. HIV-1 has become established as a lentivirus vector of
promise, and several other lentivirus vectors are also under
development. If the nucleic acid recognition process in some
lentiviruses requires encoding of structural proteins to begin
encapsidation in cis, this could severely limit their potential for use as viral vectors.
 |
ACKNOWLEDGMENTS |
We thank Nijsje Dorman for the riboprobe template, KS2HIV-2,
and the Medical Research Council AIDS Reagent Project for human sera to
HIV-2.
This work was funded by the Royal Society and the Medical
Research Council (United Kingdom) and supported by grant 960675 (Biomed II). Jane F. Kaye is funded by a Royal Society Dorothy Hodgkin Research Fellowship.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medicine, University of Cambridge, Level 5, Addenbrooke's Hospital,
Hills Rd., Cambridge CB2 2QQ, United Kingdom. Phone: 441223 336860. Fax: 441223 336846. E-mail:
jfk11{at}mole.bio.cam.ac.uk.
 |
REFERENCES |
| 1.
|
Aldovini, A., and R. A. Young.
1990.
Mutations of RNA and protein sequences involved in human immunodeficiency virus type 1 packaging result in production of noninfectious virus.
J. Virol.
64:1920-1926[Abstract/Free Full Text].
|
| 2.
|
Berkowitz, R. D., and S. P. Goff.
1994.
Analysis of binding elements in the human immunodeficiency virus type 1 genomic RNA and nucleocapsid protein.
Virology
202:233-246[Medline].
|
| 3.
|
Berkowitz, R. D.,
J. Luban, and S. P. Goff.
1993.
Specific binding of human immunodeficiency virus type 1 Gag polyprotein and nucleocapsid protein to viral RNAs detected by RNA mobility shift assays.
J. Virol.
67:7190-7200[Abstract/Free Full Text].
|
| 3a.
| Boris-Lawrie, K. Personal communication.
|
| 4.
|
Clavel, F., and J. M. Orenstein.
1990.
A mutant of human immunodeficiency virus with reduced RNA packaging and abnormal particle morphology.
J. Virol.
64:5230-5234[Abstract/Free Full Text].
|
| 5.
|
Clever, J.,
C. Sassetti, and T. G. Parslow.
1995.
RNA secondary structure and binding sites for gag gene products in the 5' packaging signal of human immunodeficiency virus type 1.
J. Virol.
69:2101-2109[Abstract].
|
| 6.
|
Dannull, J.,
A. Surovoy,
G. Jung, and K. Moelling.
1994.
Specific binding of HIV-1 nucleocapsid protein to PSI RNA in vitro requires N-terminal zinc finger and flanking basic amino acid residues.
EMBO J.
13:1525-1533[Medline].
|
| 7.
|
Donze, O.,
P. Damay, and P. F. Spahr.
1995.
The first and third uORFs in RSV leader RNA are efficiently translated: implications for translational regulation and viral RNA packaging.
Nucleic Acids Res.
23:861-868[Abstract/Free Full Text].
|
| 8.
|
Donze, O., and P. F. Spahr.
1992.
Role of the open reading frames of Rous sarcoma virus leader RNA in translation and genome packaging.
EMBO J.
11:3747-3757[Medline].
|
| 9.
|
Dorfman, T.,
J. Luban,
S. P. Goff,
W. A. Haseltine, and H. G. Göttlinger.
1993.
Mapping of functionally important residues of a cysteine-histidine box in the human immunodeficiency virus type 1 nucleocapsid protein.
J. Virol.
67:6159-6169[Abstract/Free Full Text].
|
| 10.
|
Garzino Demo, A.,
R. C. Gallo, and S. K. Arya.
1995.
Human immunodeficiency virus type 2 (HIV-2): packaging signal and associated negative regulatory element.
Hum. Gene Ther.
6:177-184[Medline].
|
| 11.
|
Gorelick, R. J.,
D. J. Chabot,
A. Rein,
L. E. Henderson, and L. O. Arthur.
1993.
The two zinc fingers in the human immunodeficiency virus type 1 nucleocapsid protein are not functionally equivalent.
J. Virol.
67:4027-4036[Abstract/Free Full Text].
|
| 12.
|
Gorelick, R. J.,
S. M. Nigida, Jr.,
J. W. Bess, Jr.,
L. O. Arthur,
L. E. Henderson, and A. Rein.
1990.
Noninfectious human immunodeficiency virus type 1 mutants deficient in genomic RNA.
J. Virol.
64:3207-3211[Abstract/Free Full Text].
|
| 13.
|
Hackett, P. B.,
M. W. Dalton,
D. P. Johnson, and R. B. Petersen.
1991.
Phylogenetic and physical analysis of the 5' leader RNA sequences of avian retroviruses.
Nucleic Acids Res.
19:6929-6934[Abstract/Free Full Text].
|
| 14.
|
Harrison, G. P., and A. M. L. Lever.
1992.
The human immunodeficiency virus type 1 packaging signal and major splice donor region have a conserved stable secondary structure.
J. Virol.
66:4144-4153[Abstract/Free Full Text].
|
| 15.
|
Harrison, G. P.,
G. Miele,
E. Hunter, and A. M. L. Lever.
1998.
Functional analysis of the core HIV-1 packaging signal in a permissive cell line.
J. Virol.
72:5886-5896[Abstract/Free Full Text].
|
| 16.
|
Hayashi, T.,
T. Shioda,
Y. Iwakura, and H. Shibuta.
1992.
RNA packaging signal of human immunodeficiency virus type 1.
Virology
188:590-599[Medline].
|
| 17.
|
Katz, R. A.,
R. W. Terry, and A. M. Skalka.
1986.
A conserved cis-acting sequence in the 5' leader of avian sarcoma virus RNA is required for packaging.
J. Virol.
59:163-167[Abstract/Free Full Text].
|
| 18.
|
Kaye, J. F., and A. M. L. Lever.
1998.
Nonreciprocal packaging of human immunodeficiency virus type 1 and type 2 RNA: a possible role for the p2 domain of Gag in RNA encapsidation.
J. Virol.
72:5877-5885[Abstract/Free Full Text].
|
| 19.
|
Knight, J. B.,
Z. H. Si, and C. M. Stoltzfus.
1994.
A base-paired structure in the avian sarcoma virus 5' leader is required for efficient encapsidation of RNA.
J. Virol.
68:4493-4502[Abstract/Free Full Text].
|
| 20.
|
Koyama, T.,
F. Harada, and S. Kawai.
1984.
Characterization of a Rous sarcoma virus mutant defective in packaging its own genomic RNA: biochemical properties of mutant TK15 and mutant-induced transformants.
J. Virol.
51:154-162[Abstract/Free Full Text].
|
| 21.
|
Kunkel, T. A.,
J. D. Roberts, and R. A. Zakour.
1987.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Methods Enzymol.
154:367-382[Medline].
|
| 22.
|
Lever, A.,
H. Göttlinger,
W. Haseltine, and J. Sodroski.
1989.
Identification of a sequence required for efficient packaging of human immunodeficiency virus type 1 RNA into virions.
J. Virol.
63:4085-4087[Abstract/Free Full Text].
|
| 23.
|
Levin, J. G.,
P. M. Grimley,
J. M. Ramseur, and I. K. Berezesky.
1974.
Deficiency of 60 to 70S RNA in murine leukemia virus particles assembled in cells treated with actinomycin D.
J. Virol.
14:152-161[Abstract/Free Full Text].
|
| 24.
|
Levin, J. G., and M. J. Rosenak.
1976.
Synthesis of murine leukemia virus proteins associated with virions assembled in actinomycin D-treated cells: evidence for persistence of viral messenger RNA.
Proc. Natl. Acad. Sci. USA
73:1154-1158[Abstract/Free Full Text].
|
| 25.
|
Luo, L.,
Y. Li,
S. Dales, and C. Y. Kang.
1994.
Mapping of functional domains for HIV-2 gag assembly into virus-like particles.
Virology
205:496-502[Medline].
|
| 26.
|
McBride, M. S., and A. T. Panganiban.
1996.
The human immunodeficiency virus type 1 encapsidation site is a multipartite RNA element composed of functional hairpin structures.
J. Virol.
70:2963-2973[Abstract].
|
| 27.
|
McBride, M. S.,
M. D. Schwartz, and A. T. Panganiban.
1997.
Efficient encapsidation of human immunodeficiency virus type 1 vectors and further characterization of cis elements required for encapsidation.
J. Virol.
71:4544-4554[Abstract].
|
| 28.
|
McCann, E. M., and A. M. L. Lever.
1997.
Location of cis-acting signals important for RNA encapsidation in the leader sequence of human immunodeficiency virus type 2.
J. Virol.
71:4133-4137[Abstract].
|
| 29.
|
Naldini, L.,
U. Blomer,
P. Gallay,
D. Ory,
P. Mulligan,
F. H. Gage,
I. M. Verma, and D. Trono.
1996.
In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector.
Science
272:263-267[Abstract].
|
| 30.
|
Poeschla, E.,
J. Gilbert,
X. Li,
S. Huang,
A. Ho, and F. Wong-Staal.
1998.
Identification of human immunodeficiency virus type 2 (HIV-2) encapsidation determinant and transduction of nondividing human cells by HIV-2 based lentivirus vectors.
J. Virol.
72:6527-6536[Abstract/Free Full Text].
|
| 31.
|
Potts, B. J.
1990.
`Mini' reverse transcriptase (RT) assay, p. 102-106.
In
A. Aldovini, and B. D. Walker (ed.), Techniques in HIV research. Stockton Press, New York, N.Y.
|
| 32.
|
Poznansky, M.,
A. M. L. Lever,
L. Bergeron,
W. Haseltine, and J. Sodroski.
1991.
Gene transfer into human lymphocytes by a defective human immunodeficiency virus type 1 vector.
J. Virol.
65:532-536[Abstract/Free Full Text].
|
| 33.
|
Richardson, J. H.,
L. A. Child, and A. M. L. Lever.
1993.
Packaging of HIV-1 genomic RNA requires cis-acting sequences outside the 5' leader region.
J. Virol.
67:3097-4005.
|
| 34.
|
Rizvi, T. A., and A. T. Panganiban.
1993.
Simian immunodeficiency virus RNA is efficiently encapsidated by human immunodeficiency virus type 1 particles.
J. Virol.
67:2681-2688[Abstract/Free Full Text].
|
| 35.
|
Sakaguchi, K.,
N. Zambrano,
E. T. Baldwin,
B. A. Shapiro,
J. W. Erickson,
J. G. Omichinski,
G. M. Clore,
A. M. Gronenborn, and E. Appella.
1993.
Identification of a binding site for the human immunodeficiency virus type 1 nucleocapsid protein.
Proc. Natl. Acad. Sci. USA
90:5219-5223[Abstract/Free Full Text].
|
| 36.
|
Schmalzbauer, E.,
B. Strack,
J. Dannull,
S. Guehmann, and K. Moelling.
1996.
Mutations of basic amino acids of NCp7 of human immunodeficiency virus type 1 affect RNA binding in vitro.
J. Virol.
70:771-777[Abstract].
|
| 37.
|
Selden, R. F.
1987.
Transfection using DEAE-dextran, p. 9.21-9.22.
In
R. Ausubel, R. E. Brent, D. D. Kingston, J. G. Moore, J. A. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. Wiley Interscience, New York, N.Y.
|
| 38.
|
Sonstegard, T. S., and P. B. Hackett.
1996.
Autogenous regulation of RNA translation and packaging by Rous sarcoma virus Pr76gag.
J. Virol.
70:6542-6552[Abstract/Free Full Text].
|
Journal of Virology, April 1999, p. 3023-3031, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ricci, E. P., Herbreteau, C. H., Decimo, D., Schaupp, A., Datta, S. A.K., Rein, A., Darlix, J.-L., Ohlmann, T.
(2008). In vitro expression of the HIV-2 genomic RNA is controlled by three distinct internal ribosome entry segments that are regulated by the HIV protease and the Gag polyprotein. RNA
14: 1443-1455
[Abstract]
[Full Text]
-
Bjarnadottir, H., Gudmundsson, B., Gudnason, J., Jonsson, J. J.
(2006). Encapsidation Determinants Located Downstream of the Major Splice Donor in the Maedi-Visna Virus Leader Region. J. Virol.
80: 11743-11755
[Abstract]
[Full Text]
-
Chen, J., Powell, D., Hu, W.-S.
(2006). High Frequency of Genetic Recombination Is a Common Feature of Primate Lentivirus Replication. J. Virol.
80: 9651-9658
[Abstract]
[Full Text]
-
Aguiar, R. S., Pereira, H. S., Costa, L. J., Brindeiro, R. M., Tanuri, A.
(2006). Gag-Pol bearing a reverse transcriptase drug-resistant mutation influences viral genomic RNA incorporation into human immunodeficiency virus type 1 particles. J. Gen. Virol.
87: 2669-2677
[Abstract]
[Full Text]
-
Evans, D. T., Bricker, J. E., Desrosiers, R. C.
(2004). A Novel Approach for Producing Lentiviruses That Are Limited to a Single Cycle of Infection. J. Virol.
78: 11715-11725
[Abstract]
[Full Text]
-
Bennett, E. M., Lever, A. M. L., Allen, J. F.
(2004). Human Immunodeficiency Virus Type 2 Gag Interacts Specifically with PRP4, a Serine-Threonine Kinase, and Inhibits Phosphorylation of Splicing Factor SF2. J. Virol.
78: 11303-11312
[Abstract]
[Full Text]
-
Lanchy, J.-M., Szafran, Q. N., Lodmell, J. S.
(2004). Splicing affects presentation of RNA dimerization signals in HIV-2 in vitro. Nucleic Acids Res
32: 4585-4595
[Abstract]
[Full Text]
-
LeBlanc, J. J., Beemon, K. L.
(2004). Unspliced Rous Sarcoma Virus Genomic RNAs Are Translated and Subjected to Nonsense-Mediated mRNA Decay before Packaging. J. Virol.
78: 5139-5146
[Abstract]
[Full Text]
-
Guo, X., Hu, J., Whitney, J. B., Russell, R. S., Liang, C.
(2004). Important Role for the CA-NC Spacer Region in the Assembly of Bovine Immunodeficiency Virus Gag Protein. J. Virol.
78: 551-560
[Abstract]
[Full Text]
-
Strappe, P. M., Greatorex, J., Thomas, J., Biswas, P., McCann, E., Lever, A. M. L.
(2003). The packaging signal of simian immunodeficiency virus is upstream of the major splice donor at a distance from the RNA cap site similar to that of human immunodeficiency virus types 1 and 2. J. Gen. Virol.
84: 2423-2430
[Abstract]
[Full Text]
-
Akahata, W., Ido, E., Hayami, M.
(2003). Mutational analysis of two zinc-finger motifs in the nucleocapsid protein of simian immunodeficiency virus mac239. J. Gen. Virol.
84: 1641-1648
[Abstract]
[Full Text]
-
Patel, J., Wang, S.-W., Izmailova, E., Aldovini, A.
(2003). The Simian Immunodeficiency Virus 5' Untranslated Leader Sequence Plays a Role in Intracellular Viral Protein Accumulation and in RNA Packaging. J. Virol.
77: 6284-6292
[Abstract]
[Full Text]
-
Brasey, A., Lopez-Lastra, M., Ohlmann, T., Beerens, N., Berkhout, B., Darlix, J.-L., Sonenberg, N.
(2003). The Leader of Human Immunodeficiency Virus Type 1 Genomic RNA Harbors an Internal Ribosome Entry Segment That Is Active during the G2/M Phase of the Cell Cycle. J. Virol.
77: 3939-3949
[Abstract]
[Full Text]
-
Kemler, I., Barraza, R., Poeschla, E. M.
(2002). Mapping the Encapsidation Determinants of Feline Immunodeficiency Virus. J. Virol.
76: 11889-11903
[Abstract]
[Full Text]
-
Myers, E. L., Allen, J. F.
(2002). Tsg101, an Inactive Homologue of Ubiquitin Ligase E2, Interacts Specifically with Human Immunodeficiency Virus Type 2 Gag Polyprotein and Results in Increased Levels of Ubiquitinated Gag. J. Virol.
76: 11226-11235
[Abstract]
[Full Text]
-
Butsch, M., Boris-Lawrie, K.
(2002). Destiny of Unspliced Retroviral RNA: Ribosome and/or Virion?. J. Virol.
76: 3089-3094
[Full Text]
-
Paillart, J.-C., Skripkin, E., Ehresmann, B., Ehresmann, C., Marquet, R.
(2002). In Vitro Evidence for a Long Range Pseudoknot in the 5'-Untranslated and Matrix Coding Regions of HIV-1 Genomic RNA. J. Biol. Chem.
277: 5995-6004
[Abstract]
[Full Text]
-
Griffin, S. D. C., Allen, J. F., Lever, A. M. L.
(2001). The Major Human Immunodeficiency Virus Type 2 (HIV-2) Packaging Signal Is Present on All HIV-2 RNA Species: Cotranslational RNA Encapsidation and Limitation of Gag Protein Confer Specificity. J. Virol.
75: 12058-12069
[Abstract]
[Full Text]
-
Guan, Y., Diallo, K., Detorio, M., Whitney, J. B., Liang, C., Wainberg, M. A.
(2001). Partial Restoration of Replication of Simian Immunodeficiency Virus by Point Mutations in either the Dimerization Initiation Site (DIS) or Gag Region after Deletion Mutagenesis within the DIS. J. Virol.
75: 11920-11923
[Abstract]
[Full Text]
-
Browning, M. T., Schmidt, R. D., Lew, K. A., Rizvi, T. A.
(2001). Primate and Feline Lentivirus Vector RNA Packaging and Propagation by Heterologous Lentivirus Virions. J. Virol.
75: 5129-5140
[Abstract]
[Full Text]
-
Guan, Y., Whitney, J. B., Liang, C., Wainberg, M. A.
(2001). Novel, Live Attenuated Simian Immunodeficiency Virus Constructs Containing Major Deletions in Leader RNA Sequences. J. Virol.
75: 2776-2785
[Abstract]
[Full Text]
-
Butsch, M., Boris-Lawrie, K.
(2000). Translation Is Not Required To Generate Virion Precursor RNA in Human Immunodeficiency Virus Type 1-Infected T Cells. J. Virol.
74: 11531-11537
[Abstract]
[Full Text]
-
Dorman, N., Lever, A.
(2000). Comparison of Viral Genomic RNA Sorting Mechanisms in Human Immunodeficiency Virus Type 1 (HIV-1), HIV-2, and Moloney Murine Leukemia Virus. J. Virol.
74: 11413-11417
[Abstract]
[Full Text]
-
Guan, Y., Whitney, J. B., Diallo, K., Wainberg, M. A.
(2000). Leader Sequences Downstream of the Primer Binding Site Are Important for Efficient Replication of Simian Immunodeficiency Virus. J. Virol.
74: 8854-8860
[Abstract]
[Full Text]
-
Jewell, N. A., Mansky, L. M.
(2000). In the beginning: genome recognition, RNA encapsidation and the initiation of complex retrovirus assembly. J. Gen. Virol.
81: 1889-1899
[Full Text]