Previous Article | Next Article 
Journal of Virology, April 1999, p. 2745-2751, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Drastic Fitness Loss in Human Immunodeficiency
Virus Type 1 upon Serial Bottleneck Events
Eloisa
Yuste,1
Sonsoles
Sánchez-Palomino,1,
Concha
Casado,1
Esteban
Domingo,2 and
Cecilio
López-Galíndez1,*
Centro Nacional de Biología
Fundamental, Instituto de Salud Carlos III, Majadahonda, 28220 Madrid,1 and Centro de Biología
Molecular "Severo Ochoa," CSIC-UAM, Universidad Autónoma,
Cantoblanco, 28049 Madrid,2 Spain
Received 19 June 1998/Accepted 7 December 1998
 |
ABSTRACT |
Muller's ratchet predicts fitness losses in small populations of
asexual organisms because of the irreversible accumulation of
deleterious mutations and genetic drift. This effect should be enhanced
if population bottlenecks intervene and fixation of mutations is not
compensated by recombination. To study whether Muller's ratchet
could operate in a retrovirus, 10 biological clones were derived from a
human immunodeficiency virus type 1 (HIV-1) field isolate by MT-4
plaque assay. Each clone was subjected to 15 plaque-to-plaque passages.
Surprisingly, genetic deterioration of viral clones was very drastic,
and only 4 of the 10 initial clones were able to produce viable progeny
after the serial plaque transfers. Two of the initial clones stopped
forming plaques at passage 7, two others stopped at passage 13, and
only four of the remaining six clones yielded infectious virus. Of
these four, three displayed important fitness losses. Thus, despite
virions carrying two copies of genomic RNA and the system
displaying frequent recombination, HIV-1 manifested a drastic fitness
loss as a result of an accentuation of Muller's ratchet effect.
| |
INTRODUCTION |
Genetic variation provides the
background on which evolution acts in living organisms. RNA viruses
display extreme genetic variation (13, 15, 25, 47) which,
although it is an energetically inefficient process, offers clear
adaptive advantages. Variation in RNA viruses is the result of an
error-prone replication machinery and of the lack of repair and
proofreading mechanisms (6, 12-14, 47). Variant genomes are
continuously arising in any replicating viral population, forming a
complex swarm of related genomes termed quasispecies (18)
which are subjected to positive and negative selective forces, as well
as to other nonselective mechanisms such as genetic drift or random
sampling events like genetic bottlenecks.
Retroviruses display unique features in their replication cycles that
have implications for genome variation. One is the need for reverse
retrotranscription of the genomic viral RNA, an error-prone process (3). Another is the presence of two copies of the
genomic RNA per virus particle, in what has been termed
pseudodiploidy (27). The process of retrotranscription, with
the requirement of enzyme strand transfers, provides the mechanistic
basis for a high recombination potential. However, an important source
of genetic variation in human immunodeficiency virus type 1 (HIV-1) results from point mutations, which have been identified in the emergence of mutants resistant to retroviral inhibitors (30, 34,
43), or in the nonsyncytial-to-syncytial switch, which occurs in
the course of infection (20, 29) and is associated with
changes in coreceptor usage (42).
RNA viruses are increasingly recognized as useful models to test
concepts and theoretical predictions of molecular evolution. Some
advantages of RNA viruses as model systems include their short
duplication times, small genomes, and high rates of genetic variation
and the possibility of using large population sizes. Among the
principles of population biology which have been addressed with RNA
viruses are the Red Queen hypothesis and the competitive exclusion
principle, which were tested by using vesicular stomatitis virus (VSV)
(5, 12). The first principle describes fitness gains in two
variants when they are cocultured in the same environment, although one
overgrows the other. The more general competitive exclusion principle
states that when two organisms coexist in the same environment with
limited resources, one will eventually overgrow the other (reviewed in
reference 12). Another prediction of classical
population genetics that found ample confirmation with RNA viruses is
the operation of Muller's ratchet (33). In its initial
formulation it recognized the tendency of populations of asexual
organisms to lose fitness due to the accumulation of deleterious
mutations which could not be compensated by sex or recombination
(33). The Muller's ratchet effect was experimentally documented for the first time with bacteriophage 
6 by using an experimental design that involved serial plaque-to-plaque transfers (4) and then with VSV (17), foot-and-mouth
disease virus (FMDV) (19), and bacteria
(1). The plaque transfers, which represent severe
bottleneck events, produced in all of these cases decreases in
average fitness, some of which were very intense.
HIV-1 is currently one of the most thoroughly studied human pathogens.
Although many in vivo studies have been performed on HIV-1 evolution
(reviewed in references 7 and
44), studies on the in vitro evolution of HIV-1 in
cell culture are scarce. HIV-1 is an attractive model to analyze the
possible operation of Muller's ratchet for theoretical and
practical reasons. The HIV-1 virion contains two copies of the genome,
and the virus displays high recombination rates (9, 11, 26, 28,
40) which, from a theoretical point of view, could potentially
counteract the debilitating effects of Muller's ratchet on virus
fitness (4, 6, 17, 32, 33, 35, 36). Also, HIV-1 infection has a diverse natural history, with different routes of infection (by
sexual transmission, by vertical transmission, or by infected blood or
blood products), and these routes of infection may often involve
different infecting doses (small in sexual transmission, larger in drug
user transmission, and probably even larger in transfusion-associated
cases) resulting, in some cases, in bottlenecks. In addition, infected
individuals show different patterns of disease progression. In this
background, it is interesting to study how genetic bottlenecks may
affect fitness values of HIV-1, a problem that has not been approached
experimentally with retroviruses.
In the present study, fitness evolution was analyzed by using 10 biological clones derived from an HIV-1 isolate. Each HIV-1 clone
was subjected to 15 serial plaque-to-plaque transfers, taking advantage
of a plaque assay in MT-4 cells (22). The results document a
high fitness heterogeneity among the initial clones and strong fitness
losses in the viruses subjected to repeated bottleneck passages, to the
point that 6 of the 10 initial clones did not survive through 15 bottleneck transfers.
| |
MATERIALS AND METHODS |
Cells, viruses, and biological cloning.
The HIV-1 parental
population, isolate s61 (41), was obtained from a 4-year-old
child and was isolated by standard coculture procedures. Ten biological
clones were obtained from this viral population by using an MT-4 plaque
assay as previously described (22, 41). In this method, the
plaques produced do not result in lysis of the monolayer; rather, there
is a formation of plaques (visible by the naked eye or by microscopy)
due to the accumulation of cells that support viral replication
following infection of a single cell (22). Plaques appear 7 to 10 days after infection. Viruses from randomly chosen, well-isolated
plaques are the origin of viral populations designated A1 to K1. In
subsequent plaque transfers, viral clones are designated with the same
letter followed by a number that indicates the total number of plaque
isolation passages (for example, B6 is clone B1 after five serial
plaque-to-plaque transfers). Virus from each plaque was resuspended in
300 µl of culture medium, diluted 1:10, and used to infect MT-4
monolayers. The number of plaques was quantified in each passage for
each virus. The plaque assay on MT-4 cells was used for titration of all viral stocks used in the study. Titers were expressed as PFU per
milliliter. When a viral population did not yield plaques on MT-4
cells, its infectivity was also tested in cultures of MT-2 cells
(22) or in peripheral blood mononuclear cells.
HTA.
DNA extraction was carried out by using the Instagene
purification matrix (Bio-Rad) according to the manufacturer's
instructions. The heteroduplex tracking assay (HTA) (10) was
carried out with a cDNA copy of a 650-bp fragment
corresponding to the V1-V2 region of the env gene. To
amplify this DNA, a nested PCR was carried out with primers 91ECU
(5'CTTAGGCATCTCCTATGGC3'; positions 5535 to 5555 [numbering
is as in reference 39]) and 92ECD
(5'GGAGCAGCAGGAAGCAC3'; complementary to positions 7370 to
7388) and nested primers 99ECU (5'AGAGCAGAAGACAGTGGC3';
positions 5783 to 5801) and 52EV1D
(5'TAATGTATGGGAATTGGCTCAA3'; complementary to positions 6429 to 6451). Amplifications were carried out for 35 cycles of 94°C for 1 min, 55°C for 55 s, and 72°C for 1 min, with an extension
cycle of 10 min at 72°C.
In order to determine the proportion of each molecular species during
competition passages, amplified cDNA of clone J1 was labeled with
[
-32P]dCTP (3,000 Ci/mmol) in a PCR amplification.
About 10,000 cpm of this radioactive PCR probe was mixed with 50 to 100 ng of unlabeled second-round PCR product from the competing virus in
annealing buffer (0.1 M NaCl, 10 mM Tris HCl [pH 7.8], and 2 mM
EDTA). The DNA mixtures were denatured at 94°C for 2 min and then
quickly cooled (10). Heteroduplexes were resolved in
denaturing 8% polyacrylamide-15% urea gels in TBE (88 mM
Tris-borate, 89 mM boric acid, and 2 mM EDTA). Autoradiograms were
obtained by exposing gels on a Fuji 2000 instrument for 2 h. The
quantification of the ratio of the J1 cDNA (homoduplex) to the cDNA of
the competing virus (heteroduplex) was determined by densitometry with
the help of the PCBAS program.
Detection of mixed viral populations by HTA.
To test the
reliability of the HTA for the detection and quantification of viral
populations, cultures with different proportions of clones A1 and J1
were grown and proviral DNA was subjected to HTA analysis (Fig.
1A). The assay was able to detect the
presence of a homoduplex amounting to about 10% of the total DNA and
of a heteroduplex amounting to about 30% (Fig. 1A). DNA from each of
the biological clones analyzed in this study displayed a heteroduplex (A1 to I1) with a distinct mobility when J1 was used as a probe (Fig.
1B). Each clone showed a distinct gel mobility reflecting its specific
nucleotide sequence. For clone H1, two DNAs with different mobilities
were detected (Fig. 1B), but the origin of this heterogeneity was not
investigated. Each clone maintained its characteristic HTA pattern
during five passages in cell culture under the same conditions used for
the competition assays (Fig. 1C). Also, independent experiments with
the same DNA preparations produced identical HTA patterns (data not
shown).
View larger version (55K):
[in this window]
[in a new window]
|
FIG. 1.
HTA as a tool for quantification of mixed viral
populations. (A) Quantification of two viruses present in different
proportions. Mixed infections with clones J1 and A1 were carried out
with decreasing (from 100 to 0%) and increasing (from 0 to 100%)
proportions of the two viruses. Proviral DNA obtained from the
infections was subjected to HTA with, as a labeled probe, cDNA of the
V1-V2 region of the env gene, as described in Materials and
Methods. (B) The same HTA analysis with DNAs of all initial clones, A1
to J1, using cDNA of clone J1 as a probe. All clones formed
heteroduplexes (HT), whereas J1 formed a homoduplex (HO). The H1
population was probably a mixture of two clones. (C) Stability of the
HTA pattern of each initial clone after five passages in cell culture.
HTA patterns of amplified proviral DNAs from the first (lanes 1) and
fifth (lanes 5) passages are shown.
|
|
Fitness assay.
Fitness determination was performed by growth
competition experiments as previously described (24).
Briefly, the assay consists of the coinfection of cultures with known
amounts of the virus to be tested together with a reference clone.
These cocultures are performed at different initial proportions, and
the cultures are allowed to compete for a number of infections, after
which the ratio of the two viruses is quantified by a phenotypic assay (4, 17, 19) or by a genotypic assay, as was done in this work (Fig. 1B). The proportion of the competing variant with
respect to the reference strain (Rn) is divided by its proportion in
the initial mixture (Ro), and this value (Rn/Ro) is plotted versus the
competition passage to derive the fitness vector (24).
In all cases, three competition passages were carried out by infecting MT-4 cells with mixtures of the clonal population to be tested and J1
at initial ratios of 1:9, 1:1, and 9:1. For each competition passage,
5 × 104 MT-4 cells were infected with 5 × 10
3 PFU of the mixture of viruses (multiplicity of
infection of 0.1 PFU per cell). Virus was recovered from the culture
supernatant when a cytopathic effect was evident (about 5 to 7 days
postinfection). Fresh MT-4 cells were then infected with 50 µl of
this supernatant diluted 1:10. Similar results were obtained for
competitions carried out with the different initial ratios. Unless
stated otherwise, the results presented are those obtained with the 1:1
initial ratio. The proportion of each clone in the competition passages was determined by using the HTA and divided by the proportion of the
two clones in the starting competition mixtures. Ratios were used to
calculate the fitness vectors as previously described (24).
The slope of the fitness vector represents the fitness value of the
corresponding viral clone; by this procedure, the fitness value of the
reference clone J1 is zero.
| |
RESULTS |
Serial plaque-to-plaque transfers of biological HIV-1 clones.
To study whether Muller's ratchet can operate in HIV-1, viruses
from 10 biological clones of isolate s61, termed A1, B1, D1, E1, F1,
G1, H1, I1, J1, and K1, were obtained as described in Materials and
Methods. Each viral clone was subjected to repeated plaque-to-plaque
transfers in MT-4 cells (Fig. 2).
Unexpectedly, 15 serial plaque-to-plaque passages could be completed
for only six clones: B1, D1, F1, I1, J1, and K1. Plaque formation was
not observed with clones A1 and G1 at passage 8 and with clones E1 and
H1 at passage 14. Repeated plating of these viruses failed to produce
visible plaques. In the case of clone H1, very small plaques were
observed at transfer 13, following 12 to 14 days of plaque development,
which represents a 7-day delay relative to normal plaque
formation. Further plating of this population did not yield any
plaques. This loss was preceded by a decreasing number of plaques
in previous transfers. There were significant differences in the
virus titers obtained among the different clones and within a clone
during the plaque transfers (data not shown). Although titers varied in
a rather irregular fashion, there was a trend towards decreasing
titers with increasing plaque transfers. Visible plaques were
obtained from populations D15, F15, K15, and I15, but no infectious
virus was recovered from clones B15 and J15. These viruses were unable
to grow not only in MT-4 cells (Fig. 2) but also in other cell
lines, such as MT-2 or peripheral blood mononuclear cells
(data not shown). These results highlight the frequent loss of
infectivity of HIV-1 clones upon serial bottleneck passages.
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic representation of the derivation of HIV-1
clones and of serial plaque-to-plaque transfers. Procedures for
isolation of virus from individual plaques of the HIV-1 isolate s61 on
MT-4 cells are detailed in Materials and Methods. Viruses from randomly
chosen individual plaques were diluted and plated again (circles and
arrows). Filled boxes indicate the viral populations from which
infectious virus could not be rescued upon subsequent plating or
infection in liquid medium in different cell lines (as described in
Materials and Methods). The 15 intended serial plaque transfers could
be completed only for clones B1, D1, F1, I1, J1, and K1, although
infectious virus could be rescued only from populations D15, F15, I15,
and K15.
|
|
Fitness decrease upon plaque-to-plaque transfers of HIV-1.
The
determination of relative fitness values was carried out by growth
competition experiments with mixed infections of each viral population
to be tested and clone J1, which was used as a reference
(24). As an example, results of an experiment corresponding to the fitness determination for clone D1 are shown in Fig.
3. The HTA patterns obtained for five
serial competition passages between D1 and J1, mixed at the three
initial proportions of 1:9, 1:1, and 9:1 are shown (Fig. 3A), as is the
fitness vector derived from the competition series with the 1:1
initial proportion (Fig. 3B). The fitness vectors and
fitness values for all of the starting populations A1 to K1 are
displayed in Fig. 4A and B, respectively. The fitness values ranged from 0.38 (clone A1) to 58 (clone I1) relative to that for J1.
View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3.
Fitness vector determination for HIV-1 clone D1. The
fitness value was obtained from competition passages between clones D1
and J1 as described in Materials and Methods. A total of five
competition passages were carried out with, as starting viruses,
mixtures of D1 and J1 at ratios of 1:9, 1:1, and 9:1. (A) Result of the
HTA assay. HT (heteroduplex) represents the proportion of D1 virus; HO
(homoduplex) represents the proportion of J1. (B) From the 1:1 initial
mixture, the proportions of D1 and J1 DNAs (measured and quantified by
densitometry of the autoradiogram) (Rn) were obtained for the five
competition passages. This proportion was compared to the ratio of the
two viruses in the initial mixtures (Ro). The value in each passage
(solid squares) was used to derive the fitness vector for D1
(24). Details of all procedures involved are given in
Materials and Methods.
|
|
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 4.
Fitness vectors and corresponding fitness values of the
initial clones. (A) Fitness vectors of all of the initial clones,
determined as indicated in Materials and Methods and in the legend to
Fig. 3. In all lineages, the 1:1 competition cultures were used in the
calculation of the vectors, except for clones I1 and H1. In these
viruses the vectors were drawn with 1:9 competition cultures because of
the very high fitness value of clone I1, which completely suppressed
the J1 population, and because of the presence of two populations in
clone H1 (Fig. 1B). Vectors were drawn with data from at least three
competing passages. (B) Slopes of fitness vectors (fitness values) for
the initial HIV-1 clones. Clone J1 was used as a reference, and
consequently its slope is zero.
|
|
Fitness values were obtained for each of the clonal populations that
yielded infectious virus after the 15 serial plaque transfers:
populations D15, F15, I15, and K15 (Fig.
5). Fitness losses were
observed in all
cases except for clone F1, which experienced a
27% fitness gain at
transfer 15 (Table
1). Clone I1 displayed
a 99% fitness loss, suggesting that this clone may also be evolving
towards extinction. Therefore, serial plaque-to-plaque transfers
of
HIV-1 clones led either to loss of virus infectivity or to
strong
fitness decreases in 9 of 10 clones tested.
View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5.
Fitness alterations produced in the viral populations
after 15 serial plaque-to-plaque transfers. (A) HTA patterns obtained
from the competitions at the 1:9, 1:1, and 9:1 proportions with cDNAs
from the initial clone K1 and the final clone K15, using J1 cDNA as a
probe. The arrow points to a new variant genome with a different HTA
mobility arising at passage 5 of the competition series carried out at
a 1:9 ratio of K1 and J1 in competition culture. (B) Comparison of the
vectors in lineages for D1 to D15, F1 to F15, I1 to I15, and K1 to K15.
The continuous lines represent initial fitness vectors, and the dashed
lines represent final fitness vectors. For I1 to I15, a different scale
has been used due to the wider range of values plotted. All of the
vectors corresponding to final populations (transfers 15) are below the
corresponding values for the initial clones, except for clone F1 (see
text). Procedures are described in Materials and Methods, and fitness
values are summarized in Table 1.
|
|
| |
DISCUSSION |
Severe Muller's ratchet effect in HIV-1.
The results
reported here with HIV-1 extend previous observations of the
deleterious effects of repeated population bottlenecks on the fitness
of bacteriophage 6 (4), VSV (17), and FMDV (19) to a retrovirus. Despite important biological
differences among the four viral systems, in all cases decreases in
average fitness have been observed, providing clear support for the
accentuation of Muller's ratchet effect when viral populations are
subjected to repeated bottleneck passages (1, 4, 6, 12, 17, 32,
33). Despite the fact that HIV-1 has two genomic RNA
molecules in each particle and shows high rates of molecular
recombination (9, 11, 28, 40), only 4 of 10 clones
maintained plaque-forming potential over 15 plaque transfers. The
fitness loss for HIV-1 was more severe than the reductions observed
with other RNA viruses when a similar experimental design was used
(Table 2).
To determine the relative fitness in HIV-1 populations, we have applied
a genetic method (HTA) instead of a phenotypic assay
as previously used
for other RNA viruses (
19,
24). This genetic
technique
offers the advantage that it can be used with any virus
in which
genetic differences from a reference virus are detectable.
However, the
use of a genetic method does not impose any selective
pressure
against variants, present or emerging in the quasispecies,
during
competition experiments as is the case with phenotypic
selection
(
4,
17,
19). In the present study, new variants
were
detected in the course of some of the competition passages,
like the
one found in the fifth passage of the competition culture
between K1
and J1 carried out at a proportion of 1:9 (arrow in
Fig.
5A).
Additional variant genomes were also seen in the competitions
between
B1 and J1 and between A1 and J1 carried out at a ratio
of 1:9 between
the two competing viruses. However, a repetition
of these two
competition experiments with the same starting inocula
did not produce
variant heteroduplexes (results not shown). These
observations suggest
that such variants arose as a result of stochastic
genetic variation
events in the course of each competition. Viral
populations showing
these variant genomes were excluded from the
calculation of fitness
values. It could be argued that recombinants
that could arise in the
course of the serial competitive infections
involved in the fitness
assays could modify our measurements of
relative fitness values. This
is highly unlikely, because it implies
that a recombinant between the
reference J1 clone (with the lowest
fitness among the clones studied)
and the clone to be tested (harboring
deleterious mutations) would be
more fit than the parental J1
clone itself. Moreover, values obtained
for homologous recombination
with viral vectors and reporter genes in
retroviruses are from
2 × 10
5 to 2 × 10
4 recombinations/nucleotide/cycle (
26,
45,
51). These rates
indicate that viable recombinant viruses are
very unlikely to
rise in the micromethod applied in the competition
experiments
because of the small viral inoculum (5 × 10
3 PFU), the low number of replication cycles (around
seven cycles
in each passage), and the small population size produced
at the
end of each passage (for example, around 3.5 × 10
4 PFU in first passage and 2.4 × 10
4
PFU in the second
passage).
There are several mechanisms that either alone or in combination
could contribute to greater fitness losses induced by serial
genetic
bottlenecks in HIV-1 than in other RNA viruses previously
examined
(
4,
6,
17,
19,
35,
36) (Table
2). One
possible mechanism
stems from the plating system of HIV-1 on MT-4
cells, which does not
result in the formation of lytic plaques.
Rather, despite some cell
killing, sites of virus production appear
as localized clusters of
virus-producing cells (
22). Also, titers
obtained from
HIV-1 plaques are low, with values around 10
3 to
10
4 total PFU per plaque, compared with titers in the range
of 10
9 to 10
10 PFU per plaque for VSV or
6
and around 10
5 PFU per plaque for FMDV. Therefore, the
number of replication
rounds and the possibility of competition among
components of
HIV-1 quasispecies during plaque development could be
more restricted
for HIV-1 than for other viruses. The lower
chance of local quasispecies
optimization within each plaque
would result in cumulative lower
fitness values after repeated
plaque-to-plaque passages. Another
possibility is that the mutational
input in the case of HIV-1
may be larger than that for nonretroviral
riboviruses. Such a
difference does not seem to be supported by
comparative analyses
of mutation rates and frequencies (
14,
16,
31,
37,
47).
However, a number of environmental modifications
(including biases
in nucleotide substrate concentrations) can affect
the retroviral
mutation rates (
2,
46), and it cannot be
excluded that such
an effect could operate during HIV-1 multiplication
in MT-4 cells.
Yet another explanation could lie in the origin of the
clones
used in this study: they were obtained from a natural HIV-1
isolate
which was passaged only once in MT-4 cells before biological
cloning
and thus had limited adaptation to the cell culture system.
This
possibility seems unlikely, since no difference in Muller's
ratchet
effect was detected when FMDV populations with different
degrees
of adaptation to the BHK-21 cell line, on which this effect was
tested, were compared (
19).
A rapid debilitating effect as a result of a limited number of
bottleneck events could have implications for the evolution
of the
pathogenic potential of HIV-1 in vivo. Although the number
of
infectious particles that are transmitted and initiate viral
multiplication is not known, it cannot be excluded that one or
a
limited number of HIV-1 particles may initiate an infection
(
48,
52). In this case, fitness differences between clones
due to
deleterious mutations may influence the outcome of the
infectious
process. Also, the implementation of hard triple- or
multidrug therapy
produces drastic and sustained reductions in
the sizes of viral
populations, which may contribute to fitness
losses of the surviving
HIV-1 (
21,
23).
Fitness variations among components of the mutant spectra.
Viral quasispecies are important reservoirs of genetically and
phenotypically relevant variants (reviewed in references
15 and 25). Examples are the
preexistence in many natural quasispecies of HIV-1 mutants resistant to
antiretrovial inhibitors (30, 34, 43) and the presence of
phenotypic variants within viral populations (12-15). In
the present analysis, biological clones derived from a field HIV-1
isolate displayed large fitness differences (Fig. 4 and Table 1) with
regard to replication in MT-4 cells. The observed clonal variations in
relative fitness values (Fig. 4 and Table 1) range from no difference
between clones B1 and K1 to 1.04-fold between clones D1 and B1 to
153-fold between clones A1 and I1. However, even small fitness
differences can become quantitatively important with regard to the
dominance of viral subpopulations, given the large number of
replication rounds during the natural infection with HIV-1
(8). Obviously, fitness values determined in MT-4 cells may
not parallel fitness in lymphocytes or other natural host cells of
HIV-1. It seems unlikely, however, that fitness heterogeneity is
restricted to MT-4 cells.
The urgent need for the development of an effective anti-AIDS vaccine
is reinforced by the explosive expansion of the AIDS
epidemic in
developing countries (
38). Although other approaches
are
also possible, current concepts of RNA virus population heterogeneity
and dynamics suggest that an immune response against a large number
of
B-cell and T-cell epitopes can be achieved with attenuated
virus
(
50). The dynamics of viral quasispecies suggest that
a
broad, multivalent immune response may diminish the chances
of
selecting escape mutants (
14). Obviously, safety concerns
must always be considered in the development of live retrovirus
vaccines, and even more so since the detection of in vivo recombination
of attenuated simian immunodeficiency virus strains in rhesus
monkeys
(
49). Experiments to investigate the nature of the genetic
lesions that mediate the severe fitness losses observed in HIV-1
are
now in progress. Knowledge of such genetic alterations may
help in
the design of highly debilitated strains of HIV-1.
| |
ACKNOWLEDGMENTS |
We thank A. del Pozo and G. Gimenez for the photographic work. C. Escarmis is acknowledged for helpful discussions and advice. MT-2 and
MT-4 cells were kindly provided by D. Richman (University of
California, San Diego).
Work at Centro Nacional de Biología Fundamental was supported
by grants from FIS (97-0117 and 98-0054/02), and work at Centro de
Biología Molecular "Severo Ochoa" was supported by grants from DGES (PM97-0060-CO2-01), FIS (98/0054-01), and
Fundación Ramón Areces.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Servicio de
Virología Molecular, Centro Nacional de Biología
Fundamental, Instituto de Salud Carlos III, Majadahonda, 28220 Madrid,
Spain. Phone: 34 91 509 79 03. Fax: 34 91 509 79 18. E-mail:
clopez{at}isciii.es.
Present address: Centro de Investigación Hospital 12 de
Octubre, 28041 Madrid, Spain.
| |
REFERENCES |
| 1.
|
Anderson, D. I., and D. Hughes.
1996.
Muller's ratchet decreases fitness of a DNA-based microbe.
Proc. Natl. Acad. Sci. USA
93:906-907[Abstract/Free Full Text].
|
| 2.
|
Back, N. K. T.,
M. Nijhuis,
W. Keulen,
C. A. B. Boucher,
B. B. Oude,
A. B. P. Essink,
A. van Kullenburg,
A. H. van Gennip, and B. Berkout.
1996.
Reduced replication of 3TC-resistant variants in primary cells due to a processivity defect of reverse transcriptase enzyme.
EMBO J.
15:4040-4049[Medline].
|
| 3.
|
Bebeneck, K., and T. Kunkel.
1993.
The fidelity of retrovial reverse transcriptases, p. 85-162.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 4.
|
Chao, L.
1990.
Fitness of RNA virus decreased by Muller's ratchet.
Nature
348:454-455[Medline].
|
| 5.
|
Clarke, D. K.,
E. A. Duarte,
S. F. Elena,
A. Moya,
E. Domingo, and J. Holland.
1994.
The Red Queen reigns in the kingdom of RNA viruses.
Proc. Natl. Acad. Sci. USA
91:4821-4824[Abstract/Free Full Text].
|
| 6.
|
Clarke, D. K.,
E. A. Duarte,
A. Moya,
S. F. Elena,
E. Domingo, and J. Holland.
1993.
Genetic bottlenecks and population passages cause profound fitness differences in RNA viruses.
Proc. Natl. Acad. Sci. USA
67:222-228.
|
| 7.
|
Coffin, J. M.
1995.
HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy.
Science
267:483-489.
|
| 8.
|
Coffin, J. M.
1996.
Plasma viral load, CD4+ cell counts, and HIV-1 production by cells.
Science
271:670-671[Medline].
|
| 9.
|
Cornelissen, M.,
G. Kampinga,
F. Zorgdrager, and J. Goudsmit.
1996.
Human immunodeficiency virus type 1 subtypes defined by env show high frequency of recombinant gag genes.
J. Virol.
70:6777-6780.
|
| 10.
|
Delwart, E. L.,
E. G. Shpaer,
J. Louwagie,
F. E. McCutchan,
M. Grez,
H. Rübsamen-Walgmann, and J. I. Mullins.
1993.
Genetic relationship determined by a DNA heteroduplex mobility assay: analysis of HIV-1 env genes.
Science
262:1257-1261[Abstract/Free Full Text].
|
| 11.
|
Diaz, R. S.,
E. C. Sabino,
A. Mayer,
J. W. Mosley,
M. P. Busch, and T. T. S. S. Group.
1995.
Dual human immunodeficiency virus type 1 infection and recombination in a dually exposed transfusion recipient.
J. Virol.
69:3273-3281[Abstract].
|
| 12.
|
Domingo, E.,
C. Escarmis,
N. Sevilla,
A. Moya,
S. F. Elena,
J. Quer,
I. S. Novella, and J. J. Holland.
1996.
Basic concepts in RNA virus evolution.
FASEB J.
10:859-863[Abstract].
|
| 13.
|
Domingo, E., and J. J. Holland.
1988.
High error rates, population equilibrium and evolution of RNA replication systems, p. 3-36.
In
E. Domingo, J. J. Holland, and P. Ahlquist (ed.), RNA genetics, vol. III. Variability of RNA genomes. CRC Press, Boca Raton, Fla.
|
| 14.
|
Domingo, E., and J. J. Holland.
1994.
Mutations rates and rapid evolution of RNA viruses, p. 161-184.
In
S. S. Morse (ed.), The evolutionary biology of viruses. Raven Press, New York, N.Y.
|
| 15.
|
Domingo, E.,
E. Martínez-Salas,
F. Sobrino,
J. C. de la Torre,
A. Portela,
J. Ortin,
C. López-Galíndez,
P. Perez-Breña,
N. Villanueva,
R. Nájera,
S. VandePol,
D. Steinhauer,
N. DePolo, and J. J. Holland.
1985.
The quasispecies (extremely heterogenous) nature of viral RNA genome populations: biological relevance a review.
Gene
40:1-8[Medline].
|
| 16.
|
Drake, J.
1993.
Rates of spontaneous mutation among RNA viruses.
Proc. Natl. Acad. Sci. USA
90:4171-4175[Abstract/Free Full Text].
|
| 17.
|
Duarte, E.,
D. Clarke,
A. Moya,
E. Domingo, and J. J. Holland.
1992.
Rapid fitness losses in mammalian RNA virus due to Muller's ratchet.
Proc. Natl. Acad. Sci. USA
89:6015-6019[Abstract/Free Full Text].
|
| 18.
|
Elgen, M.
1971.
Self-organization of matter and the evolution of biological macromolecules.
Naturwissenschaften
58:465-523[Medline].
|
| 19.
|
Escarmís, C.,
M. Dávila,
N. Charpentier,
A. Bracho,
A. Moya, and E. Domingo.
1996.
Genetic lesions associated with Muller's ratchet in an RNA virus.
J. Mol. Biol.
264:255-267[Medline].
|
| 20.
|
Fouchier, R. A. M.,
M. Groenink,
N. A. Kootstra,
M. Tersmette,
H. G. Huisman,
F. Miedema, and H. Schultemaker.
1992.
Phenotype-associated sequence variation in the third variable domain of the human immunodeficiency virus type 1 gp120 molecule.
J. Virol.
66:3183-3187[Abstract/Free Full Text].
|
| 21.
|
Goudsmit, J.,
A. de Ronde,
E. de Roolj, and R. de Boer.
1997.
Broad spectrum of in vivo fitness of human immunodeficiency virus type 1 subpopulations differing at reverse transcriptase codons 41 and 215.
J. Virol.
71:4479-4484[Abstract].
|
| 22.
|
Harada, S.,
Y. Koyanagi, and N. Yamamoto.
1985.
Infection of HTLV-III/LAV in HTLV-I-carrying cells MT-2 and MT-4 and application in a plaque assay.
Science
229:563-566[Abstract/Free Full Text].
|
| 23.
|
Harrigan, P. R.,
S. Bloor, and B. A. Larder.
1998.
Relative replicative fitness of zidovudine-resistant human immunodeficiency virus type 1 isolates in vitro.
J. Virol.
72:3773-3778[Abstract/Free Full Text].
|
| 24.
|
Holland, J. J.,
J. C. de la Torre,
D. K. Clarke, and E. Duarte.
1991.
Quantitation of relative fitness and great adaptability of clonal populations of RNA viruses.
J. Virol.
65:2960[Abstract/Free Full Text].
|
| 25.
|
Holland, J. J.,
J. C. de la Torre, and D. A. Steinhauer.
1992.
RNA virus populations as quasispecies.
Curr. Top. Microbiol. Immunol.
176:1-20[Medline].
|
| 26.
|
Hu, W. S., and H. M. Temin.
1990.
Retroviral recombination and reverse transcription.
Science
250:1227-1233[Abstract/Free Full Text].
|
| 27.
|
Hu, W. S., and H. M. Temin.
1990.
Genetic consequences of packing two RNA genomes in one retroviral particle: pseudodiploidy and high rate of genetic recombination.
Proc. Natl. Acad. Sci. USA
87:1556-1560[Abstract/Free Full Text].
|
| 28.
|
Kampinga, G. A.,
A. Simonon,
P. Van de Perre,
E. Karlta,
P. Msellati, and J. Goudsmit.
1997.
Primary infections with HIV-1 of women and their offspring in Rwanda. Findings of heterogeneity at seroconversion, coinfection, and recombinations of HIV-1 subtypes A and C.
Virology
227:63-76[Medline].
|
| 29.
|
Kulken, C. L.,
J. J. de Jong,
E. Baan,
W. Keulen,
M. Tersmette, and J. Goudsmit.
1992.
Evolution of the V3 envelope domain in proviral sequences and isolates of human immunodeficiency virus type 1 during transitions of the viral biological phenotype.
Proc. Natl. Acad. Sci. USA
66:4622-4627.
|
| 30.
|
Lech, W. J.,
G. Wang,
Y. L. Yang,
Y. Chee,
K. Dorman,
D. McCrae,
L. C. Lazzeroni,
J. W. Erickson,
J. S. Sinshelmer, and A. H. Kaplan.
1996.
In vivo sequence diversity of the protease of human immunodeficiency virus type 1: presence of protease inhibitor-resistant variants in untreated subjects.
J. Virol.
70:2038-2043[Abstract].
|
| 31.
|
Mansky, L. M., and H. M. Temin.
1995.
Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase.
J. Virol.
69:5087-5094[Abstract].
|
| 32.
|
Maynard-Smith, J.
1976.
The evolution of sex.
Cambridge University Press, Cambridge, United Kingdom.
|
| 33.
|
Muller, H.
1984.
The relation of recombination to mutational advance.
Mutat. Res.
1:2-29.
|
| 34.
|
Nájera, I.,
A. Holguín,
M. E. Quiñones-Mateu,
M. A. Muñoz-Fernández,
R. Nájera,
C. López-Galíndez, and E. Domingo.
1995.
pol gene quasispecies of human immunodeficiency virus: mutations associated with drug resistance in virus from patients undergoing no drug therapy.
J. Virol.
69:23-31[Abstract].
|
| 35.
|
Novella, I. S.,
S. F. Elena,
A. Moya,
E. Domingo, and J. J. Holland.
1996.
Repeated transfer of small RNA virus populations leading to balanced fitness with infrequent stochastic drift.
Mol. Gen. Genet.
252:733-738[Medline].
|
| 36.
|
Novella, I. S.,
S. F. Elena,
A. Moya,
E. Domingo, and J. J. Holland.
1995.
Size of genetic bottlenecks leading to virus fitness loss determined by mean initial population fitness.
Proc. Natl. Acad. Sci. USA
69:2869-2872.
|
| 37.
|
Preston, B. P., and J. P. Dougherty.
1996.
Mechanisms of retroviral mutation.
Trends Microbiol.
4:16-21[Medline].
|
| 38.
|
Quinn, T. C.
1994.
Population migration and the spread of types 1 and 2 human immunodeficiency viruses.
Proc. Natl. Acad. Sci. USA
91:2407-2414[Abstract/Free Full Text].
|
| 39.
|
Ratner, L.,
W. Haseltine,
R. Patarca,
K. J. Livak,
B. Starcich,
S. F. Josephs,
E. R. Doran,
J. A. Rafalski,
E. Whichorn,
K. Baumelsteir,
L. Ivanoff,
S. R. J. Petteway,
M. L. Pearson,
J. A. Lautenbergen,
T. S. Papas,
J. Chrayeb,
N. T. Chang,
R. C. Gallo, and F. Wong-Staal.
1985.
Complete nucleotide sequence of the AIDS virus, HTLV-III.
Nature
313:277-284[Medline].
|
| 40.
|
Robertson, D. L.,
P. M. Sharp,
F. E. McCutchan, and B. H. Hahn.
1995.
Recombination in HIV-1.
Nature
374:124-127[Medline].
|
| 41.
|
Sánchez-Palomino, S.,
J. M. Rojas,
M. A. Martínez,
E. M. Fenyö,
R. Nájera,
E. Domingo, and C. López-Galindez.
1993.
Dilute passage promotes expression of genetic and phenotypic variants of human immunodeficiency virus type 1 in cell culture.
J. Virol.
67:2938-2943[Abstract/Free Full Text].
|
| 42.
|
Scarlatti, G.,
E. Tresoldi,
A. Björndal,
R. Fredriksson,
C. Colognesl,
H. K. Deng,
M. S. Malnatl,
A. Plebani,
A. G. Siccardi,
D. R. Littman,
E. M. Fenyö, and P. Lusso.
1997.
In vivo evolution of HIV-1 co-receptor usage and sensitivity to chemokine-mediated suppression.
Nat. Med.
3:1259-1265[Medline].
|
| 43.
|
Schinazi, R.,
B. Larder, and J. Mellors.
1997.
Mutations in retroviral genes associated with drug resistance.
Int. Antiviral News
5:129-142.
|
| 44.
|
Seillier-Molsiwitsch, F.,
B. H. Margolin, and R. Swanstrom.
1994.
Genetic variability of the human immunodeficiency virus: statistical and biological issues.
Annu. Rev. Genet.
28:559-596[Medline].
|
| 45.
|
Temin, H. M.
1993.
Retrovirus variation and reverse transcription: abnormal strand transfer results in retrovirus genetic variation.
Proc. Natl. Acad. Sci. USA
90:6900-6903[Abstract/Free Full Text].
|
| 46.
|
Vartanian, J.-P.,
A. Meyerhans,
B. Äsjö, and S. Wain-Hobson.
1991.
Selection, recombination, and G A hypermutation of human immunodeficiency virus type 1 genomes.
J. Virol.
65:1779-1788[Abstract/Free Full Text].
|
| 47.
|
Wain-Hobson, S.
1996.
Running the gamut of retroviral variation.
Trends Microbiol.
4:135-141[Medline].
|
| 48.
|
Wolinsky, S. M.,
G. M. Wike,
B. T. M. Korber,
C. Hutto,
W. P. Parks,
L. L. Rosenblum,
K. J. Kunstman,
M. R. Furtado, and J. L. Muñoz.
1992.
Selective transmission of human immunodeficiency virus type-1 variants from mothers to infants.
Science
255:1134-1137[Abstract/Free Full Text].
|
| 49.
|
Wooley, D. P.,
R. A. Smith,
S. Czajak, and R. Desrosiers.
1997.
Direct demonstration of retroviral recombination in a rhesus monkey.
J. Virol.
71:9650-9653[Abstract].
|
| 50.
|
Wyand, M. S.,
K. H. Manson,
A. A. Lackner, and R. C. Desrosiers.
1997.
Resistance of neonatal monkeys to live attenuated vaccine strains of simian immunodeficiency virus.
Nat. Med.
3:32-35[Medline].
|
| 51.
|
Zhang, J., and H. Temin.
1993.
Rate and mechanism of nonhomologous recombination during a single cycle of retroviral replication.
Science
259:234-238[Abstract/Free Full Text].
|
| 52.
|
Zhu, T.,
H. Mo,
N. Wang,
D. S. Nam,
Y. Cao,
R. A. Koup, and D. D. Ho.
1993.
Genotypic and phenotypic characterization of HIV-1 in patients with primary infection.
Science
261:1179-1181.
|
Journal of Virology, April 1999, p. 2745-2751, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Carrillo, C., Lu, Z., Borca, M. V., Vagnozzi, A., Kutish, G. F., Rock, D. L.
(2007). Genetic and Phenotypic Variation of Foot-and-Mouth Disease Virus during Serial Passages in a Natural Host. J. Virol.
81: 11341-11351
[Abstract]
[Full Text]
-
de la Iglesia, F., Elena, S. F.
(2007). Fitness Declines in Tobacco Etch Virus upon Serial Bottleneck Transfers. J. Virol.
81: 4941-4947
[Abstract]
[Full Text]
-
Bull, J. J., Sanjuan, R., Wilke, C. O.
(2007). Theory of Lethal Mutagenesis for Viruses. J. Virol.
81: 2930-2939
[Abstract]
[Full Text]
-
Sanjuan, R.
(2006). Quantifying antagonistic epistasis in a multifunctional RNA secondary structure of the Rous sarcoma virus. J. Gen. Virol.
87: 1595-1602
[Abstract]
[Full Text]
-
Arien, K. K., Abraha, A., Quinones-Mateu, M. E., Kestens, L., Vanham, G., Arts, E. J.
(2005). The Replicative Fitness of Primary Human Immunodeficiency Virus Type 1 (HIV-1) Group M, HIV-1 Group O, and HIV-2 Isolates. J. Virol.
79: 8979-8990
[Abstract]
[Full Text]
-
Troyer, R. M., Collins, K. R., Abraha, A., Fraundorf, E., Moore, D. M., Krizan, R. W., Toossi, Z., Colebunders, R. L., Jensen, M. A., Mullins, J. I., Vanham, G., Arts, E. J.
(2005). Changes in Human Immunodeficiency Virus Type 1 Fitness and Genetic Diversity during Disease Progression. J. Virol.
79: 9006-9018
[Abstract]
[Full Text]
-
Yuste, E., Borderia, A. V., Domingo, E., Lopez-Galindez, C.
(2005). Few Mutations in the 5' Leader Region Mediate Fitness Recovery of Debilitated Human Immunodeficiency Type 1 Viruses. J. Virol.
79: 5421-5427
[Abstract]
[Full Text]
-
Tan, Z., Gibbs, A. J., Tomitaka, Y., Sanchez, F., Ponz, F., Ohshima, K.
(2005). Mutations in Turnip mosaic virus genomes that have adapted to Raphanus sativus. J. Gen. Virol.
86: 501-510
[Abstract]
[Full Text]
-
Li, H., Roossinck, M. J.
(2004). Genetic Bottlenecks Reduce Population Variation in an Experimental RNA Virus Population. J. Virol.
78: 10582-10587
[Abstract]
[Full Text]
-
Tsui, R., Herring, B. L., Barbour, J. D., Grant, R. M., Bacchetti, P., Kral, A., Edlin, B. R., Delwart, E. L.
(2004). Human Immunodeficiency Virus Type 1 Superinfection Was Not Detected following 215 Years of Injection Drug User Exposure. J. Virol.
78: 94-103
[Abstract]
[Full Text]
-
Sagar, M., Lavreys, L., Baeten, J. M., Richardson, B. A., Mandaliya, K., Chohan, B. H., Kreiss, J. K., Overbaugh, J.
(2003). Infection with Multiple Human Immunodeficiency Virus Type 1 Variants Is Associated with Faster Disease Progression. J. Virol.
77: 12921-12926
[Abstract]
[Full Text]
-
Lazaro, E., Escarmis, C., Domingo, E., Manrubia, S. C.
(2002). Modeling Viral Genome Fitness Evolution Associated with Serial Bottleneck Events: Evidence of Stationary States of Fitness. J. Virol.
76: 8675-8681
[Abstract]
[Full Text]
-
Iglesias-Ussel, M. D., Casado, C., Yuste, E., Olivares, I., Lopez-Galindez, C.
(2002). In vitro analysis of human immunodeficiency virus type 1 resistance to nevirapine and fitness determination of resistant variants. J. Gen. Virol.
83: 93-101
[Abstract]
[Full Text]
-
Yuste, E., Moya, A., Lopez-Galindez, C.
(2002). Frequency-dependent selection in human immunodeficiency virus type 1. J. Gen. Virol.
83: 103-106
[Abstract]
[Full Text]
-
Peters, S., Munoz, M., Yerly, S., Sanchez-Merino, V., Lopez-Galindez, C., Perrin, L., Larder, B., Cmarko, D., Fakan, S., Meylan, P., Telenti, A.
(2001). Resistance to Nucleoside Analog Reverse Transcriptase Inhibitors Mediated by Human Immunodeficiency Virus Type 1 p6 Protein. J. Virol.
75: 9644-9653
[Abstract]
[Full Text]
-
Pariente, N., Sierra, S., Lowenstein, P. R., Domingo, E.
(2001). Efficient Virus Extinction by Combinations of a Mutagen and Antiviral Inhibitors. J. Virol.
75: 9723-9730
[Abstract]
[Full Text]
-
Casado, C., Garcia, S., Rodriguez, C., del Romero, J., Bello, G., Lopez-Galindez, C.
(2001). Different evolutionary patterns are found within human immunodeficiency virus type 1-infected patients. J. Gen. Virol.
82: 2495-2508
[Abstract]
[Full Text]
-
Schneider, W. L., Roossinck, M. J.
(2001). Genetic Diversity in RNA Virus Quasispecies Is Controlled by Host-Virus Interactions. J. Virol.
75: 6566-6571
[Abstract]
[Full Text]
-
Arias, A., Lázaro, E., Escarmís, C., Domingo, E.
(2001). Molecular intermediates of fitness gain of an RNA virus: characterization of a mutant spectrum by biological and molecular cloning. J. Gen. Virol.
82: 1049-1060
[Abstract]
[Full Text]
-
Greenier, J. L., Miller, C. J., Lu, D., Dailey, P. J., Lü, F. X., Kunstman, K. J., Wolinsky, S. M., Marthas, M. L.
(2001). Route of Simian Immunodeficiency Virus Inoculation Determines the Complexity but Not the Identity of Viral Variant Populations That Infect Rhesus Macaques. J. Virol.
75: 3753-3765
[Abstract]
[Full Text]
-
Bleiber, G., Munoz, M., Ciuffi, A., Meylan, P., Telenti, A.
(2001). Individual Contributions of Mutant Protease and Reverse Transcriptase to Viral Infectivity, Replication, and Protein Maturation of Antiretroviral Drug-Resistant Human Immunodeficiency Virus Type 1. J. Virol.
75: 3291-3300
[Abstract]
[Full Text]
-
Yuste, E., López-Galíndez, C., Domingo, E.
(2000). Unusual Distribution of Mutations Associated with Serial Bottleneck Passages of Human Immunodeficiency Virus Type 1. J. Virol.
74: 9546-9552
[Abstract]
[Full Text]
-
Quiñones-Mateu, M. E., Ball, S. C., Marozsan, A. J., Torre, V. S., Albright, J. L., Vanham, G., van der Groen, G., Colebunders, R. L., Arts, E. J.
(2000). A Dual Infection/Competition Assay Shows a Correlation between Ex Vivo Human Immunodeficiency Virus Type 1 Fitness and Disease Progression. J. Virol.
74: 9222-9233
[Abstract]
[Full Text]
-
Moya, A., Elena, S. F., Bracho, A., Miralles, R., Barrio, E.
(2000). The evolution of RNA viruses: A population genetics view. Proc. Natl. Acad. Sci. USA
97: 6967-6973
[Abstract]
[Full Text]
-
Ibáñez, A., Clotet, B., Martínez, M.-A.
(2000). Human immunodeficiency virus type 1 population bottleneck during indinavir therapy causes a genetic drift in the env quasispecies. J. Gen. Virol.
81: 85-95
[Abstract]
[Full Text]
Top
Abstract
Introduction
