Previous Article | Next Article 
Journal of Virology, April 1999, p. 2798-2802, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
A Single Amino Acid in the Adenovirus Type 37 Fiber
Confers Binding to Human Conjunctival Cells
Shuang
Huang,
Vijay
Reddy,
Nabarun
Dasgupta, and
Glen R.
Nemerow*
Departments of Immunology and Molecular
Biology, The Scripps Research Institute, La Jolla, California
Received 18 September 1998/Accepted 15 December 1998
 |
ABSTRACT |
A 46-kDa receptor, coxsackievirus-adenovirus (Ad) receptor (CAR),
mediates cell attachment of a number of different Ad serotypes; however, not all Ad serotypes utilize this receptor for infection. Moreover, the precise amino acid sequences in the Ad fiber protein that
mediate cell attachment have yet to be identified. We
investigated the interaction of subgroup D Ads with human ocular
cells. Ad serotype 37 (Ad37), a virus associated with epidemic
keratoconjunctivitis, but not a closely related virus serotype, Ad19p,
exhibited preferential binding to and infection of human
conjunctival cells. A single amino acid substitution in the Ad19p fiber
distal domain (knob), Glu240 to Lys, conferred
binding to conjunctival cells, while the reverse substitution in the
Ad37 fiber abrogated cell binding. These findings provide new
information on the fiber sequences that regulate Ad host cell tropism.
 |
INTRODUCTION |
Human adenoviruses (Ads) are
associated with a significant number of gastrointestinal and
respiratory infections in young children and are also a leading cause
of viral conjunctivitis. Several subgroup D viruses, including Ad
serotype 8 (Ad8), Ad19p, and Ad37, have been frequently isolated from
patients during outbreaks of epidemic keratoconjunctivitis (EKC)
(5, 14). EKC can be distinguished from viral conjunctivitis
in that it involves the cornea. Persistent Ad infection in EKC can
threaten long-term visual function. At present, there is little
information on the viral and cellular factors that govern the tropism
of certain Ad serotypes for specific ocular cell types.
The Ad fiber protein is an oligomeric molecule comprised of three
identical polypeptide subunits of 30 to 65 kDa (12). The fiber contains a conserved N-terminal tail that mediates interaction with the Ad penton base protein, a variable-length elongated (shaft) domain, and a C-terminal knob that mediates high-affinity interaction with cell receptors (10). Recent studies (11)
have indicated that multiple Ad serotypes from different subgroups
recognize a 46-kDa cell receptor that also serves as the receptor for
the subgroup B coxsackieviruses (designated CAR [coxsackievirus-Ad receptor]) (4, 13). However, not all Ads use CAR to bind to
host cells. The identity of cell receptors for many other Ads remain to
be determined.
The three-dimensional structure of the Ad5 fiber N-terminal knob domain
has been determined (17). A comparison of the fiber knob
sequences of different Ad serotypes together with the crystal structure
of the protein has suggested that the sites for CAR binding interaction
are located on residues lining the walls and central depression of the
fiber knob (4, 13). However, this has not been formally
demonstrated. Moreover, the locations of receptor binding sites for
other Ad serotypes on the fiber protein have not been identified.
The amino acid sequences of the Ad19p and Ad37 fiber proteins
have been reported (1). Interestingly, only two differences (amino acid residues K/E240 and N/D340) were
noted in the knob regions of these two related viruses. In the studies
presented here, we sought to determine whether either of these amino
acid sequences played a role in Ad interaction with cell receptors.
 |
MATERIALS AND METHODS |
Cell lines, viruses, and plaque assays.
Human epithelial
cells A549, 293 (Ad5-transformed embryonic kidney cells), and Chang C
conjunctival cells (American Type Culture Collection [ATCC]) were
maintained in complete Dulbecco modified Eagle medium containing 10%
fetal bovine serum. Ad37 (ATCC) was propagated in Chang C cells, while
Ad2 and Ad19p (ATCC) were produced in A549 cells. High-titered virus
culture supernates were added to 90 to 95% confluent cell monolayers
in 162-cm2 tissue culture flasks. When more than 60% of
the cells showed evidence of cytopathic effect the cells were detached
by using 10 mM EDTA, resuspended in 0.5 to 1.0 ml of complete Dulbecco modified Eagle medium, and then subjected to three cycles of
freezing-thawing to release viral particles from infected cells.
Virions were subsequently purified by banding on 16 to 40% continuous
CsCl density gradients as previously described (6) and then
dialyzed against 10 mM Tris-buffered saline (pH 8.1) containing 10%
glycerol. Viral protein content was measured by the Bio-Rad protein
assay. The number of viral particles was calculated based on the known
molecular weight of Ad2 virions (1 µg = 4 × 109 particles).
The infectivity of Ad37 was determined by plaquing the virus on Chang C
cells. Various dilutions of virus in a total volume of 2 ml were added
to cell monolayers in six-well tissue culture plates and incubated for
2 h at 37°C. The cells were then washed with serum-free medium
and overlaid with 3 ml of 0.5% agarose (SeaKem; FMC) in medium. The
cells were observed daily for the appearance of plaques, and
quantitation was performed on day 7 postinfection. Infections of A549
and 293 cells by Ad37 and Ad19p were performed in identically.
Infectivity of Ad2 was determined by plaquing on 293 cells.
Recombinant wild-type and mutant Ad fiber proteins.
Recombinant Ad2 fiber protein was produced in insect cells using
baculovirus and purified by anion-exchange chromatography as previously
described (16). Recombinant Ad19p and Ad37 fiber proteins
containing an N-terminal polyhistidine sequence were produced in
bacteria by using the pET expression system (Novagen). The highly
similar Ad19p and Ad37 fiber DNAs (GenBank accession no. X94485 and
X94484, respectively) were PCR amplified from viral genomic DNA by
using 5' and 3' primers with the sequences CAATCTAGATCAAACAGGCTCCGGGTGGAA and
GCAACTCGAGTCATTCTTGGGCAATATAGG, respectively
(the underlined sequences correspond to XbaI [5' primer] and XhoI [3' primer] endonuclease
restriction sites). PCRs were performed at 94°C (denaturation),
55°C (annealing), and 72°C (extension; 30 cycles), using PCR
polymerase (Qiagen). The amplified DNA fragments were digested with
XbaI and XhoI and then subcloned into the
bacterial expression vector pEM1 (NheI/XhoI cloning sites). Following transformation of Escherichia coli
BL21(DE3), individual colonies were selected for fiber expression by
induction with 1 mM isopropyl-
-D-thiogalactopyranoside
for 1 h at 37°C. Colonies displaying high fiber expression as
assessed by sodium dodecyl sulfate (SDS)-polyacrylamide gel
electrophoresis analysis were then used for large-scale fiber
production. The recombinant fiber proteins were isolated from bacterial
lysates by using Ni+ chelating columns as recommended by
the manufacturer (Qiagen).
To construct single-site mutations in the wild-type Ad37 fiber,
additional PCRs were performed as follows. Using pEM1/Ad37
DNA as a
template, we carried out two separate PCRs: one with
the wild-type 3'
primer (see above) and a primer for the mutant
sequence
5'-TTTTTATTT
CTGGATTTGTCTT (the mutated sequence
is underlined);
and a second reaction with the 5' wild-type primer
and a mutant
primer (ACAAATCCA
GAAATAAAAAGTT-3').
An equimolar amount of each
of the gel-purified PCR fragments was
then mixed and subjected
to a second round of PCR amplification using
the 5' and 3' wild-type
fiber primers to generate the entire fiber
DNA sequence containing
the mutations. The PCR products were then
digested with
XhoI/
XbaI
and cloned into pEM1 DNA
as described above. A mutant Ad19p fiber
expression plasmid was
similarly prepared with the primers
ACAAATCCA
AAAATAAAAAGTT-3'
and
TTTTTATTT
TTGGATTTGTCTT-5' and with pEM1/Ad19p
DNA as a template.
The DNA sequence of each of the fiber construct was
subjected
to automated sequencer analysis and confirmed to be
correct.
Purified wild-type and mutant fiber proteins were analyzed on 8%
polyacrylamide gels under denaturing (2% SDS, boiled) or
native (no
SDS, nonboiled)
conditions.
Ad fiber and virus binding assays.
For cell binding
experiments, purified recombinant fiber proteins or viral particles
were labeled with 125I by using Iodogen (Pierce). Briefly,
500-µg aliquots of virus or recombinant fiber proteins were incubated
for 20 min at 22°C in an Iodogen-coated tube containing 1 mCi of
Na125I. Iodinated proteins were separated from free
125I by passage through a PD10 column (Pharmacia).
Generally, fiber proteins were labeled to a specific activity of 1 × 107 to 2 × 107 cpm/µg, while viral
particles were labeled to a specific activity 5 × 106
to 8 × 106 cpm/µg. Binding of radiolabeled virus
particles or of fiber protein was then assayed by incubating
106 Chang C, A549, or 293 cells in suspension with
106 cpm of the labeled virus proteins at 4°C for 2 h. Nonspecific binding was determined by incubating cells and labeled
proteins in the presence of a 100-fold excess of unlabeled virus or
fiber protein. After the cells were washed four times in ice-cold
phosphate-buffered saline, specific binding was calculated by
subtracted the nonspecific binding from the total counts per minute
bound. For competition experiments, Chang C cells were preincubated
with a 100-fold excess of unlabeled recombinant Ad2 or Ad37 fiber
protein for 1 h at 4°C prior to addition of 106 cpm
of 125I-labeled Ad37 virus particles.
Scatchard analysis of Ad37 fiber binding was performed as follows.
After being detached by using 10 mM EDTA, Chang C cells
were washed
several times in serum-free medium to remove residual
EDTA and
resuspended to 2 × 10
7/ml in medium. Cell aliquots of
100 µl were then incubated with
various amounts of
125I-labeled Ad37 fiber in a total volume of 200 µl for
2 h at 4°C
with constant agitation. The cells were then washed
four times
with PBS, and the cell pellets were counted in a gamma
counter.
Nonspecific binding (approximately 10% of the total) was
determined
by incubating the cells in a 100-fold excess of unlabeled
Ad37
fiber protein. The data were then analyzed by Scatchard analyses
using the EBDA-LIGAND PC software program (Biosoft, Ferguson,
Mo.).
Sequence analysis and molecular modeling of Ad fiber
proteins.
Sequences of the fiber knob domains of Ad37 and Ad19p
were aligned with those of Ad5, Ad2, and Ad7 by using the
computer-based software program AMPS (2, 3, 7). The crystal
structure of the Ad5 fiber knob (17) was used a template for
Ad37 and Ad19p modeling. Sequence alignments suggested an insertion and a deletion in the Ad5 template sequence with respect to the Ad37 and
Ad19p target sequences. Therefore, residue changes, insertions, and
deletions in Ad39 and Ad19p, according to the sequence alignment, were
modeled onto the Ad5 structure by using the graphics program O
(7).
 |
RESULTS |
Comparison of Ad2 and Ad37 interactions with conjunctival and
epithelial cells.
To better understand the molecular basis of Ad
host cell tropism, we evaluated the binding of
125I-labeled Ad37 to human epithelial or conjunctival
cells. As it is not practical to examine virus interactions with
primary human conjunctival cells due to the relatively low abundance of
these cells in human tissue and their limited proliferative capacity, we used the immortalized Chang C human conjunctival cell line. Ad37
bound at 30-fold higher levels to Chang C conjunctival cells than to
A549 lung epithelial cells (Fig. 1A).
Ad2, a serotype belonging to subgroup C, showed similar levels of
binding to both A549 and Chang C cells. Conjunctival cells were also
more susceptible to Ad37 infection than A549 or 293 human embryonic
kidney cells (Fig. 1B). These studies indicated that Ad37, a virus
associated with EKC, displays preferential binding to and infection of
human conjunctival cells.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison of Ad37 and Ad2 interactions with different
cell types. (A) Specific binding of 125I-labeled Ad37 and
Ad2 to A549 or Chang C cells. Nonspecific binding, which was subtracted
from the total counts per minute bound, was determined by incubation in
the presence of a 100-fold excess of unlabeled virus particles. (B)
Susceptibility of A549, 293, and Chang C cells to Ad37 infection,
determined by plaque assay.
|
|
Role of the Ad37 fiber protein in virus attachment.
Previous
studies (15) demonstrated that the Ad2 fiber protein
mediates high-affinity interaction of the virus with host cells whereas
cell integrins promote the subsequent step of
internalization/penetration. To determine whether the Ad37 fiber
protein was also responsible for attachment of Ad37 to cells, we
examined the binding of 125I-labeled Ad37 to conjunctival
cells in the presence or absence of soluble recombinant fiber proteins
derived from different Ad serotypes. The specific binding of Ad37 to
conjunctival cells was competed by soluble recombinant Ad37 fiber but
not by the fiber protein of Ad2, a subgroup C virus (Fig.
2A). In parallel studies, soluble Ad2
fiber was capable of blocking attachment of Ad2 virions to cells but
did not alter Ad37 virus attachment. These studies indicate that the
Ad37 fiber protein is responsible for virus attachment and that the
receptor for Ad37 is distinct from that of Ad2. In further studies, we
examined by Scatchard analysis binding of the Ad37 fiber protein to its
cellular receptor. The Ad37 fiber saturation binding data revealed that
the Ad37 fiber protein exhibits high affinity for conjunctival cells
(KKd = 3.5 nM) and that there are 2 × 104 fiber binding sites per cell (Fig. 2B).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Quantitative binding analysis of Ad37 interaction with
conjunctival cells. (A) Binding of 125I-labeled Ad37 or Ad2
virions to Chang C cells assayed in the presence or absence (control)
of a 100-fold excess of unlabeled Ad37 or Ad2 fiber proteins; (B)
Scatchard analysis of recombinant Ad37 fiber binding, performed as
described in Materials and Methods. The number of receptor binding
sites for Ad37 fiber protein was calculated by dividing the value
extrapolated on the x axis (78.5 fmol, equivalent to
4.7 × 1010 molecules of fiber), based on a molecular
mass of 132 kDa for the trimeric fiber protein), by the number of cells
(2 × 106). B, bound; F, free.
|
|
Different group D Ads exhibit distinct binding and infection
properties.
As other subgroup D Ads are also associated with
ocular infections, we examined the interaction of one of them Ad19p,
with conjunctival cells. Somewhat surprisingly, we observed only low levels of Ad19p binding to conjunctival cells compared to Ad37 (Fig.
3A). The low level of Ad19p binding to
these cells also correlated with a substantial reduction in infectivity
compared to Ad37 (Fig. 3B). These findings indicated that Ad37 exhibits a selective tropism for Chang C conjunctival cells and raised the
possibility that differences in sequences of the fiber proteins of Ad37
and Ad19p could account for this.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Relative binding efficiency and infection of Chang C
conjunctival cells by different Ad serotypes. (A) Binding of
radiolabeled Ad2, Ad19p, and Ad37 to Chang C cells, measured as
described in Materials and Methods; (B) infection of Chang C cells with
various amounts of Ad19p and Ad37 virus particles, assayed by plaque
formation.
|
|
As an initial assessment of the role of individual amino acid residues
in fiber binding, we performed molecular modeling of
the Ad37 and Ad19p
fiber domains based on the crystal structure
of the Ad5 fiber
(
17). The sequences of the Ad37 and Ad5 fiber
domains are
similar (53% identity overall). There are only two
amino acid residue
differences in the fiber distal domain (knob)
(1): at position 240, where Ad37 fiber contains lysine while Ad19p
has glutamic acid (Fig.
4A); and at position 340, where Ad37
contains
asparagine while Ad19p contains aspartic acid. Modeling of the
Ad37 fiber knob required an insertion of four residues between
amino acids 451 and 452 of the CD loop, while a deletion of six
residues was carried out on the HI loop between residues 539 and
546 in
the template of the Ad5 fiber crystal structure (Fig.
4B).
The final
model suggested that the two amino acid changes in the
fiber knob are
located at the apex of the exposed CD loop (K240E)
or within the
individual folding domains of the knob monomers
(N340D). The
three-dimensional model also indicates that residue
K240E is
more solvent exposed than residue N340D. These studies
suggested that
K240 rather than N340 could play the major role
in receptor recognition
on conjunctival cells.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
Sequences and modeling of the Ad37 and Ad19p fiber knob
domains. (A) Amino acid sequence of the Ad19p fiber knob domain
(5), with the different residues (K240 and N340) present in
Ad37 indicated in bold. (B) Ribbon diagram of the modeled Ad19p fiber
knob domain. Shown are an insertion of four residues in the CD loop
between residues 451 and 452 (purple tube) and a deletion of six
residues on the HI loop, between residues 539 and 546 (black sphere).
The two residues that are different between Ad37 and Ad19p are K240E
and N340D, shown in yellow-green and magenta space-filling models,
respectively. The black arrow represents the trimeric fiber axis.
Secondary structural elements are labeled according to the Ad5 fiber
structure (12). (C) Ribbon representation of the trimeric
knob of Ad37 viewing down the fiber axis. Each fiber domain is
indicated with a different color. (D) Side view of the trimeric knob.
The fiber axis is represented by the dark arrow. The side chain of
K240E is highly solvent accessible (60% exposed) compared to that of
N340D, which is only 20% exposed.
|
|
Identity of the amino acid residue that regulates Ad37 fiber
binding.
To investigate whether the K240E sequence in the Ad fiber
knob played a role in binding to conjunctival cells, we generated recombinant forms of wild-type and site-specific mutants of the Ad37 (K
to E) and Ad19p (E to K) fiber proteins in bacteria (Fig. 5A). The wild-type and mutant fiber
proteins were expressed in their native trimeric form (132 kDa)
as assessed by electrophoresis on a non-SDS (native) polyacrylamide
gel (Fig. 5B). The purified proteins were assayed for the
ability to bind to conjunctival cells. Recombinant wild-type Ad37 but
not the wild-type Ad19p fiber exhibited significant binding to
conjunctival cells (Fig. 5C). A single amino acid substitution in the
Ad37 fiber protein (K240 to E) abrogated binding. In
contrast, the reverse substitution in the Ad19p fiber (E240
to K) restored binding to conjunctival cells (Fig. 5C). The E-to-K mutant Ad19p fiber was also capable of competing the binding of 125I-labeled Ad37 to cells (data not shown). In parallel
studies, substitution of the amino acids at position 340 in the two
different fiber proteins did not affect binding (data not shown).
Together, these studies indicate that K240 plays a major role in
conferring virus binding of Ad37 to conjunctival cells.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 5.
Structures and binding properties of Ad37 and Ad19p
fiber proteins containing a single amino acid (aa) substitution in the
knob domain. (A) Schematic representation of the recombinant Ad37 and
Ad19p wild-type (WT) and mutant (MUT) proteins; (B) Analysis of
recombinant fiber proteins by electrophoresis on polyacrylamide gels
under native (no SDS, nonboiled) or denaturing (2% SDS, boiled)
conditions; (C) binding of wild-type or mutant 125I-labeled
fiber proteins to Chang C cells, analyzed as described in Materials and
Methods.
|
|
 |
DISCUSSION |
We undertook this study to gain further insight into the molecular
basis by which human Ad recognizes cellular receptors. Previous studies
demonstrated that a number of different Ad serotypes, representing
distinct subgroups, adhere to cells via interaction with a 46-kDa
protein (CAR). CAR is a member of the immunoglobulin superfamily whose
normal cell function is unknown. The fact that not all Ad serotypes,
including several members of subgroup B, do not use CAR for binding
(11) indicates that other, as yet unidentified cell
receptors play a role in infection by several other Ads. To gain
insight into the identity of some of these receptors, we examined host
cell interactions of several subgroup D viruses associated with EKC in
the anticipation that they might display selective tropism for certain
ocular cell types. Interestingly Ad37 but not Ad19p showed selective
binding and infection of Chang C conjunctival cells, and this was shown
to be mediated by the fiber protein (Fig. 1 and 3). As is true for
multiple Ad serotypes (9), Ad37 also interacts with
v
integrins, the receptors used for internalization and penetration
(8).
Since there are only two amino acid differences in the fiber distal
domain between these highly related Ad serotypes (1), and
one of these residues, K240E, is predicted to lie at the apex of the
exposed CD loop on the fiber knob (Fig. 4), we examined the role of the
lysine246 residue in fiber binding. Consistent with the
model predictions, substitution of the lysine to glutamic acid at
position 240 abrogated Ad37 fiber binding whereas the reverse
substitution in Ad19p conferred the ability of this protein to
bind human conjunctival cells (Fig. 5C). These studies confirm that a
single amino residue in an exposed loop of the fiber knob promote virus
interaction with its cellular receptor. It is likely that other amino
acid sequences in the Ad37 fiber knob also contribute to virus
attachment; however, it appears that K240 plays a pivotal role in this event.
The results of this study indicate that a specific cell receptor may
facilitate Ad37 attachment to conjunctival cells. Our preliminary
studies indicate that the cell receptor is a protein, since treatment
of cells with several different proteases abrogates Ad37 binding.
Interestingly, other subgroup D viruses such as Ad8 may use the same
receptor since Ad8 partially competes Ad37 binding to conjunctival
cells (data not shown). Further characterization of this receptor
should provide further insights into the earliest events in Ad
infection of cells and may allow the development of therapeutic
approaches to restrict ocular infections by subgroup D Ads.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grants HL54352 and EY11431.
We express our appreciation to Catalina Hope and Joan Gausepohl for
preparation of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Immunology, IMM19, The Scripps Research Institute, 10550 N. Torrey
Pines Rd., La Jolla, CA 92037. Phone: (619) 784-8072. Fax: (619)
784-8472. E-mail: gnemerow{at}scripps.edu.
Manuscript no. 11946-IMM of The Scripps Research Institute.
 |
REFERENCES |
| 1.
|
Arnberg, N.,
Y.-F. Mei, and G. Wadell.
1997.
Fiber genes of adenoviruses with tropism for the eye and the genital tract.
Virology
227:239-244[Medline].
|
| 2.
|
Barton, G. J.
1990.
Protein multiple sequence alignment and flexible pattern.
Methods Enzymol.
183:403-428[Medline].
|
| 3.
|
Barton, G. J., and M. J. Sternberg.
1987.
A strategy for the rapid multiple alignment of protein sequences.
J. Mol. Biol.
198:327-337[Medline].
|
| 4.
|
Bergelson, J. M.,
J. A. Cunningham,
G. Droguett,
E. A. Kurt-Jones,
A. Krithivas,
J. S. Hong,
M. S. Horwitz,
R. L. Crowell, and R. W. Finberg.
1997.
Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5.
Science
275:1320-1323[Abstract/Free Full Text].
|
| 5.
|
Curtis, S.,
G. W. G. Wilkinson, and D. Westmoreland.
1998.
An outbreak of epidemic keratoconjunctivitis caused by adenovirus type 37.
J. Med. Microbiol.
47:91-94[Abstract/Free Full Text].
|
| 6.
|
Everitt, E.,
S. A. Meador, and A. S. Levine.
1977.
Synthesis and processing of the precursor to the major core protein of adenovirus type 2.
J. Virol.
21:199-214[Abstract/Free Full Text].
|
| 7.
|
Jones, T. A.,
J. Y. Zou,
S. W. Cowan, and M. Kjeldgaard.
1991.
Improved methods for binding protein models in electron density maps and the location of errors in these models.
Acta Crystallogr.
47:110-119.
|
| 8.
|
Mathias, P.,
M. Galleno, and G. R. Nemerow.
1998.
Interactions of soluble recombinant integrin av 5 with human adenoviruses.
J. Virol.
72:8669-8675[Abstract/Free Full Text].
|
| 9.
|
Mathias, P.,
T. J. Wickham,
M. Moore, and G. Nemerow.
1994.
Multiple adenovirus serotypes use v integrins for infection.
J. Virol.
68:6811-6814[Abstract/Free Full Text].
|
| 10.
|
Philipson, L.,
K. Lonberg-Holm, and U. Pettersson.
1968.
Virus-receptor interaction in an adenovirus system.
J. Virol.
2:1064-1075[Abstract/Free Full Text].
|
| 11.
|
Roelvink, P. W.,
A. Lizonova,
J. G. M. Lee,
Y. Li,
J. M. Bergelson,
R. W. Finberg,
D. E. Brough,
I. Kovesdi, and T. J. Wickham.
1998.
The coxsackievirus-adenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from subgroups A, C, E, and F.
J. Virol.
72:7909-7915[Abstract/Free Full Text].
|
| 12.
|
Ruigrok, R. W. H.,
A. Barge,
C. Albiges-Rizo, and S. Dayan.
1990.
Structure of adenovirus fibre. II. Morphology of single fibres.
J. Mol. Biol.
215:589-596[Medline].
|
| 13.
|
Tomko, R. P.,
R. Xu, and L. Philipson.
1997.
HCAR and MAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses.
Proc. Natl. Acad. Sci. USA
94:3352-3356[Abstract/Free Full Text].
|
| 14.
|
Viswalingam, N. D.
1993.
Adenovirus keratoconjunctivitis: an enigma.
Eye
7(Pt. 3 Suppl.):5-7.
|
| 15.
|
Wickham, T. J.,
P. Mathias,
D. A. Cheresh, and G. R. Nemerow.
1993.
Integrins v 3 and v 5 promote adenovirus internalization but not virus attachment.
Cell
73:309-319[Medline].
|
| 16.
|
Wickham, T. J., and G. R. Nemerow.
1993.
Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.
Biotechnol. Prog.
9:25-30[Medline].
|
| 17.
|
Xia, D.,
L. J. Henry,
R. D. Gerard, and J. Deisenhofer.
1994.
Crystal structure of the receptor-binding domain of adenovirus type 5 fiber protein at 1.7 Å resolution.
Structure
2:1259-1270[Medline].
|
Journal of Virology, April 1999, p. 2798-2802, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Mathis, J. M., Stewart, P. L., Zhu, Z. B., Curiel, D. T.
(2006). Advanced Generation Adenoviral Virotherapy Agents Embody Enhanced Potency Based upon CAR-Independent Tropism.. Clin. Cancer Res.
12: 2651-2656
[Full Text]
-
Gustafsson, D. J., Segerman, A., Lindman, K., Mei, Y.-F., Wadell, G.
(2006). The Arg279Glu Substitution in the Adenovirus Type 11p (Ad11p) Fiber Knob Abolishes EDTA-Resistant Binding to A549 and CHO-CD46 Cells, Converting the Phenotype to That of Ad7p. J. Virol.
80: 1897-1905
[Abstract]
[Full Text]
-
Knaan-Shanzer, S., van de Watering, M. J.M., van der Velde, I., Goncalves, M. A.F.V., Valerio, D., de Vries, A. A.F.
(2005). Endowing Human Adenovirus Serotype 5 Vectors with Fiber Domains of Species B Greatly Enhances Gene Transfer into Human Mesenchymal Stem Cells. Stem Cells
23: 1598-1607
[Abstract]
[Full Text]
-
Burmeister, W. P., Guilligay, D., Cusack, S., Wadell, G., Arnberg, N.
(2004). Crystal Structure of Species D Adenovirus Fiber Knobs and Their Sialic Acid Binding Sites. J. Virol.
78: 7727-7736
[Abstract]
[Full Text]
-
Wu, E., Trauger, S. A., Pache, L., Mullen, T.-M., Von Seggern, D. J., Siuzdak, G., Nemerow, G. R.
(2004). Membrane Cofactor Protein Is a Receptor for Adenoviruses Associated with Epidemic Keratoconjunctivitis. J. Virol.
78: 3897-3905
[Abstract]
[Full Text]
-
Wu, E., Pache, L., Von Seggern, D. J., Mullen, T.-M., Mikyas, Y., Stewart, P. L., Nemerow, G. R.
(2003). Flexibility of the Adenovirus Fiber Is Required for Efficient Receptor Interaction. J. Virol.
77: 7225-7235
[Abstract]
[Full Text]
-
Natarajan, K., Rajala, M. S., Chodosh, J.
(2003). Corneal IL-8 Expression Following Adenovirus Infection Is Mediated by c-Src Activation in Human Corneal Fibroblasts. J. Immunol.
170: 6234-6243
[Abstract]
[Full Text]
-
Arnberg, N., Pring-Akerblom, P., Wadell, G.
(2002). Adenovirus Type 37 Uses Sialic Acid as a Cellular Receptor on Chang C Cells. J. Virol.
76: 8834-8841
[Abstract]
[Full Text]
-
Chiu, C. Y., Wu, E., Brown, S. L., Von Seggern, D. J., Nemerow, G. R., Stewart, P. L.
(2001). Structural Analysis of a Fiber-Pseudotyped Adenovirus with Ocular Tropism Suggests Differential Modes of Cell Receptor Interactions. J. Virol.
75: 5375-5380
[Abstract]
[Full Text]
-
Arnberg, N., Kidd, A. H., Edlund, K., Olfat, F., Wadell, G.
(2000). Initial Interactions of Subgenus D Adenoviruses with A549 Cellular Receptors: Sialic Acid versus alpha v Integrins. J. Virol.
74: 7691-7693
[Abstract]
[Full Text]