Previous Article | Next Article 
Journal of Virology, April 1999, p. 2893-2900, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Ski7 Antiviral Protein Is an EF1-
Homolog
That Blocks Expression of Non-Poly(A) mRNA in
Saccharomyces cerevisiae
Lionel
Benard,
Kathleen
Carroll,
Rosaura C. P.
Valle,§
Daniel C.
Masison, and
Reed B.
Wickner*
Laboratory of Biochemistry and Genetics,
National Institute of Diabetes and Digestive and Kidney Diseases,
National Institutes of Health, Bethesda, Maryland 20892-0830
Received 20 October 1998/Accepted 14 December 1998
 |
ABSTRACT |
We mapped and cloned SKI7, a gene that negatively
controls the copy number of L-A and M double-stranded RNA viruses in
Saccharomyces cerevisiae. We found that it encodes a
nonessential 747-residue protein with similarities to two translation
factors, Hbs1p and EF1-
. The ski7 mutant was
hypersensitive to hygromycin B, a result also suggesting a role in
translation. The SKI7 product repressed the expression of
nonpolyadenylated [non-poly(A)] mRNAs, whether capped or uncapped,
thus explaining why Ski7p inhibits the propagation of the yeast
viruses, whose mRNAs lack poly(A). The dependence of the Ski7p effect
on 3' RNA structures motivated a study of the expression of capped
non-poly(A) luciferase mRNAs containing 3' untranslated regions
(3'UTRs) differing in length. In a wild-type strain, increasing the
length of the 3'UTR increased luciferase expression due to both
increased rates and duration of translation. Overexpression of Ski7p
efficiently cured the satellite virus M2 due to a
twofold-increased repression of non-poly(A) mRNA expression. Our
experiments showed that Ski7p is part of the Ski2p-Ski3p-Ski8p antiviral system because a single ski7 mutation derepresses
the expression of non-poly(A) mRNA as much as a quadruple ski2
ski3 ski7 ski8 mutation, and the effect of the overexpression of
Ski7p is not obtained unless other SKI genes are
functional. ski1/xrn1
ski2
and ski1/xrn1
ski7
mutants were viable but temperature sensitive for growth.
 |
INTRODUCTION |
The 5' cap (m7G5'ppp5'Xp) and the 3'
poly(A) structures of eukaryotic mRNAs are essential for efficient
translation and mRNA stability. The poly(A) tail acts synergistically
with the 5' cap structure in translation (11, 13;
reviewed in reference 37). The first step in mRNA
degradation is the shortening of this poly(A) tail, followed by a
decapping reaction, producing an uncapped nonpolyadenylated
[non-poly(A)] mRNA which is then subject to rapid 5'
3'
degradation (9, 29; reviewed in reference
16).
This intermediate of mRNA degradation resembles the mRNAs of the
L-A and M double-stranded RNA (dsRNA) viruses of the yeast Saccharomyces cerevisiae, which naturally lack both the 5'
cap and the 3' poly(A) tail (6, 46). The L-A and M mRNAs are nonetheless expressed, but their expression is sensitive to chromosomal mutations affecting pathways involving these 5' or 3' structures. The
ski mutants were first isolated on the basis of their
superkiller phenotype (35, 47). The SKI2,
SKI3, SKI4, SKI6, SKI7, and SKI8 products repress the copy number of L-A and M viruses,
and mutations in these genes result in a higher level of expression of
the secreted killer toxin encoded by M dsRNA (3, 35, 47, 53; reviewed in reference 50). The
SKI1 gene (47), later proved to be
XRN1, encodes the 5'
3' exoribonuclease specific for
uncapped cellular mRNAs and is responsible for a major pathway of mRNA
decay (14, 18, 29, 43, 44). In a ski1 mutant, uncapped viral mRNAs are more stable, causing, for example, increased toxin production (24). The SKI2, SKI3,
and SKI8 genes (26, 34, 53) encode a system
that specifically blocks the expression of 3' non-poly(A) mRNAs
(24). The nuclear location of Ski3p (34)
and the similarity of Ski2p to a nucleolar human homolog (21,
53) suggested that they carry out a function taking place in the
nucleus and inducing specific repression of non-poly(A) mRNA
translation (24).
Ski6p is homologous to bacterial RNase PH (4), an enzyme
responsible for trimming a few nucleotides from the 3' end of tRNA
precursors and 5S rRNA during their maturation (22). Indeed, ski6 mutants produce defective 60S subunits (4),
and Ski6p (Rrp41p) was localized in a complex of 3'
5'
exoribonucleases involved in 5.8S rRNA processing (28).
These abnormalities lead to derepressed expression of non-poly(A) mRNA
in ski6 mutants (4), with effects on both the
initial rate and the duration of translation from electroporated
non-poly(A) mRNAs. Mutations in the SKI2, SKI3,
SKI6, or SKI8 gene can also slow the 3'
5' degradation of special mRNA decay intermediates whose degradation by
the predominant 5'
3' degradation system is blocked (1). Because the control of translation and mRNA turnover are multiply intertwined, distinguishing the primary effects of the SKI
genes is difficult, but the overall effect on viral replication appears to be enhanced expression of the viral mRNA which lacks 3' poly(A).
Since ski mutations (including, as we show here,
ski7) primarily affect the expression of non-poly(A) mRNAs,
we examined the role of the 3' untranslated region (3'UTR) in
non-poly(A) mRNA expression. The 3'UTR is known to have specific
functions in many systems (49). Furthermore, all cellular
mRNAs are believed to undergo deadenylation, and non-poly(A) mRNAs can
be present in the polysomal fraction under special circumstances
(14, 33). Thus, when the mRNA remains capped and is
non-poly(A), its 3'UTR may itself serve as an element influencing mRNA
expression (reviewed in references 15 and
49). In CHO (Chinese hamster ovary) cells, increased
3'UTR length substantially improved the efficiency of translation
initiation, suggesting a model in which the 3'UTR acts through more
efficient ribosome recycling (45). A modest stabilization of
mRNAs with longer 3'UTRs was also observed but was interpreted as a
secondary phenomenon. There is also evidence for prokaryotes that
events occurring during termination can affect the efficiency of
ribosome recycling, the fourth step of translation (17, 32).
We show here that the ski7 mutation increases both the
initial rate and the duration of the expression of non-poly(A) mRNAs and that this effect is independent of the length of the 3'UTR. The
effect of the ski7 mutation on the expression of non-poly(A) mRNAs explains the superkiller phenotype of the mutant because the
viral mRNAs lack 5' poly(A). Overexpression of Ski7p cured the
M2 satellite RNA due to increased repression of the
expression of non-poly(A) mRNAs. The increased block of the translation
of non-poly(A) mRNAs and the resulting elimination of M2
depended on the function of other SKI genes. This and other
genetic experiments indicated that SKI7 is part of the
SKI2-SKI3-SKI8 antiviral system.
 |
MATERIALS AND METHODS |
Genetic mapping of SKI7.
M2 dsRNA is a
killer toxin-encoding satellite of the L-A virus (5, 27,
52). Above 32°C, M2 propagation depends on two genes, MKT1 and MKT2 (maintenance of
K2), which are not needed by M1 dsRNA (51,
52). ski mutations suppress this requirement of
M2 for MKT genes (35). Many
laboratory strains carry mkt1 mutations. We crossed
mkt1 ski7 M2 strains with a set of multiply marked strains designed for genetic mapping (12), which also proved to be mkt1. We found that ski7 was tightly
linked to pet17 (parental ditype [PD], 34; nonparental
ditype [NPD], 0; tetratype [T], 8; 9.5 cM) and linked to
ade2 (PD, 24; NPD, 0; T, 22; 24 cM) on the right arm of
chromosome XV. Analysis of individual tetrads showed that the order was
CEN15-PET17-SKI7, placing SKI7 very close to
TMP1/CDC21 (Fig. 1).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
Cloning of SKI7. The ski7-1
mutation was localized by meiotic mapping to a region near
TMP1/CDC21. Various clones from the Olson bank
(36) were tested for complementation of ski7-1.
Subcloning proved that SKI7 was YOR076c; this
finding was confirmed by the phenotype of the disruption and
complementation of ski7-1 by pRS3167 (see Materials and
Methods).
|
|
Cloning of SKI7.
Strain RV603 (MATa
ura3 leu2 ski7-1 mkt1; L-A-HN M2) is stably
K2+ at either 25 or 32°C, but if it becomes
SKI+, then it will be
K2
after growth at 32°C (Table
1). Several
clones of yeast DNA (36) located near tmp1 were tested by
cotransformation of
clone DNA and pBM2240, the latter cut with
EcoRI and XhoI (10). Transformants
were isolated at 25°C, grown at 25 or 32°C, and then tested for
killer activity. Only
3749 (ATCC 70213) gave recombinants which
complemented ski7-1 (Fig. 1). The pBM2240 derivative carrying the insert of
3749 was isolated, and subclones were made by
cleavage with HindIII and ligation to pRS316 cut with the same enzyme. One of these, p3749H1, containing an 8.9-kb insert, complemented ski7-1. Subclones of p3749H1 were made by
cleavage with ClaI and SpeI and insertion into
pRS316 cut with the same enzymes. One of these, p3749L, contained a
5-kb insert and complemented ski7-1. Deletions of p3749L
were made by cutting with ClaI-BamHI, BamHI-NotI, BglII-ClaI,
KpnI, or BamHI followed by ligation (Fig. 1).
None of these deletion plasmids complemented ski7-1. The
ends of several of these clones were sequenced and found to match a region of chromosome XV near TMP1/CDC21 (48), as
expected. The results indicated that the open reading frame
YOR076c was responsible for the complementation of
ski7-1. This finding was confirmed by cloning the 3,155-bp
EcoRV-PvuII fragment containing
YOR076c into pRS316 cut with SmaI and showing
that the resulting plasmid, pRS3167, complemented ski7-1
(Fig. 1).
Plasmid constructions.
The insert from pRS3167 (see above)
was excised as a SpeI-HindIII fragment and
inserted into pBluescript SK(+), creating pSKSKI7. To prepare a genomic
disruption of SKI7, the StuI-SphI
fragment including nearly all of the SKI7 open reading frame
was replaced with the HIS3 gene on a
SmaI-SphI fragment from pJJ215 (19), creating pSKI7::HIS3. Multicopy YEpSKI7 was created by the
insertion of the same pRS3167 SpeI-HindIII
fragment containing SKI7 into YEp351 cut with
SpeI and HindIII.
Disruption of SKI7.
A diploid strain, 2959 (MATa ura3 his3 trp1; M2 L-A-HN) × 2966 (MAT
leu2 his3 trp1 pho3 pho5; L-A-o M-o), was
transformed with linearized pSKI7::HIS3. His+
diploids were selected, and the genomic replacement of SKI7
was confirmed by Southern blotting. Positive diploids were sporulated, and the segregation observed was 2 His+ Ski
:2
His
Ski+ (four tetrads). Tetrad analyses were
confirmed by Southern blotting. As the SKI7 disruptant was
viable, strain B117 was constructed from strain 2959 by the same procedure.
Strain 5X47 was the toxin-sensitive strain used as an indicator in the
killer assay (
35).
Expression of luciferase mRNAs.
The luciferase mRNA
expression plasmids pT7-luc [no poly(A); untranslated
region, 22 bases] and pT7-luc50A [50-mer poly(A) tail]
(13) were linearized with SmaI and
DraI, respectively. Plasmids allowing the transcription of
luciferase mRNAs with repeated copies of a 20-base 3'UTR
(5'TCTACAGCATATCTGGATCTGGATCC3') followed (or not) by a
50-mer poly(A) tail
(5'CCA25GTTATA25TTTAAA3') were kindly provided by Daniel Gallie (45). For RNA synthesis,
pT7-luc with several copies of the above 3'UTR sequence was
linearized with BamHI, and
pT7-luc(3'UTR)n+50(A) was linearized with
DraI. Transcripts were synthesized with an Ambion MEGAscript
transcription kit in the presence or absence of the cap analog
5'm7GpppG in accordance with the manufacturer's instructions. After
DNase I treatment and precipitation with LiCl, RNAs were passed over
G-50 columns (5 prime-3 prime SELECT-B) and quantitated by both
measurement of the optical density (OD) at 260 nm and comparison with
known concentration standards on agarose gels.
RNA electroporation was done as described previously (
11)
with minor modifications. Two micrograms of RNA was used for
electroporation,
and cells were assayed for luciferase activity after
different
times of growth at 30°C. Luciferase activity was assayed as
previously
described (
24).
Drug sensitivity test.
Isogenic wild-type and
ski7 cells grown in YPAD to the log phase were diluted to an
OD at 600 nm of 0.15; 0.015-, 0.0015, and 5-µl aliquots were spotted
on YPAD plates with or without drug (the viabilities of both strains
appeared to be identical and proportional to the measured OD on YPAD).
The concentration of hygromycin B was 100 µg/ml, and that of
cycloheximide was 100 ng/ml.
 |
RESULTS |
The SKI7 product is similar to translation
factors.
Like other ski (superkiller) mutations,
ski7 confers cold sensitivity for growth on cells carrying M
dsRNA, indicating the importance in nature of the SKI genes.
We genetically mapped ski7 close to CDC21/TMP1 on
chromosome XV by using the suppression by ski7 of a defect
in propagation of the M2 virus. We obtained
clones
including this small area and cloned the gene from one of them (see
Materials and Methods) (Fig. 1). Since the clone complementing the
ski7 mutation was obtained from DNA that maps close to
CDC21/TMP1, we have cloned SKI7 and not a
suppressor. Deletion analysis (Fig. 1) proved that SKI7 is
identical to YOR076c, previously identified in the yeast
genome project (48). A deletion-substitution ski7
mutation produced the superkiller phenotype but did not produce a
growth defect, showing that SKI7 is not essential (see
Materials and Methods).
The 747-residue protein Ski7p is similar to yeast Hbs1p (24.4%
identity and 58% similarity in 582 amino acids), a factor whose
overexpression suppresses the growth defect of an
ssb1
ssb2 double
mutant.
SSB1 and
SSB2 products
are known to be associated with
the ribosome during peptide synthesis
(
31). However, overexpression
of Hbs1p does not suppress
ski7-1 (data not shown). Ski7p also
resembles the
translation elongation factors EF-Tu and EF-1

(45
identities in a
154-residue region of similarity) (Fig.
2) and
the yeast translation termination
factor Sup35p (data not shown),
including a GTPase consensus sequence.
These similarities suggest
that Ski7p is involved in translation.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Ski7p is similar to Hbs1p (31) and yeast
EF-1 (Tef1p or Tef2p) (40). Black boxes show residues
identical to those in Ski7p; dashes show gaps.
|
|
Ski7p specifically blocks the expression of non-poly(A)
mRNAs.
Because the ski7 mutation, like
ski1, ski2, ski3, ski6, and
ski8, increases the expression of viral uncapped non-poly(A)
mRNAs, we used electroporation of luciferase mRNAs to study the effect of a SKI7 disruption (Table
2). In a wild-type strain, capped (C+) polyadenylated (A+) mRNA was expressed 38 to 42 times better than C+ non-poly(A) (A
)
mRNA (Table 2). In the isogenic SKI7 disruptant,
C+ A+ mRNA was expressed only 2 to 5.5 times
better than C+ A
mRNA. Thus, the
SKI7 disruption increases the expression of C+
A
mRNA 7- to 20-fold. A similar effect on uncapped
(C
) A
mRNA expression was also seen, with a
seven- to ninefold increase in expression in the
ski7::HIS3 disruptant (Table 2). In contrast, no
increased expression of C
A+ mRNA in the
mutant was seen; a decrease of two- to threefold was observed (Table
2). This modest effect of the absence of a cap in the mutant might also
explain why C
A
mRNA expression is not
enhanced in the ski7 mutant as strongly as is that of
C+ A
mRNA.
In a
ski7 mutant, the lack of a 3' poly(A) structure appears
less critical. The poly(A) structure is well known to be important
in
both the initial rate and the duration of translation of mRNAs.
Since
3'UTRs can also play roles in translation (
45) and in
mRNA
stability (
30), it is possible that the
ski7
mutation derepresses
3'UTR function itself, compensating for the loss
of the poly(A)
tail or its natural absence on viral mRNAs. We thus
examined the
effect of the length of the 3'UTR on mRNA expression in a
wild-type
strain or an isogenic
ski7 mutant.
3'UTR length influences non-poly(A) mRNA expression, and the
ski7 mutation has an additive effect.
We used
constructs allowing the production in vitro of capped luciferase mRNAs
with a 3'UTR sequence composed of repeats of a 20-nucleotide sequence
(45) (see Materials and Methods). Expression from these
mRNAs was measured 2 h after their electroporation into
spheroplasts prepared from wild-type and isogenic ski7
strains (Fig. 3). Increasing the length
of the 3'UTR from 24 bases to 104 bases resulted in a 9.7-fold increase
in expression in the wild-type strain (Fig. 3). With a poly(A) tail,
the difference between these mRNA constructs was at most twofold (Fig.
3). We confirmed with yeast cells the observation made with CHO cells (45) that increasing the length of the 3'UTR improves
expression when mRNAs are non-poly(A).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Luciferase expression in isogenic wild-type (B959) and
ski7 mutant (B117) strains 2 h after electroporation
with 2 µg of the indicated mRNAs. All mRNAs had 5' cap structures.
The lengths of the 3'UTRs are indicated (one to five identical 20-bp
units were inserted 3' of the luc coding region)
(45) (see Materials and Methods). microg, microgram.
|
|
The
ski7 mutation increased expression from all of these
non-poly(A) mRNAs, regardless of the length of the 3'UTR (Fig.
3 and
Table
3). As in the wild-type strain, the
expression of polyadenylated
mRNAs in a
ski7 strain was not
strongly dependent on the length
of the 3'UTR (Fig.
3).
From the time course of luciferase accumulation, the luc-64b-3'UTR or
luc-104b-3'UTR mRNAs were found to induce a 3- to 4-fold-higher
initial
rate and a 2.5-fold-increased duration of expression compared
to the
luc-4b-3'UTR mRNA (Table
3), leading to a maximum luciferase
activity
that was 10-fold higher (Table
3).
The initial rate of expression for the luc-24b-3'UTR mRNA was 5.5-fold
higher in the mutant than in the wild type (Fig.
4B
and Table
3). The functional half-life
was increased five times,
and overall expression was 24-fold higher.
Similarly, the initial
rate for the luc-4b-3'UTR mRNA was increased
fourfold in the
ski7 mutant. Thus, the
ski7
mutation clearly increases both the initial
rate of expression and the
duration of expression of these RNAs.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Time course of luciferase accumulation in cells
electroporated with 2 µg of C+ A mRNAs with
various lengths of 3'UTRs. Isogenic wild-type (B959) and
ski7 mutant (B117) strains were used. (B) Wild-type
results on an expanded scale. microg, microgram.
|
|
One test of whether the
ski7 mutation produces its effects
by derepressing the activity of the 3'UTR is to examine an mRNA
that
has almost no 3'UTR. We used a C
+ A

mRNA with
a 3'UTR only 4 nucleotides long. We still saw a 4-fold
increase in the
initial expression rate in the
ski7 strain and
a 3.7-fold
increase in the functional half-life (Table
3). These
results show that
Ski7p does not act by repressing the activity
of the 3'UTR. Conversely,
a comparison of luc-4b-3'UTR and luc-64b-3'UTR
mRNAs in the
ski7 strain showed increases in the initial expression
rate
and in the functional half-life comparable to those seen
in the
wild-type host (Table
3). These results indicate that
the 3'UTR effect
is not dependent on
Ski7p.
We also noted that while functional half-lives and initial expression
rates are undoubtedly connected, there is no one-to-one
relationship.
For example, the initial expression rates for luc-24b-3'UTR
in a
wild-type strain and luc-4b-3'UTR in a
ski7 mutant were
similar,
but their duration of expression differed by fourfold.
Likewise,
the functional half-lives for luc-24b-3'UTR and luc-4b-3'UTR
in
the
ski7 mutant were similar, but their initial
expression rates
were fourfold
different.
Antibiotic sensitivity of the ski7 mutant.
Although the ski7 mutant had an apparently normal polysome
profile (data not shown), many mutations affecting components of the
translation apparatus are found to be hypersensitive to hygromycin B
(7, 38) and other drugs that increase translational errors (23). Figure 5 shows that the
ski7 mutant strain was hypersensitive to hygromycin B and
slightly hypersensitive to cycloheximide (but not to paromomycin; data
not shown), supporting the notion that SKI7 affects ribosome
function.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
Hypersensitivity of the ski7 mutant to
hygromycin B and cycloheximide. Dilutions of suspended wild-type (B959)
and ski7 mutant (B117) strains were spotted on rich
medium containing hygromycin B, cycloheximide, or neither drug
(control).
|
|
SKI7 is a regulator of non-poly(A) mRNA
expression.
We examined the effect of the overproduction of Ski7p
on viral propagation and non-poly(A) mRNA expression. SKI7
was subcloned on a multicopy plasmid and used to transform RV603, a
ski7-1 mutant. ski mutants are able to propagate
M2 dsRNA at 25 and 32°C and have a superkiller phenotype
(Table 4) (see Materials and Methods). When the ski7 mutation was complemented by a single copy of
SKI7 (plasmid pRS3167), the strain remained a killer at 25 but lost the virus at 32°C. This result is expected from a wild-type
strain containing LA-HN and M2 viruses (35).
Interestingly, SKI7 present on a multicopy plasmid (YEpSKI7)
induced the loss of killer toxin production and M2 dsRNA at
every temperature (Table 4 and data not shown).
We further analyzed the expression of non-poly(A) mRNAs in a
ski7 mutant or wild-type strain in the presence or absence
of
SKI7 on a multicopy plasmid. Figure
3 shows that a
ski7 mutant
strain expressed luc-24b-3'UTR, luc-64b-3'UTR,
and luc-104b-3'UTR
31.9-, 7.5-, and 8.7-fold better than a wild-type
strain, respectively.
Ski7p overproduction in a wild-type strain (or a
ski7 mutant strain)
reduced the expression of C
+
A

mRNAs, particularly those with luc-64b-3'UTR and
luc-104b-3'UTR,
to levels twofold below those seen in a wild-type
strain with
the vector alone (Table
5).
We speculate that this stronger repression
of expression of non-poly(A)
mRNAs was responsible for the observed
loss of the virus after several
cell divisions.
Thus, inactivation of Ski7p produces derepression and its
overproduction produces repression of C
+ A

mRNA expression. We conclude that the level of expression of
Ski7p is
critical for regulating non-poly(A) mRNA expression and
M
2
virus
propagation.
Ski7p activity in different ski backgrounds.
Single deletions of SKI2, SKI3, SKI7,
or SKI8 do not affect cell viability (34, 42,
53; this work). Within this group, multiple ski
deletion strains were easily constructed. For example, the cross
4592-1C (MATa leu2 ura3 his3 ski8::URA3
ski7::HIS3) × 4593-6B (MAT
trp1 ura3 his3
ski3::URA3 ski2::HIS3) gave 90% spore
germination at 30°C. A quadruple disruptant (strain 3963) was
confirmed by a subsequent cross. Overexpression of SKI7 in strain 3963 did not modify the expression of luciferase mRNAs (Table
5). Nor did overproduction of Ski7p alter expression in single
ski2, ski3, or ski6 strains. Further,
adding ski2, ski3, and ski8 mutations
to a ski7 mutant did not alter either the initial rates or the duration of translation of different luciferase
mRNAs (Table 6). These results
suggest that the different Ski proteins are related in function.
ski1/xrn1 ski7 and ski1/xrn1 ski2 double
mutants are viable but temperature sensitive for growth.
The
cold-sensitive and temperature-sensitive growth of ski2,
ski3, ski4, ski6, ski7, or
ski8 mutants depends on M dsRNA (35) and is
believed to be due to its high copy number. However, a ski2
mutation is known to also result in increased copy numbers of L-A,
L-BC, and 20S RNAs (3, 25). It has been reported that
ski1/xrn1 ski2 and ski1/xrn1 ski3 double mutants
are lethal even if they lack L-A and M dsRNAs (18). Since
ski1/xrn1 mutants were first isolated based on their
increased expression of viral mRNAs (47) and should
derepress the expression of L-A, L-BC, 20S, and 23S RNAs, all of which
apparently lack 5' caps and are found in nearly all laboratory strains,
it is possible that the reported lethality of ski1 ski2 or
ski1 ski3 is due to viral effects.
We crossed deletion mutants of
ski1/xrn1 marked with
URA3 with
ski7::HIS3 and
ski2::HIS3 strains. The doubly heterozygous
diploids were subcloned several times at 39°C in an attempt to
cure
viruses before sporulation (
41), but this procedure cured
only L-A and M dsRNAs. Germination at 30°C produced no viable
double
mutants, as was previously observed for
ski1/xrn1 ski2 and
ski1/xrn1 ski3, but germination at 20°C produced almost
the
expected proportions of viable
ski1/xrn1 ski7 and
ski1/xrn1 ski2 segregants (Table
7). The double-mutant segregants were
unable
to grow at 30°C, as expected, and showed prominent L-BC dsRNA
bands (data not shown). Because there is no known method for curing
20S
RNA or 23S RNA and heat curing of L-BC dsRNA is variable and
ineffective in these strains, it remains unclear whether the growth
defect in these double mutants was due to effects of these RNA
replicons or to translation and mRNA stability effects on the
host.
 |
DISCUSSION |
Viral mRNAs, 3'UTRs, and SKI7.
Mutation of
SKI7 produces an increased copy number of L-A and M viruses
and an associated superkiller phenotype. We demonstrate that this
mutation specifically induces the expression of non-poly(A) luciferase
mRNAs, thus explaining its effect on viruses, since L-A and M viral
mRNAs are non-poly(A). Thus, the SKI7 product is a repressor
of non-poly(A) mRNA expression. This effect on luciferase or viral
mRNAs having only a 3'UTR [but no poly(A)] led us to question its
possible involvement in this regulation by SKI genes. As has
been shown in other systems (e.g., 45, 49), we find
that 3'UTRs are not passive elements in mRNA expression but elevate
both the initial rates and the duration of translation of
electroporated mRNAs. 3'UTRs are also known to be the locations of
certain specific signals affecting the processes of translation and
mRNA turnover. We confirm that general 3'UTR actions can be detected
only when the mRNA has been deadenylated, because the addition of a
poly(A) tail largely overwhelms 3'UTR effects on translation.
The poly(A) structure and the poly(A) binding protein, Pab1p, act
synergistically with the factors associated with the 5'
cap in
initiation. The poly(A) structure may also play roles in
translation termination, in reinitiation, and in protecting mRNA
from degradation from both 3' and 5' ends. The 3'UTRs could
affect
any of these
functions.
Knowing the 3'UTRs can promote mRNA expression in the absence of
poly(A), we considered the possibility that Ski7p is normally
a
repressor of such a 3'UTR function.
ski7 mutants are
enhanced
for the functions to which the 3'UTR contributes, with
increased
initial rates and duration of translation. However, mRNAs
which
have essentially no 3'UTR also show a similar effect of
ski7 mutations.
This fact indicates that Ski7p and the 3'UTR
both affect related
events but that Ski7p does not act by repressing
3'UTR
function.
Translation efficiency and mRNA stability.
Translation and
mRNA turnover are intertwined in complex and poorly understood ways.
Translation may either protect an mRNA or lead to its decay. For
example, in nonsense-mediated decay, failure of translation of an mRNA
leads to mRNA degradation (16). In contrast, there are
several cases in which mRNA degradation requires translation of the
mRNA to be degraded (2, 39). The 5' cap and 3' poly(A)
structures each promote translation and protect the mRNA from degradation.
If one assumes that initial rates of translation of electroporated mRNA
reflect translation efficiency and that functional
half-life reflects
mRNA stability, the experiments reported here
show effects of
ski7 mutations on both. Which is the primary effect?
The
relationship of translation kinetics to initiation rates and
mRNA
degradation depends on several assumptions, not directly
tested here.
Arguing for an effect on translation efficiency are
the Ski7p effect on
initial rates of translation, the similarity
of Ski7p to the known
translation components HBS1p and EF1-

,
and the fact that Ski7p
inactivation produces hypersensitivity
to drugs known to affect
ribosomal function. Even with longer
3'UTRs, which would be expected to
protect an mRNA from 3' degradation,
a substantial effect of a
ski7 mutation is seen. However,
ski2,
ski3,
ski7, and
ski8 mutations also
affect the functional half-life
of mRNA (
24; this
work), effects which could be primary, as
suggested by others
(
1), or secondary to translation effects.
It is also
possible that
ski7 affects both translation efficiency
and
mRNA turnover. For example, the
UPF genes have recently been
found to function both in translation elongation (e.g., in maintenance
of the reading frame) and in nonsense-mediated decay (
8,
16).
Further work is necessary to distinguish these
possibilities.
Relationships of SKI genes.
Although
ski1
leads to slowed growth (20) and
ski6
is lethal (4), ski7
does
not affect cell growth if M dsRNA is absent. Even a quadruple
ski2 ski3 ski7 ski8 mutant is healthy and has kinetics of
translation of C+ A
luciferase mRNA similar
to those of any of the single mutants. This finding indicates that
these four Ski proteins are functionally related, perhaps part of a
common complex or part of a common pathway. Ski7p may be the limiting
component, since its overexpression can eliminate M2 from a
normal strain, but its overexpression does not suppress other
ski mutations.
Although
xrn1/ski1
ski2
, and
xrn1/ski1
ski3
double mutants have been reported to be lethal
(
18), we find that at least
xrn1/ski1
ski2
and
xrn1/ski1
ski7
are viable at 20°C, although
they
do fail to grow at 30°C, the temperature at which the earlier
experiments were performed. Several yeast RNA replicons, because
they
lack both the 5' cap and 3' poly(A), are normally subject
to repression
by the
SKI genes. It is thus possible that this
conditional
lethal phenotype is due to these other replicons.
There is no known
method of curing 20S RNA or 23S RNA, and the
ability of L-BC to be
cured is variable and difficult at best,
making testing of this
question impractical at
present.
 |
ACKNOWLEDGMENTS |
We particularly thank Daniel Gallie for providing numerous
plasmids. We thank Arlen Johnson for providing the
xrn1::URA3 allele. We thank Tom Dever and Alan
Hinnebusch for many helpful comments on the manuscript. Christina Pfund
and Elizabeth Craig kindly provided the HBS1 plasmid.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Bldg. 8, Room
225, NIH, 8 Center Dr. MSC 0830, Bethesda, MD 20892-0830. Phone: (301) 496-3452. Fax: (301) 402-0240. E-mail:
wickner{at}helix.nih.gov.
Present address: Institut de Biologie Physico-Chimique UPR9073,
75005 Paris, France.
Present address: Technology Development and Commercialization
Branch, National Cancer Institute, Rockville, MD 20852.
§
Present address: Center for Biologics Evaluation and Research, Food
and Drug Administration, Bethesda, MD 20892.
 |
REFERENCES |
| 1.
|
Anderson, J. S. J., and R. Parker.
1998.
The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein and 3' to 5' exonucleases of the exosome complex.
EMBO J.
17:1497-1506[Medline].
|
| 2.
|
Bachurski, C. J.,
N. G. Theodorakis,
R. M. Coulson, and D. W. Cleveland.
1994.
An amino-terminal tetrapeptide specifies cotranslational degradation of beta-tubulin but not alpha-tubulin mRNAs.
Mol. Cell. Biol.
14:4076-4086[Abstract/Free Full Text].
|
| 3.
|
Ball, S. G.,
C. Tirtiaux, and R. B. Wickner.
1984.
Genetic control of L-A and L-BC dsRNA copy number in killer systems of Saccharomyces cerevisiae.
Genetics
107:199-217[Abstract/Free Full Text].
|
| 4.
|
Benard, L.,
K. Carroll,
R. C. P. Valle, and R. B. Wickner.
1998.
Ski6p is a homolog of RNA-processing enzymes that affects translation of non-poly(A) mRNAs and 60S ribosomal subunit biogenesis.
Mol. Cell. Biol.
18:2688-2696[Abstract/Free Full Text].
|
| 5.
|
Bostian, K. A.,
J. A. Sturgeon, and D. J. Tipper.
1980.
Encapsidation of yeast killer double-stranded ribonucleic acids: dependence of M on L.
J. Bacteriol.
143:463-470[Abstract/Free Full Text].
|
| 6.
|
Bruenn, J., and B. Keitz.
1976.
The 5' ends of yeast killer factor RNAs are pppGp.
Nucleic Acids Res.
3:2427-2436.
|
| 7.
|
Crouzet, M.,
F. Izgu,
C. M. Grant, and M. F. Tuite.
1988.
The allosuppressor gene SAL4 encodes a protein important for maintaining translational fidelity in Saccharomyces cerevisiae.
Curr. Genet.
14:537-543[Medline].
|
| 8.
|
Cui, Y.,
J. D. Dinman, and S. W. Peltz.
1996.
Mof4-1 is an allele of the UPF1/IFS2 gene which affects both mRNA turnover and 1 ribosomal frameshifting efficiency.
EMBO J.
15:5726-5736[Medline].
|
| 9.
|
Decker, C. J., and R. Parker.
1993.
A turnover pathway for both stable and unstable mRNAs in yeast: evidence for a requirement for deadenylation.
Genes Dev.
7:1632-1643[Abstract/Free Full Text].
|
| 10.
|
Erickson, J. R., and M. Johnston.
1993.
Direct cloning of yeast genes from an ordered set of lambda clones in Saccharomyces cerevisiae by recombination in vivo.
Genetics
134:151-157[Abstract].
|
| 11.
|
Everett, J. G., and D. R. Gallie.
1992.
RNA delivery in Saccharomyces cerevisiae using electroporation.
Yeast
8:1007-1014[Medline].
|
| 12.
|
Gaber, R. F., and M. R. Culbertson.
1982.
Frameshift suppression in Saccharomyces cerevisiae. IV. New suppressors among spontaneous co-revertants of the group II his4-206 and leu2-3 frameshift mutations.
Genetics
101:345-367[Abstract/Free Full Text].
|
| 13.
|
Gallie, D. R.
1991.
The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency.
Genes Dev.
5:2108-2116[Abstract/Free Full Text].
|
| 14.
|
Hsu, C. L., and A. Stevens.
1993.
Yeast cells lacking 5' 3' exoribonuclease 1 contain mRNA species that are poly(A) deficient and partially lack the 5' cap structure.
Mol. Cell. Biol.
13:4826-4835[Abstract/Free Full Text].
|
| 15.
|
Jackson, R. J., and N. Standart.
1990.
Do the poly(A) tail and 3' untranslated region control mRNA translation?
Cell
62:15-24[Medline].
|
| 16.
|
Jacobson, A., and S. W. Peltz.
1996.
Interrelationships of the pathways of mRNA decay and translation in eukaryotic cells.
Annu. Rev. Biochem.
65:693-739[Medline].
|
| 17.
|
Janosi, L.,
S. Mottagui-Tabar,
L. A. Isaksson,
Y. Sekine,
E. Ohtsubo,
S. Zhang,
S. Goon,
S. Nelken,
M. Shuda, and A. Kaji.
1998.
Evidence for in vivo ribosome recycling, the fourth step in protein biosynthesis.
EMBO J.
17:1141-1151[Medline].
|
| 18.
|
Johnson, A. W., and R. D. Kolodner.
1995.
Synthetic lethality of sep1 (xrn1) ski2 and sep1 (xrn1) ski3 mutants of Saccharomyces cerevisiae is independent of killer virus and suggests a general role for these genes in translation control.
Mol. Cell. Biol.
15:2719-2727[Abstract].
|
| 19.
|
Jones, J. S., and L. Prakash.
1990.
Yeast Saccharomyces cerevisiae selectable markers in pUC18 polylinkers.
Yeast
6:363-366[Medline].
|
| 20.
|
Larimer, F. W., and A. Stevens.
1990.
Disruption of the gene XRN1, coding for a 5' 3' exoribonuclease, restricts yeast cell growth.
Gene
95:85-90[Medline].
|
| 21.
|
Lee, S.-G.,
I. Lee,
C. Kang, and K. Song.
1994.
Identification and characterization of a human cDNA homologous to yeast SKI2.
Genomics
25:660-666.
|
| 22.
|
Li, Z.,
S. Pandit, and M. P. Deutscher.
1998.
3' Exoribonucleolytic trimming is a common feature of the maturation of small, stable RNAs in Escherichia coli.
Proc. Natl. Acad. Sci. USA
95:2856-2861[Abstract/Free Full Text].
|
| 23.
|
Liu, R., and S. W. Liebman.
1996.
A translational fidelity mutation in the universally conserved sarcin/ricin domain of 25S yeast ribosomal RNA.
RNA
2:254-263[Abstract].
|
| 24.
|
Masison, D. C.,
A. Blanc,
J. C. Ribas,
K. Carroll,
N. Sonenberg, and R. B. Wickner.
1995.
Decoying the cap mRNA degradation system by a double-stranded RNA virus and poly(A) mRNA surveillance by a yeast antiviral system.
Mol. Cell. Biol.
15:2763-2771[Abstract].
|
| 25.
|
Matsumoto, Y.,
R. Fishel, and R. B. Wickner.
1990.
Circular single-stranded RNA replicon in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
87:7628-7632[Abstract/Free Full Text].
|
| 26.
|
Matsumoto, Y.,
G. Sarkar,
S. S. Sommer, and R. B. Wickner.
1993.
A yeast antiviral protein, SKI8, shares a repeated amino acid sequence pattern with beta-subunits of G proteins and several other proteins.
Yeast
8:43-51.
|
| 27.
|
Maule, A. P., and P. D. Thomas.
1973.
Strains of yeast lethal to brewery yeasts.
J. Inst. Brew. (London)
79:137-141.
|
| 28.
|
Mitchell, P.,
E. Petfalski,
A. Shevchenko,
M. Mann, and D. Tollervey.
1997.
The exosome, a conserved eukaryotic RNA processing complex containing multiple 3' 5' exoribonucleases.
Cell
91:457-466[Medline].
|
| 29.
|
Muhlrad, D.,
C. J. Decker, and R. Parker.
1995.
Turnover mechanisms of the stable yeast PGK1 mRNA.
Mol. Cell. Biol.
15:2145-2156[Abstract].
|
| 30.
|
Mullner, E. W., and L. C. Kuhn.
1988.
A stem-loop in the 3' untranslated region mediates iron-dependent regulation of transferrin receptor mRNA stability in the cytoplasm.
Cell
53:815-825[Medline].
|
| 31.
|
Nelson, R. J.,
T. Ziegelhoffer,
C. Nicolet,
M. Werner-Washburne, and E. A. Craig.
1992.
The translation machinery and 70 kd heat shock protein cooperate in protein synthesis.
Cell
71:97-105[Medline].
|
| 32.
|
Pavlov, M. Y.,
D. V. Freistroffer,
J. MacDougall,
R. H. Buckingham, and M. Ehrenberg.
1997.
Fast recycling of Escherichia coli ribosomes requires both ribosome recycling factor (RRF) and release factor RF3.
EMBO J.
16:4134-4141[Medline]. (Erratum 16:5480.)
|
| 33.
|
Proweller, A., and S. Butler.
1994.
Efficient translation of poly(A)-deficient mRNAs in Saccharomyces cerevisiae.
Genes Dev.
8:2629-2640[Abstract/Free Full Text].
|
| 34.
|
Rhee, S. K.,
T. Icho, and R. B. Wickner.
1989.
Structure and nuclear localization signal of the SKI3 antiviral protein of Saccharomyces cerevisiae.
Yeast
5:149-158[Medline].
|
| 35.
|
Ridley, S. P.,
S. S. Sommer, and R. B. Wickner.
1984.
Superkiller mutations in Saccharomyces cerevisiae suppress exclusion of M2 double-stranded RNA by L-A-HN and confer cold sensitivity in the presence of M and L-A-HN.
Mol. Cell. Biol.
4:761-770[Abstract/Free Full Text].
|
| 36.
|
Riles, L.,
J. E. Dutchik,
A. Baktha,
B. K. McCauley,
E. C. Thayer,
M. P. Leckie,
V. V. Braden,
J. E. Depke, and M. V. Olson.
1993.
Physical maps of the six smallest chromosomes of Saccharomyces cerevisiae at a resolution of 2.6 kilobase pairs.
Genetics
134:81-150[Abstract].
|
| 37.
|
Sachs, A. B.,
P. Sarnow, and M. W. Hentze.
1997.
Starting at the beginning, middle and end: translation initiation in eukaryotes.
Cell
89:831-838[Medline].
|
| 38.
|
Sandbaken, M. G.,
J. A. Lupisella,
B. DiDimenico, and K. Chakraburtty.
1990.
Protein synthesis in yeast: structural and functional analysis of the gene encoding elongation factor 3.
J. Biol. Chem.
265:15838-15844[Abstract/Free Full Text].
|
| 39.
|
Savant-Bhonsale, S., and D. W. Cleveland.
1992.
Evidence for instability of mRNAs containing AUUUA motifs mediated through translation-dependent assembly of a > 20S degradation complex.
Genes Dev.
6:1927-1939[Abstract/Free Full Text].
|
| 40.
|
Schirmaier, F., and P. Philippsen.
1984.
Identification of two genes coding for the translation elongation factor EF-1.
EMBO J.
3:3311-3315[Medline].
|
| 41.
|
Sommer, S. S., and R. B. Wickner.
1982.
Co-curing of plasmids affecting killer double-stranded RNAs of Saccharomyces cerevisiae: [HOK], [NEX], and the abundance of L are related and further evidence that M1 requires L.
J. Bacteriol.
150:545-551[Abstract/Free Full Text].
|
| 42.
|
Sommer, S. S., and R. B. Wickner.
1987.
Gene disruption indicates that the only essential function of the SKI8 chromosomal gene is to protect Saccharomyces cerevisiae from viral cytopathology.
Virology
157:252-256[Medline].
|
| 43.
|
Stevens, A.
1980.
Purification and characterization of a Saccharomyces cerevisiae exoribonuclease which yields 5' mononucleotides by a 5' 3' mode of hydrolysis.
J. Biol. Chem.
255:3080-3085[Abstract/Free Full Text].
|
| 44.
|
Stevens, A., and M. K. Maupin.
1987.
A 5' 3' exoribonuclease of Saccharomyces cerevisiae: size and novel substrate specificity.
Arch. Biochem. Biophys.
252:339-347[Medline].
|
| 45.
|
Tanguay, R. L., and D. R. Gallie.
1996.
Translational efficiency is regulated by the length of the 3' untranslated region.
Mol. Cell. Biol.
16:146-156[Abstract].
|
| 46.
|
Thiele, D. J.,
E. M. Hannig, and M. J. Leibowitz.
1984.
Genome structure and expression of a defective interfering mutant of the killer virus of yeast.
Virology
137:20-31[Medline].
|
| 47.
|
Toh-e, A.,
P. Guerry, and R. B. Wickner.
1978.
Chromosomal superkiller mutants of Saccharomyces cerevisiae.
J. Bacteriol.
136:1002-1007[Abstract/Free Full Text].
|
| 48.
|
Valens, M.,
C. Bohn,
B. Daignan-Fornier,
V. D. Dang, and M. Bolotin-Fukuhara.
1997.
The sequence of a 54.7 kb fragment of yeast chromosome XV reveals the presence of two tRNAs and 24 new open reading frames.
Yeast
13:379-390[Medline].
|
| 49.
|
Wickens, M.,
P. Anderson, and R. J. Jackson.
1997.
Life and death in the cytoplasm: messages from the 3' end.
Curr. Opin. Genet. Dev.
7:220-232[Medline].
|
| 50.
|
Wickner, R. B.
1996.
Double-stranded RNA virus of yeast.
Microbiol. Rev.
60:250-265[Free Full Text].
|
| 51.
|
Wickner, R. B.
1983.
Killer systems in Saccharomyces cerevisiae: three distinct modes of exclusion of M2 double-stranded RNA by three species of double-stranded RNA, M1, L-A-E, and L-A-HN.
Mol. Cell. Biol.
3:654-661[Abstract/Free Full Text].
|
| 52.
|
Wickner, R. B.
1980.
Plasmids controlling exclusion of the K2 killer double-stranded RNA plasmid of yeast.
Cell
21:217-226[Medline].
|
| 53.
|
Widner, W. R., and R. B. Wickner.
1993.
Evidence that the SKI antiviral system of Saccharomyces cerevisiae acts by blocking expression of viral mRNA.
Mol. Cell. Biol.
13:4331-4341[Abstract/Free Full Text].
|
Journal of Virology, April 1999, p. 2893-2900, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lykke-Andersen, S., Brodersen, D. E., Jensen, T. H.
(2009). Origins and activities of the eukaryotic exosome. J. Cell Sci.
122: 1487-1494
[Abstract]
[Full Text]
-
Wilson, M. A., Meaux, S., van Hoof, A.
(2007). A Genomic Screen in Yeast Reveals Novel Aspects of Nonstop mRNA Metabolism. Genetics
177: 773-784
[Abstract]
[Full Text]
-
Meskauskas, A., Petrov, A. N., Dinman, J. D.
(2005). Identification of Functionally Important Amino Acids of Ribosomal Protein L3 by Saturation Mutagenesis. Mol. Cell. Biol.
25: 10863-10874
[Abstract]
[Full Text]
-
van Hoof, A.
(2005). Conserved Functions of Yeast Genes Support the Duplication, Degeneration and Complementation Model for Gene Duplication. Genetics
171: 1455-1461
[Abstract]
[Full Text]
-
Milligan, L., Torchet, C., Allmang, C., Shipman, T., Tollervey, D.
(2005). A Nuclear Surveillance Pathway for mRNAs with Defective Polyadenylation. Mol. Cell. Biol.
25: 9996-10004
[Abstract]
[Full Text]
-
WANG, L., LEWIS, M. S., JOHNSON, A. W.
(2005). Domain interactions within the Ski2/3/8 complex and between the Ski complex and Ski7p. RNA
11: 1291-1302
[Abstract]
[Full Text]
-
BENARD, L.
(2004). Inhibition of 5' to 3' mRNA degradation under stress conditions in Saccharomyces cerevisiae: from GCN4 to MET16. RNA
10: 458-468
[Abstract]
[Full Text]
-
Kushner, D. B., Lindenbach, B. D., Grdzelishvili, V. Z., Noueiry, A. O., Paul, S. M., Ahlquist, P.
(2003). Systematic, genome-wide identification of host genes affecting replication of a positive-strand RNA virus. Proc. Natl. Acad. Sci. USA
100: 15764-15769
[Abstract]
[Full Text]
-
van Hoof, A., Frischmeyer, P. A., Dietz, H. C., Parker, R.
(2002). Exosome-Mediated Recognition and Degradation of mRNAs Lacking a Termination Codon. Science
295: 2262-2264
[Abstract]
[Full Text]
-
Searfoss, A., Dever, T. E., Wickner, R.
(2001). Linking the 3' Poly(A) Tail to the Subunit Joining Step of Translation Initiation: Relations of Pab1p, Eukaryotic Translation Initiation Factor 5B (Fun12p), and Ski2p-Slh1p. Mol. Cell. Biol.
21: 4900-4908
[Abstract]
[Full Text]
-
van Hoof, A., Staples, R. R., Baker, R. E., Parker, R.
(2000). Function of the Ski4p (Csl4p) and Ski7p Proteins in 3'-to-5' Degradation of mRNA. Mol. Cell. Biol.
20: 8230-8243
[Abstract]
[Full Text]
-
Searfoss, A. M., Wickner, R. B.
(2000). 3' poly(A) is dispensable for translation. Proc. Natl. Acad. Sci. USA
97: 9133-9137
[Abstract]
[Full Text]