Previous Article | Next Article 
Journal of Virology, April 1999, p. 2876-2885, Vol. 73, No. 4
Plant Pathology Department, Iowa State
University, Ames, Iowa 50011-1020
Received 12 October 1998/Accepted 4 January 1999
Barley yellow dwarf luteovirus (BYDV) generates three 3'-coterminal
subgenomic RNAs (sgRNAs) in infected cells. The promoter of sgRNA1 is a
putative hot spot for RNA recombination in luteovirus evolution. The
sgRNA1 transcription start site was mapped previously to either
nucleotide 2670 or nucleotide 2769 of BYDV genomic RNA (gRNA) in two
independent studies. Our data support the former initiation site. The
boundaries of the sgRNA1 promoter map between nucleotides 2595 and 2692 on genomic RNA. Computer prediction, phylogenetic comparison, and
structural probing revealed two stem-loops (SL1 and SL2) in the sgRNA1
promoter region on the negative strand. Promoter function was analyzed
by inoculating protoplasts with a full-length infectious clone of the
BYDV genome containing mutations in the sgRNA promoter. Because the
promoter is located in an essential coding region of the replicase
gene, we duplicated it in a nonessential part of the genome from which
a new sgRNA was expressed. Mutational analysis revealed that secondary
structure, but not the nucleotide sequence, was important at the base
of SL1. Regions with both RNA primary and secondary structural features
that contributed to transcription initiation were found at the top of
SL1. Primary sequence, but not the secondary structure, was required in
SL2, which includes the initiation site. Disruption of base pairing near the sgRNA1 start site increased the level of transcription three-
to fourfold. We propose that both primary and secondary structures of
the sgRNA1 promoter of BYDV play unique roles in sgRNA1 promoter
recognition and transcription initiation.
Many positive-strand RNA viruses
express genes via RNA-templated transcription of subgenomic mRNAs.
Several mechanisms of subgenomic RNA (sgRNA) synthesis have been
proposed for various viruses, including internal initiation of the
replicase at subgenomic promoters, premature termination of
negative-sense RNA synthesis with subsequent independent replication,
5' leader-primed synthesis, and RNA recombination (reviewed in
references 19 and 27). So far,
only internal initiation on the negative-strand template has been
demonstrated as a mechanism of sgRNA synthesis in plant RNA viruses
(16, 29, 47), although premature termination during
negative-strand synthesis has been suggested as an alternative mechanism (27, 43). Despite the lack of direct evidence for internal initiation of transcription in most viruses, we will adhere to
convention and refer to cis elements responsible for synthesis of sgRNAs as sgRNA promoters.
Boundaries of sgRNA promoters have been determined for several RNA
viruses in vivo (3, 4, 15, 17, 23, 45, 47, 48). Their sizes
vary from 24 nucleotides (nt) in Sindbis virus (23) and 27 nt in cucumber necrosis virus (17) to nearly 100 nt in
turnip crinkle virus (TCV) (47) and over 100 nt in beet necrotic yellow vein virus (3). With the exception of beet necrotic yellow vein virus (3), the larger portions of
subgenomic promoters are located upstream of the transcription
initiation site (in the positive sense).
In vitro analysis of the sgRNA4 promoter of brome mosaic virus (BMV)
and its comparison with other alpha-like virus subgenomic promoters
revealed four major structural elements: a core promoter, an AU tract
downstream of the initiation site, an oligo(A) tract, and an enhancer
element located upstream of the core (24). However, wild-type levels of RNA4 synthesis in vivo require an additional upstream element that contains repeats of sequences from the core (15). The core promoter of BMV RNA4 has been characterized
extensively in vitro, revealing sequence requirements for transcription
initiation and suggesting that the primary and not the secondary
structure of RNA is critical for specific and accurate initiation, much like in DNA-dependent RNA polymerase promoters (42).
However, RNA secondary and tertiary structures play important roles in various processes of the virus life cycle including RNA replication, recombination, translation, and others. These processes involve RNA-protein interactions (1, 6, 10, 35, 38). The combination of primary and secondary RNA structure requirements is common in
control of virus replication (21, 36, 38, 40). Therefore, we
set out to determine the role of RNA structure in sgRNA promoter function.
The object of this study is the PAV strain of barley yellow dwarf virus
(BYDV), which belongs to the genus Luteovirus (formerly called subgroup I) of the family Luteoviridae (formerly the
luteovirus group) (9, 26). BYDV has a positive-sense, 5.7-kb
genomic RNA (gRNA). In the infected cell, three 3'-coterminal sgRNAs
are produced (12, 18). They are not encapsidated. All three
sgRNAs play different roles in virus replication. sgRNA1 is the mRNA for the coat protein, a readthrough extension of the coat protein involved in aphid transmission, and a 17-kDa protein required for plant
systemic infection (8). sgRNA2 codes for a small 4.3- to
7.0-kDa peptide that is dispensable for virus replication in
protoplasts (33). sgRNA2 may also regulate translation from gRNA and sgRNA1. The role of sgRNA3 which lacks open reading frames (ORFs) is unclear (27, 28, 31).
The family Luteoviridae is split into two major genera,
Luteovirus and Polerovirus, based on differences
in the 5' halves of their genomes (9, 26). The genes in
these regions, including the RNA-dependent RNA polymerase (RdRp), are
unrelated between the genera (28). The border between
divergent and homologous regions is located between ORF2 and ORF3 (RdRp
and coat protein genes) (28). This region also includes the
5' end of sgRNA1. Based on this observation, we proposed that
recombination has occurred during luteovirus evolution by replicase
strand switching at the subgenomic promoters (28, 30).
As a first step in testing the recombination model, we have begun
mapping the sgRNA promoters of BYDV. In this study, we mapped the
primary and secondary structures required for sgRNA1 synthesis in
detail. We show that both primary and secondary RNA structure play
unique roles in promoter recognition by viral replicase in vivo.
Plasmids.
pPAV6 is a full-length cDNA clone of BYDV-PAV
described in reference 11. pGK-1 was constructed by
cloning the AvaI (2456)-SspI (2737) fragment of
pPAV6 into pGEM-3Z digested with AvaI and SspI. Mutants pKel-6, pKel-f, and p2670M were constructed by two-step PCR
(20). To make pKel-6 and pKel-f, in the first round of PCR we used an upstream mutagenic primer,
5'-GCCCAACTCCAGTC[G/C/A]GT[T/C]AAAGTGACGACTCCACAT-3' (altered bases in boldface), spanning bases 2655 to 2690 and a downstream primer (5'-CTGAATTCGTTCACCACC-3') complementary
to bases 2867 to 2850. For 2670M, we used an upstream mutagenic primer (5'-CCAGAGTCTGAAGGTGACGACT-3') complementary to
bases 2663 to 2684 and the above downstream primer. The product of the
first round was gel purified and used in the second round of PCR as the
downstream primer with the upstream primer RB1100
(5'-TGGCTCTTGCACTTGAAC-3') spanning bases 1927 to 1945. The
resulting PCR product was digested with Bst1107 I and
Tth111 I and cloned into pPAV6 cut with Bst1107 I
and Tth111 I. Mutants with the duplicated sgRNA1 and sgRNA3 promoters were constructed by PCR amplification of the promoter region
with the primers listed in Table 1,
containing flanking KpnI restriction sites, and by cloning
KpnI-digested PCR products into the unique KpnI
site of pPAV6 (4154). For the sgRNA1 promoter secondary structure
probing, pT7SGP1 was constructed by amplifying a region of pPAV6
between nt 2595 and 2716 with primers 2595 (Table 1) and T7SGP1
(CCGGAATTCTAATACGACTCACTATAGGGATGGAAAGCAGTATTGATT, EcoRI site underlined, T7 promoter italicized), which
contained flanking KpnI and EcoRI restriction
sites, respectively, and cloning the PCR product into the plasmid
pUC118/1180 described in reference 11.
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Primary and Secondary Structural Elements Required for
Synthesis of Barley Yellow Dwarf Virus Subgenomic RNA1
and
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Primers used to construct mutants of the duplicated
sgRNA promotersa
Infection of protoplasts and Northern blot analysis. Infectious RNA transcripts were obtained by transcription in vitro of plasmids linearized with SmaI, by using T7 RNA polymerase (RiboMax kit; Promega, Madison, Wis.). Oat protoplasts were prepared and inoculated with 10 µg of RNA as described in reference 12. Total RNA was extracted from inoculated protoplasts by using the Qiagen (Los Angeles, Calif.) RNeasy plant RNA isolation kit. RNA (5 to 10 µg) was analyzed by Northern blot hybridization essentially as described in reference 41. A probe complementary to the 3'-terminal 1.5 kb of the PAV genome was used to detect viral gRNA and sgRNA accumulation. This probe was obtained by in vitro transcription of the plasmid pSP10 (12) linearized with HindIII with T7 RNA polymerase. Membranes hybridized with this probe were exposed to PhosphorImager screens for 1 to 2 days. The subgenomic promoter activity was quantified as the ratio of the sgRNA1A signal intensity to that of the gRNA. Because of the significant accumulation of the lower-molecular-mass RNA due to RNA degradation, the value of the sgRNA1A signal was determined by subtracting the background value (region under the sgRNA1A band) from the sgRNA1A signal. All mutants were evaluated in two to five separate experiments.
RNA structure analysis.
pT7SGP1 was linearized with
KpnI prior to transcription with T7 RNA. Transcripts were 5'
end labeled with [
-32P]ATP as described in references
14 and 46. RNA was purified by
denaturing 5% polyacrylamide-8 M urea gel electrophoresis. Structural
probing with imidazole was performed in 0.04 mM NaCl-1 mM EDTA-10 mM
MgCl2 with 0, 0.8, and 1.6 M imidazole for 17 and 22 h
at 25°C as described in references 14 and
46. Partial digestion with T1 RNase was
done as described in reference 32. Reaction products
were separated by using denaturing 6% polyacrylamide-8 M urea gel
electrophoresis. The gels were dried and exposed to PhosphorImager
screens for 1 to 3 days and visualized with a STORM 840 PhosphorImager
(Molecular Dynamics, Sunnyvale, Calif.). The U2 and T1 RNA
sequencing ladders were generated as described in references
14 and 46.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Reexamining the 5' end of sgRNA1. The 5' end of sgRNA1 of BYDV-PAV was mapped to position 2769 of gRNA by Dinesh-Kumar et al. (12) and to position 2670 by Kelly et al. (18). The 99-nt discrepancy has been attributed to the two different isolates of BYDV-PAV used in these studies: Australia and Illinois isolates were used by Kelly et al. and by Dinesh-Kumar et al., respectively. However, the high homology of the two isolates as well as a conserved hexanucleotide, GUGAAG, present at the 5' ends of the gRNA and sgRNA1 and sgRNA2, revealed in the study by Kelly et al. (18), prompted us to revisit this issue. We constructed a probe, pGK-1, that is complementary to the region of BYDV gRNA (bases 2456 to 2737) that spans the sgRNA1 start site as mapped by Kelly et al. (2670) but should not detect sgRNA1 as mapped by Dinesh-Kumar et al. (2769 [Fig. 1]). This probe hybridized with sgRNA1 of BYDV-PAV-Illinois and an in vitro transcript that contains the 5' end at 2670. It did not detect an in vitro transcript with the 5' end at 2769. Therefore, the 5' extremity of sgRNA1 of this isolate is in fact well upstream of 2769 and consistent with the 5' end at 2670 in BYDV-PAV-Australia (Fig. 1). Promoter mapping described herein supports an initiation site at or near 2670.
|
Mutations near the sgRNA1 start site affect transcription. The sgRNA1 initiation site (2670) is located within ORF2, which encodes viral RdRp (Fig. 1), which is required for replication (33). To examine the possibility of using deletion mutagenesis to map the subgenomic promoter, we introduced a stop codon at position 2650 of the infectious clone, pPAV6, which truncated ORF2 by 30 3'-terminal codons. No replication of this mutant transcript in oat protoplasts was detected by Northern blot analysis (data not shown). Thus, deletion mapping of the subgenomic promoter in this region was not possible.
To determine the importance of individual nucleotides around the start site for sgRNA synthesis, we introduced point mutations in this region of pPAV6. Two mutants with five base changes around the start site replicated but synthesized no sgRNA1 (Fig. 2). One had a Val
Asp amino acid
change; the other had no amino acid changes (Fig. 2). To test the
importance of the G at the initiation site, it alone was mutated to a C
in mutant 2670M. This resulted in an unavoidable amino acid
substitution (ValLeu). This mutant did not replicate at all (Fig.
2). This is surprising considering that the more radical change of
ValAsp at this site did not knock out replication. Thus, either the
RdRp tolerated Asp but not Leu at amino acid position 825, or the
particular base that coincides with the 5' end of sgRNA1 is essential
for gRNA replication. Mutants Kel-6 and Kel-f demonstrated the
sensitivity of sgRNA1 transcription to changes in the conserved
hexanucleotide GUGAAG and immediately upstream of the
initiation site. Mutant 2670M further emphasized the difficulty of the
promoter characterization due to potential undesired alterations in
RdRp function.
|
Mapping the boundaries of the sgRNA1 promoter. To allow more mutagenesis of the sgRNA1 promoter, we moved a copy of it to a nonessential portion of the genome. This duplication of subgenomic promoters and this synthesis of sgRNAs from ectopic locations have been demonstrated elsewhere for several RNA viruses (3, 4, 15, 22, 45, 47). We duplicated a 314-nt region flanking the putative sgRNA1 initiation site (nt 2503 to 2816) and introduced it into a unique KpnI site in ORF5 (position 4154 [Fig. 3A]). This ORF is not required for virus replication in protoplasts (33). As expected, the promoter duplication resulted in the expression of an additional 1.7-kb sgRNA (sgRNA1A [Fig. 3B]). This caused a dramatic drop in accumulation of sgRNA1 from its natural setting and also reduced gRNA levels. This phenomenon of reduced synthesis of sgRNAs from upstream promoters when additional promoters are inserted downstream has been observed elsewhere with other RNA viruses (15, 47). Reduced gRNA accumulation is likely due to lack of coat protein synthesis (33) caused by reduced levels of its mRNA (sgRNA1). This ectopic expression of sgRNA1 set the stage for the deletion mapping and detailed characterization of the sgRNA1 promoter without interfering with the RdRp coding region.
|
Secondary structure prediction for the sgRNA1 promoter. To explore the possible role of RNA secondary structure in sgRNA1 synthesis, we analyzed the 98-nt promoter sequence for potential RNA folding patterns by using the MFOLD program (49). Because sgRNA synthesis has been shown to occur by internal initiation of transcription on the negative-strand template in other viruses, we used the complement of the mapped subgenomic promoter region for the secondary structure predictions. Most of the suboptimal folding patterns contained two stem-loop structures (SL1 and SL2). There were two major variations of the SL1 folding: structure I and structure II (Fig. 4A). To establish which one is more likely to exist, we compared the sgRNA1 promoter regions of other BYDV isolates and the related soybean dwarf virus (SbDV). The BYDV sequences were too highly conserved to shed light on the secondary structure, while SbDV diverged significantly (Fig. 4B). The predicted structure of the SbDV subgenomic promoter region resembled only that of BYDV-PAV structure II. Sequence covariations found in SbDV revealed four sites at which base changes retained base pairing (boxed base pairs [Fig. 4A]) in structure II. Thus, structure II is more likely to exist in BYDV, even though it is calculated to be slightly less stable than structure I (Fig. 4A).
|
Nuclease probing of the sgRNA1 promoter secondary structure. To test the existence of the two computer-predicted stem-loops in the sgRNA1 promoter, we constructed a plasmid, pT7SGP1, which contained a region of the negative-strand gRNA spanning the minimal sgRNA1 promoter (nt 2595 to 2716) cloned behind the bacteriophage T7 promoter. For RNA secondary structure analysis, we used 5'-end-labeled in vitro transcripts of the sgRNA1 promoter obtained from KpnI-linearized pT7SGP1. To detect double- and single-stranded RNA regions within the subgenomic promoter, we performed partial digests of the 5'-end-labeled transcripts with RNase T1 (cuts single-stranded G's) and imidazole, a chemical RNase that cleaves RNA at all single-stranded bases. Imidazole has been used elsewhere to resolve secondary structure of various RNAs (14, 46).
Both the T1 and the imidazole analyses identified most of the single-stranded RNA regions corresponding to those predicted by computer (Fig. 5A). The lower part of SL2 was sensitive to nuclease, suggesting the existence of a single-stranded junction between the two major stem-loop domains. The upper and the lower regions of SL1 were well protected from both T1 and imidazole digestion, implying stable RNA helices. Highly protected C2648/C2649/A2650 and U2602/G2603/G2604 appeared paired to each other, whereas both G2605 and G2647 were nuclease sensitive and consistent with the bulge in structure II (Fig. 4A and 5A). Therefore, despite the lower predicted stability, structure II appears more likely to form in solution than does structure I.
|
Primary and secondary RNA structures of SL1 are required for transcription of sgRNA1. To test the involvement of primary and secondary RNA structure elements of SL1 in sgRNA synthesis, we introduced a series of mutations into the duplicated sgRNA1 promoter. Oat protoplasts were inoculated with the mutants, and total RNA was isolated 24 h postinoculation (hpi) and analyzed by Northern blot hybridization. We used the ratio of steady-state levels of sgRNA1A to those of gRNA as a measure of the promoter activity.
To examine the role of the helix at the base of SL1, we introduced nucleotide alterations (blocks of 4 nt) in both strands of the helix that disrupted and restored the base pairing (mutants SL11A, SL11B, and SL11C [Fig. 6A]). Transcription of sgRNA1A was eliminated when the base pairing was disrupted in mutants SL11A (sgRNA1A/gRNA ratio = 0.06 ± 0.02) and SL11B (0.02 ± 0.01) and was restored to a level higher than that of wild type (construct 2SL, 0.51 ± 0.08 [Fig. 6B]) in the compensatory mutant SL11C (1.56 ± 0.25 [Fig. 6B]). These results indicated that the secondary structure, and not the nucleotide sequence at the bottom of SL1, is required for transcription.
|
Nucleotide sequence but not the secondary structure of SL2 is required for transcription of sgRNA1. We next characterized the sequence and structural elements of SL2 that are involved in sgRNA synthesis. As reported for initial mutants, sequence alterations within five bases of the transcription start site in its natural location in ORF2 knocked out sgRNA1 synthesis (Fig. 2). Mutations in Kel-6, Kel-f, and 2670M were predicted to disrupt the secondary structure of SL2. To separate the influence of the nucleotide sequence alteration from that of the RNA secondary structure disruption, we designed a series of sgRNA1 promoter mutants that disrupted and restored the secondary structure of SL2 in the duplicated promoter. Three nucleotides near the start site were altered to disrupt base pairing in either strand of SL2 in mutants trpl1 and trpl2 (Fig. 7A). The mutant trplc contained both of the above sets of substitutions to restore the structure of SL2 (Fig. 7A). No sgRNA1A synthesis was detected in trpl1 (0.01 ± 0.02) and trplc (0.0 ± 0.02), both of which are mutated in the conserved hexanucleotide at the start of sgRNA1 (Fig. 7B). However, trpl2 exhibited a level of transcription three times higher than that of wild type (1.60 ± 0.02). Thus, the primary structure adjacent to the start is required for sgRNA synthesis (Fig. 7B), and SL2 secondary structure may actually inhibit transcription.
|
0.02 ± 0.01) and comp1
(0.16 ± 0.21), and transcription almost four times higher than
the wild-type level of transcription in 2688C (1.95 ± 0.32) (Fig.
7B). Finally, changing the sequence of the SL2 terminal loop to that of
its complement in the mutant SL21 (Fig. 7A) reduced the sgRNA1A level
to 0.11 ± 0.01 (Fig. 7B), indicating the importance, but not the
absolute requirement, of the nucleotide sequence of the SL2 terminal
loop. These results stressed the importance of the primary RNA sequence
and the negative effect of the secondary structure at the initiation site.
In pursuit of the nucleotides in SL2 that could be altered without
affecting transcription, we replaced the 5'-terminal conserved hexanucleotide of sgRNA1 (GUGAAG in the positive strand)
with the 5' terminus of sgRNA3 (GACGAC in the positive
strand). Interestingly, this mutant, SL2SG3 (Fig. 7A), did not produce
detectable levels of sgRNA1A (0.0 ± 0.02 [Fig. 7B]). We also
constructed a mutant, SGP300, with the duplicated putative sgRNA3
promoter region (301 nt, 5150 to 5450) spanning the sgRNA3 start site
(nt 5348) inserted in the KpnI site in ORF5 in order to test
if this promoter could function outside its wild-type location. The
mutant produced sgRNA1A (0.72 ± 0.04 [Fig. 7B]), which
indicated that the sgRNA3-specific 5'-terminal hexanucleotide could
function in the context of its own promoter. This shows that the
replicase recognizes very different promoters.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Reevaluation of the 5' end of sgRNA1. Here we show that the 5' end of sgRNA1 is most likely at position 2670 as reported by Kelly et al. (18) and not at our originally reported site of 2769 (12). The error may have occurred due to a variety of technical difficulties, involving mismatches between the probe (from BYDV-PAV Australia) and the viral RNA (BYDV-PAV Illinois), and the unexpectedly far-upstream location of the 5' end. The difficulty of mapping 5' ends of Luteoviridae sgRNAs is further indicated by discrepancies reported for potato leafroll virus. Initially, the 5' end of sgRNA1 of potato leafroll virus was reported to be only 40 nt upstream of the coat protein start codon (44). However, subsequent analysis mapped it to 212 nt upstream at a region which, like BYDV (nt 2670 to 2675), shows homology to the 5' end of the gRNA (25). Phylogenetic comparisons support this latter start site for other members of the Luteoviridae (28).
Structure and function of sgRNA1. Mutations in the subgenomic promoter unveiled roles for three types of structures: (i) one in which the secondary and not the primary structure is important (base of SL1), (ii) an ambiguous region where the primary structure and possibly secondary structure both may influence the transcription efficiency (upper stem and loop of SL1), and (iii) a region where the primary and not the secondary structure is required (stem of SL2). The nuclease probing and phylogenetic analysis support the existence of the base of SL1. Stem-loops have been predicted in sgRNA promoters of other RNA viruses (24, 47, 48), with the initiation site usually located within a single-stranded region. To our knowledge, our data represent the first actual demonstration of a requirement for a specific helical domain in a viral sgRNA promoter. The requirement for primary and not secondary structure at the sgRNA1 initiation site result is consistent with other studies showing the role of single-stranded regions for specific protein recognition (2, 35, 36).
The ambiguous results of the structure probing of the distal portion of SL1 lead us to propose that this portion of the subgenomic promoter forms metastable structures. Alternative conformations have been demonstrated for other viral RNAs (32, 39); therefore, a portion of molecules may also fold as predicted in structure I, or the entire AUUCU:AGAAU stem of structure II may be unpaired, giving a very large bulge between stems at the top and the base of SL1. The 36-base deletion mutant (SL1D) lacking this ambiguously paired region still retained 20% of wild-type promoter activity. This indicates that the deleted region probably does not contact the viral replicase directly but may provide favorable spatial localization of the essential elements.Recognition of the sgRNA1 promoter by replicase. We propose that SL1 acts as a replicase recognition site, placing the replicase in proximity to the start site at the base complementary to 2670. The double-stranded proximal end (bottom) of SL1 may serve only to provide the structural foundation that ensures that the sequence at the distal end (top) of SL1 (Fig. 6) is presented in the proper orientation for specific binding by the replicase. The ambiguously structured, nonessential, central portion of SL1 may play only an auxiliary role in spacing between the distal region and the initiation site.
This model of a separate RNA binding site and adjacent initiation site resembles those proposed for a recombination site in TCV satellite RNAs, subgenomic promoter recognition by BMV replicase (42), and recognition of bacteriophage Q
RNA by its replicase (5). The TCV satellite RNA sequence includes a bulged
stem-loop as the putative replicase binding site adjacent to the actual site at which RNA synthesis takes place (35). The
well-characterized BMV promoter differs by its lack of requirement for
the secondary structure in replicase recognition (42).
However, this difference may be explained in part by the use of a
cell-free transcription system which may have less stringent
requirements for cis elements in vitro than those observed
in vivo (15). The divergent sequences of the three BYDV
promoters may allow differential expression of each. Each sgRNA
promoter may have a separate recognition site on the replicase
holoenzyme, each of which may be on a separate protein factor as shown
for positive- and negative-strand recognition by Q replicase
(5), or the sequences may have different affinities for the
same site on the replicase.
Possible alternative mechanisms of sgRNA1 synthesis. Our data leave open the possibility that sgRNAs could be synthesized by premature termination during negative-strand synthesis on genomic template followed by independent replication of the sgRNA (27). Evidence suggesting such a mechanism has been provided for coronaviruses (7) and dianthoviruses (43). Upstream of the sgRNA1 5' end, stem-loops complementary to SL1 and SL2 are predicted to exist in the positive strand by MFOLD (49). The mutations that support a role for the helix at the base of SL1 in the negative strand could equally well support the role of the complementary helix in the positive strand. Such a structure in the positive strand could inhibit replicase migration along the template, favoring termination. The resulting 3' end of the truncated negative strand would resemble that of full-length negative strand owing to the CACUUC homology, allowing it to be recognized and replicated by the replicase. Thus, that essential sequence would still be serving the promoter function.
The premature termination model has been invoked for red clover necrotic mosaic dianthovirus (RCNMV), owing to a remarkable base pairing between the positive strands of the two gRNAs of the virus that is essential for formation of sgRNA from gRNA1 (43). The polymerase of RCNMV is closely related to that of BYDV (29, 31), and so a similar replication mechanism might apply to BYDV. Because BYDV has only one gRNA, the termination structure would form either as the complement of SL1, as discussed above, or intermolecularly, in which two gRNA molecules dimerize by base pairing at the complementary sequences that would otherwise form the stem-loop. Alternatively, it is possible that other inter- or intramolecular interactions could generate a transcription termination structure. Some observations argue against a premature termination model. The disruption of the secondary structure at the initiation site (SL2) that increases sgRNA1A synthesis (Fig. 7) should have had the opposite effect if sgRNA1A was synthesized by premature termination during the negative-strand synthesis because stable stems should increase termination (37). Furthermore, the role of SL1 is more than just providing a stem-loop structure, which would (in the positive strand) block replicase migration, because mutations at the distal end of SL1 reduced sgRNA1A accumulation independently of their effect on secondary structure.Role in recombination. The presence of an sgRNA promoter at the 3' end of ORF2 is consistent with our proposed model in which Luteoviridae genomes recombine at a subgenomic promoter in the vicinity of the intergenic region between ORF2 and ORF3 (28). This model requires that sgRNAs are generated by internal initiation of the replicase on the negative strand. A premature termination mechanism, followed by independent replication of the sgRNA, is difficult to reconcile with the sgRNA promoter being a recombination hot spot, if a stem-loop in the positive strand facilitates termination. However, if base pairing between gRNAs occurs as with RCNMV, one could imagine replicase occasionally switching gRNA strands, rather than terminating at this base-paired region. This type of recombination, mediated by base pairing between template strands, has been demonstrated for BMV (34).
Evolution of sgRNA promoters. The small sizes of viral genomes often require the overlapping of protein coding regions with cis-acting RNA elements. It is an intriguing question, how genetic information coding for a protein and an RNA cis element with which it interacts coevolved on the same region of viral genome. ORF2 is very sensitive to deletions and point mutations (Fig. 2), while the sgRNA promoters tolerate changes and consist of quite diverse sequences. Thus, we propose that sgRNA promoters evolved independently at the appropriate genomic locations while allowing overlapping ORFs to maintain their function. The size of the BYDV sgRNA1 promoter is comparable to that in other RNA viruses, but no apparent sequence homology can be found with subgenomic promoters of members of other virus groups. This diversity among sgRNA promoters of related virus taxa and ability to tolerate movement to different regions of the genome (3, 4, 15, 22, 45, 47) further support the hypothesis of multiple, independent origins of sgRNA promoters. The only conserved secondary structures among the BYDV promoters are the SL2-like hairpins flanking all initiation sites (Fig. 4C), yet the SL2 stem structure inhibits sgRNA1 transcription (Fig. 7). Perhaps the SL2-like stems serve as negative regulatory elements to prevent too much transcription of the sgRNAs at inappropriate stages in RNA replication. Obviously, much additional research is necessary to unveil this complex interplay of replicase-RNA interactions.
| |
ACKNOWLEDGMENTS |
|---|
We thank Brice Felden for advice on RNA structure probing methods.
We thank the USDA Biotechnology Risk Assessment Research Grants Program (no. 94-39210-0531) and the USDA National Research Initiative (grant no. 98-35303-6447) for funding. This work was part of the Iowa State University Agricultural and Home Economics Experiment Station Project 3545 and supported by Hatch Act and State of Iowa funds.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Plant Pathology Department, 351 Bessey Hall, Iowa State University, Ames, IA 50011-1020. Phone: (515) 294-2436. Fax: (515) 294-9420. E-mail: wamiller{at}iastate.edu.
Paper no. J-18114 of the Iowa State University Agricultural and
Home Economics Experiment Station Project 3545.
Present address: Department of Microbiology, University of
Pennsylvania School of Medicine, Philadelphia, PA 19104-6076.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Andino, R., G. E. Rieckhof, and D. Baltimore. 1990. A functional ribonucleoprotein complex forms around the 5' end of poliovirus RNA. Cell 63:369-380[Medline]. |
| 2. | Ansel-McKinney, P., and L. Gehrke. 1998. RNA determinants of a specific RNA-coat protein peptide interaction in alfalfa mosaic virus: conservation of homologous features in ilarvirus RNAs. J. Mol. Biol. 278:767-785[Medline]. |
| 3. | Balmori, E., D. Gilmer, K. Richards, H. Guilley, and G. Jonard. 1993. Mapping the promoter for subgenomic RNA synthesis on beet necrotic yellow vein virus RNA 3. Biochimie 75:517-521[Medline]. |
| 4. | Boccard, F., and D. Baulcombe. 1993. Mutational analysis of cis-acting sequences and gene function in RNA3 of cucumber mosaic virus. Virology 193:563-578[Medline]. |
| 5. |
Brown, D., and L. Gold.
1996.
RNA replication by Q replicase: a working model.
Proc. Natl. Acad. Sci. USA
93:11558-11562 |
| 6. | Carpenter, C. D., J.-W. Oh, C. Zhang, and A. E. Simon. 1995. Involvement of a stem-loop structure in the location of junction sites in viral RNA recombination. J. Mol. Biol. 245:608-622[Medline]. |
| 7. | Chang, R.-Y., R. Krishnan, and D. A. Brian. 1996. The UCUAAAC promoter motif is not required for high-frequency leader recombination in bovine coronavirus defective interfering RNA. J. Virol. 70:2720-2729[Abstract]. |
| 8. | Chay, C. A., U. B. Gunasinge, S. P. Dinesh-Kumar, W. A. Miller, and S. M. Gray. 1996. Aphid transmission and systemic plant infection determinants of barley yellow dwarf luteovirus-PAV are contained in the coat protein readthrough domain and 17-kDa protein, respectively. Virology 219:57-65[Medline]. |
| 9. | D'Arcy, C., L. Domier, and M. A. Mayo. Luteoviridae. In Seventh report of the International Committee on the Taxonomy of Viruses, in press. Elsevier, New York, N.Y. |
| 10. | Deiman, B. A. L. M., R. M. Kortlever, and C. W. A. Pleij. 1997. The role of the pseudoknot at the 3' end of turnip yellow mosaic virus RNA in minus-strand synthesis by the viral RNA-dependent RNA polymerase. J. Virol. 71:5990-5996[Abstract]. |
| 11. | Di, R., S. P. Dinesh-Kumar, and W. A. Miller. 1993. Translational frameshifting by barley yellow dwarf virus RNA (PAV serotype) in Escherichia coli and in eukaryotic cell-free extracts. Mol. Plant-Microbe Interact. 6:444-452[Medline]. |
| 12. | Dinesh-Kumar, S. P., V. Brault, and W. A. Miller. 1992. Precise mapping and in vitro translation of a trifunctional subgenomic RNA of barley yellow dwarf virus. Virology 187:711-722[Medline]. |
| 13. |
Dinesh-Kumar, S. P., and W. A. Miller.
1993.
Control of start codon choice on a plant viral RNA encoding overlapping genes.
Plant Cell
5:679-692 |
| 14. | Felden, B., H. Himeno, A. Muto, J. McCutcheon, J. Atkins, and R. F. Gesteland. 1997. Probing the structure of the Escherichia coli 10Sa RNA (tmRNA). RNA 3:89-103[Abstract]. |
| 15. |
French, R., and P. Ahlquist.
1988.
Characterization and engineering of sequences controlling in vivo synthesis of brome mosaic virus subgenomic RNA.
J. Virol.
62:2411-2420 |
| 16. | Gargouri, R., R. L. Joshi, J. F. Bol, S. Astier-Manifacier, and A.-L. Haenni. 1989. Mechanism of synthesis of turnip yellow mosaic virus coat protein subgenomic RNA in vivo. Virology 171:386-393[Medline]. |
| 17. | Johnston, J. C., and D. M. Rochon. 1995. Deletion analysis of the promoter for the cucumber necrosis virus 0.9-kb subgenomic RNA. Virology 214:100-109[Medline]. |
| 18. | Kelly, L., W. L. Gerlach, and P. M. Waterhouse. 1994. Characterisation of the subgenomic RNAs of an Australian isolate of barley yellow dwarf luteovirus. Virology 202:565-573[Medline]. |
| 19. | Lai, M. M. C., and D. Cavanagh. 1997. The molecular biology of coronaviruses. Adv. Virus Res. 48:1-100. |
| 20. | Landt, O., H.-P. Grunert, and U. Hahn. 1990. A general method for rapid site-directed mutagenesis using the polymerase chain reaction. Gene 96:125-128[Medline]. |
| 21. |
Lauber, E.,
H. Guilley,
K. Richards,
G. Jonard, and D. Gilmer.
1997.
Conformation of the 3'-end of beet necrotic yellow vein benevirus RNA 3 analysed by chemical and enzymatic probing and mutagenesis.
Nucleic Acids Res.
25:4723-4729 |
| 22. | Lehto, K., G. L. Grantham, and W. O. Dawson. 1990. Insertion of sequences containing the coat protein subgenomic RNA promoter and leader in front of the tobacco mosaic virus 30K ORF delays its expression and causes defective cell-to-cell movement. Virology 174:145-157[Medline]. |
| 23. |
Levis, R.,
S. Schlesinger, and H. V. Huang.
1990.
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
J. Virol.
64:1726-1733 |
| 24. |
Marsh, L. E.,
T. W. Dreher, and T. C. Hall.
1988.
Mutational analysis of the core and modulator sequences of the BMV RNA3 subgenomic promoter.
Nucleic Acids Res.
16:981-995 |
| 25. |
Miller, J. S., and M. A. Mayo.
1991.
The location of the 5' end of the potato leafroll luteovirus subgenomic coat protein mRNA.
J. Gen. Virol.
72:2633-2638 |
| 26. | Miller, W. A. Luteoviridae. In R. G. Webster and A. Granoff (ed.), Encyclopedia of virology, 2nd ed., in press. Academic Press, London, United Kingdom. |
| 27. | Miller, W. A., C. M. Brown, and S. Wang. 1997. New punctuation for the genetic code: luteovirus gene expression. Semin. Virol. 8:3-13. |
| 28. | Miller, W. A., S. P. Dinesh-Kumar, and C. P. Paul. 1995. Luteovirus gene expression. Crit. Rev. Plant Sci. 14:179-211. |
| 29. |
Miller, W. A.,
T. W. Dreher, and T. C. Hall.
1985.
Synthesis of brome mosaic virus subgenomic RNA in vitro by internal initiation on () sense genomic RNA.
Nature
313:68-70[Medline].
|
| 30. | Miller, W. A., G. Koev, and B. R. Mohan. 1997. Are there risks associated with transgenic resistance to luteoviruses? Plant Dis. 81:700-710. |
| 31. | Miller, W. A., and L. Rasochova. 1997. Barley yellow dwarf viruses. Annu. Rev. Phytopathol. 35:167-190. [Medline] |
| 32. |
Miller, W. A., and S. L. Silver.
1991.
Alternative tertiary structure attenuates self-cleavage of the ribozyme in the satellite RNA of barley yellow dwarf virus.
Nucleic Acids Res.
19:5313-5320 |
| 33. | Mohan, B. R., S. P. Dinesh-Kumar, and W. A. Miller. 1995. Genes and cis-acting sequences involved in replication of barley yellow dwarf virus-PAV RNA. Virology 212:186-195[Medline]. |
| 34. |
Nagy, P. D., and J. J. Bujarski.
1993.
Targeting the site of RNA-RNA recombination in brome mosaic virus with antisense sequences.
Proc. Natl. Acad. Sci. USA
90:6390-6394 |
| 35. | Nagy, P. D., C. Zhang, and A. E. Simon. 1998. Dissecting RNA recombination in vitro: role of RNA sequences and the viral replicase. EMBO J. 17:2392-2403[Medline]. |
| 36. | Parsley, T. B., J. S. Towner, L. B. Blyn, E. Ehrenfeld, and B. L. Semler. 1997. Poly (rC) binding protein 2 forms a ternary complex with the 5'-terminal sequences of poliovirus RNA and the viral 3CD proteinase. RNA 3:1124-1134[Abstract]. |
| 37. | Platt, T. 1981. Termination of transcription and its regulation in the tryptophan operon of E. coli. Cell 24:10-23[Medline]. |
| 38. |
Pogue, G. P., and T. C. Hall.
1992.
The requirement for a 5' stem-loop structure in brome mosaic virus replication supports a new model for viral positive-strand RNA initiation.
J. Virol.
66:674-684 |
| 39. |
Proutski, V.,
E. A. Gould, and E. C. Holmes.
1997.
Secondary structure of the 3' untranslated region of flaviviruses: similarities and differences.
Nucleic Acids Res.
25:1194-1202 |
| 40. | Rohll, J. B., D. H. Moon, D. J. Evans, and J. W. Almond. 1995. The 3' untranslated region of picornavirus RNA: features required for efficient genome replication. J. Virol. 69:7835-7844[Abstract]. |
| 41. |
Seeley, K. A.,
D. H. Byrne, and J. T. Colbert.
1992.
Red light-independent instability of oat phytochrome mRNA in vivo.
Plant Cell
4:29-38 |
| 42. |
Siegel, R. W.,
S. Adkins, and C. C. Kao.
1997.
Sequence-specific recognition of a subgenomic RNA promoter by a viral RNA polymerase.
Proc. Natl. Acad. Sci. USA
94:11238-11243 |
| 43. |
Sit, T. L.,
A. A. Vaewhongs, and S. A. Lommel.
1998.
RNA-mediated transactivation of transcription from a viral RNA.
Science
281:829-832 |
| 44. |
Tacke, E.,
D. Prufer,
F. Salamini, and W. Rohde.
1990.
Characterization of a potato leafroll luteovirus subgenomic RNA: differential expression by internal translation initiation and UAG suppression.
J. Gen. Virol.
71:2265-2272 |
| 45. | van der Vossen, E. A., T. Notenboom, and J. F. Bol. 1995. Characterization of sequences controlling the synthesis of alfalfa mosaic virus subgenomic RNA in vivo. Virology 212:663-672[Medline]. |
| 46. |
Vlassov, V. V.,
G. Zuber,
B. Felden,
J. P. Behr, and R. Giege.
1995.
Cleavage of tRNA with imidazole and spermine imidazole constructs: a new approach for probing RNA structure.
Nucleic Acids Res.
23:3161-3167 |
| 47. | Wang, J., and A. E. Simon. 1997. Analysis of the two subgenomic RNA promoters for turnip crinkle virus in vivo and in vitro. Virology 232:174-186[Medline]. |
| 48. | Zavriev, S. K., C. M. Hickey, and S. A. Lommel. 1996. Mapping of the red clover necrotic mosaic virus subgenomic RNA. Virology 216:407-410[Medline]. |
| 49. |
Zuker, M.
1989.
On finding all suboptimal foldings of an RNA molecule.
Science
244:48-52 |
Journal of Virology, April 1999, p. 2876-2885, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sztuba-Solinska, J., Bujarski, J. J.
(2008). Insights into the Single-Cell Reproduction Cycle of Members of the Family Bromoviridae: Lessons from the Use of Protoplast Systems. J. Virol.
82: 10330-10340
[Full Text] -
Pal, N., Boyapalle, S., Beckett, R., Miller, W. A., Bonning, B. C.
(2007). A Baculovirus-Expressed Dicistrovirus That Is Infectious to Aphids. J. Virol.
81: 9339-9345
[Abstract] [Full Text] -
Shen, R., Rakotondrafara, A. M., Miller, W. A.
(2006). trans Regulation of Cap-Independent Translation by a Viral Subgenomic RNA.. J. Virol.
80: 10045-10054
[Abstract] [Full Text] -
Pasternak, A. O., Spaan, W. J. M., Snijder, E. J.
(2006). Nidovirus transcription: how to make sense...?. J. Gen. Virol.
87: 1403-1421
[Abstract] [Full Text] -
Li, W., Wong, S.-M.
(2006). Analyses of subgenomic promoters of hibiscus chlorotic ringspot virus and demonstration of 5' untranslated region and 3'-terminal sequences functioning as subgenomic promoters.. J. Virol.
80: 3395-3405
[Abstract] [Full Text] -
Pasternak, A. O., Spaan, W. J. M., Snijder, E. J.
(2004). Regulation of Relative Abundance of Arterivirus Subgenomic mRNAs. J. Virol.
78: 8102-8113
[Abstract] [Full Text] -
Man, M., Epel, B. L.
(2004). Characterization of regulatory elements within the coat protein (CP) coding region of Tobacco mosaic virus affecting subgenomic transcription and green fluorescent protein expression from the CP subgenomic RNA promoter. J. Gen. Virol.
85: 1727-1738
[Abstract] [Full Text] -
Morales, M., Barcena, J., Ramirez, M. A., Boga, J. A., Parra, F., Torres, J. M.
(2004). Synthesis in Vitro of Rabbit Hemorrhagic Disease Virus Subgenomic RNA by Internal Initiation on (-)Sense Genomic RNA: MAPPING OF A SUBGENOMIC PROMOTER. J. Biol. Chem.
279: 17013-17018
[Abstract] [Full Text] -
Song, S. I., Miller, W. A.
(2004). cis and trans Requirements for Rolling Circle Replication of a Satellite RNA. J. Virol.
78: 3072-3082
[Abstract] [Full Text] -
Ayllon, M. A., Gowda, S., Satyanarayana, T., Karasev, A. V., Adkins, S., Mawassi, M., Guerri, J., Moreno, P., Dawson, W. O.
(2003). Effects of Modification of the Transcription Initiation Site Context on Citrus Tristeza Virus Subgenomic RNA Synthesis. J. Virol.
77: 9232-9243
[Abstract] [Full Text] -
Park, J.-W., Desvoyes, B., Scholthof, H. B.
(2002). Tomato Bushy Stunt Virus Genomic RNA Accumulation Is Regulated by Interdependent cis-Acting Elements within the Movement Protein Open Reading Frames. J. Virol.
76: 12747-12757
[Abstract] [Full Text] -
Domier, L. L., McCoppin, N. K., Larsen, R. C., D'Arcy, C. J.
(2002). Nucleotide sequence shows that Bean leafroll virus has a Luteovirus-like genome organization. J. Gen. Virol.
83: 1791-1798
[Abstract] [Full Text] -
Lindenbach, B. D., Sgro, J.-Y., Ahlquist, P.
(2002). Long-Distance Base Pairing in Flock House Virus RNA1 Regulates Subgenomic RNA3 Synthesis and RNA2 Replication. J. Virol.
76: 3905-3919
[Abstract] [Full Text] -
Chen, M.-H., Roossinck, M. J., Kao, C. C.
(2000). Efficient and Specific Initiation of Subgenomic RNA Synthesis by Cucumber Mosaic Virus Replicase In Vitro Requires an Upstream RNA Stem-Loop. J. Virol.
74: 11201-11209
[Abstract] [Full Text] -
Koev, G., Miller, W. A.
(2000). A Positive-Strand RNA Virus with Three Very Different Subgenomic RNA Promoters. J. Virol.
74: 5988-5996
[Abstract] [Full Text] -
Bruyere, A., Wantroba, M., Flasinski, S., Dzianott, A., Bujarski, J. J.
(2000). Frequent Homologous Recombination Events between Molecules of One RNA Component in a Multipartite RNA Virus. J. Virol.
74: 4214-4219
[Abstract] [Full Text] -
Hagiwara, Y., Peremyslov, V. V., Dolja, V. V.
(1999). Regulation of Closterovirus Gene Expression Examined by Insertion of a Self-Processing Reporter and by Northern Hybridization. J. Virol.
73: 7988-7993
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»