This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsai, C.-H.
Right arrow Articles by Hsu, Y.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsai, C.-H.
Right arrow Articles by Hsu, Y.-H.

 Previous Article  |  Next Article 

Journal of Virology, April 1999, p. 2703-2709, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Sufficient Length of a Poly(A) Tail for the Formation of a Potential Pseudoknot Is Required for Efficient Replication of Bamboo Mosaic Potexvirus RNA

Ching-Hsiu Tsai,1,* Chi-Ping Cheng,1 Chih-Weng Peng,1 Biing-Yuan Lin,2 Na-Sheng Lin,2 and Yau-Heiu Hsu1

Graduate Institute of Agricultural Biotechnology, National Chung Hsing University, Taichung 402,1 and Institute of Botany, Academia Sinica, Nankang, Taipei 115,2 Taiwan

Received 11 September 1998/Accepted 4 December 1998


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

RNAs transcribed from a full-length infectious cDNA clone of the bamboo mosaic potexvirus (strain O) genome, pBaMV-O, were infectious to Nicotiana benthamiana plants. Mutant genomes in which the poly(A) tail is absent or replaced by a 3' tRNA-like structure from turnip yellow mosaic virus RNA failed to amplify detectably in N. benthamiana protoplasts. No amplification was detected in protoplasts inoculated with transcripts containing 4, 7, or 10 adenylate residues at the 3' end, whereas transcript inocula with 15 adenylate residues resulted in coat protein accumulation to a level 26% of that resulting from inoculation with transcripts with 25 adenylate residues (designated as wild type). Coat protein accumulation levels of 69 and 98% relative to wild type were observed after inoculation of protoplasts with transcripts bearing poly(A) tails 18 and 22 nucleotides long, respectively. The presence of a putative 3' pseudoknot structure including at least 13 adenylate residues of the 3'-terminal poly(A) tail was supported by enzymatic and chemical structural analysis. The functional relevance of this putative pseudoknot was tested by mutations that affected basepairing within the pseudoknot. These results support the existence of functional 3' pseudoknot that includes part of the 3' poly(A) tail.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bamboo mosaic virus (BaMV), a member of the potexvirus group of plant viruses, has a flexuous rod-shaped morphology (15). It causes a serious mosaic disease on bamboo, especially in Ma Chu (Dendrocalamus latiflorus) and Green Bamboo (Bambusa oldhamii) in Taiwan. The BaMV genome consists of a single-stranded positive-sense RNA molecule with a 5' cap structure and a 3' poly(A) tail. The entire nucleotide sequences of two isolates, O and V, comprising 6,366 nucleotides [excluding the 3' poly(A) tail], have been determined (17, 31). Five major open reading frames (ORFs 1 to 5) encode polypeptides of 155, 28, 13, 6, and 25 kDa, respectively (Fig. 1). Two major subgenomic RNAs of 2.0 and 1.0 kb in length are not encapsidated (16).


View larger version (10K):
[in this window]
[in a new window]
 
FIG. 1.   Diagram of the BaMV strain O infectious clone pBaMV-O, a pUC-derived clone containing a full-length insert of BaMV genomic cDNA. The BaMV insert, with its 5' and 3' termini and significant restriction sites as marked, is flanked at the 5' end by a bacteriophage T7 promoter and at the 3' end by a unique BamHI site. Five major ORFs encoded by BaMV RNA, ORF1 to ORF 5, are shown under the cDNA clone. When this linearized template is transcribed with T7 RNA polymerase in the presence of cap analogue, full-length capped transcripts beginning at the viral 5' terminus as indicated in the lower panel are synthesized.

Constructing a full-length infectious cDNA clone is fundamental for further understanding of the functions of the products encoded by each ORF (3, 5, 10), the cis-elements required for viral replication (28, 29, 31), and the relationships between the viral RNAs and host symptom development (12). Infectious RNA transcripts have been produced from cDNA clones of several RNA viruses isolated from bacteria, animals, and plants (reviewed in reference 4). The strategies employed to obtain infectious clones and to determine the parameters that affected the infectivities of those RNA transcripts have also been described in detail (4).

The sequences of the 3' untranslated region (UTR) of positive-sense RNA viruses have been reported to play an important role in RNA amplification, whether the end structure is a tRNA-like structure (25, 27, 28) or a poly(A) tail (8, 21, 26, 30). As with eukaryotic mRNAs, the poly(A) tail of potexviral RNA is expected to play a general role in RNA stabilization and in translation initiation, in addition to possibly providing recognition elements for the replicase complex. Experiments with white clover mosaic potexvirus (WClMV) RNA (10) showed some marginal infectivity in plants with a completely deleted poly(A) tail. However, in the cases of hepatitis A virus (14), cowpea mosaic virus (8), poliovirus (21), and encephalomyocarditis virus (6), deletion of the poly(A) tail led to a loss of infectivity.

Here we report the cloning and generation of infectious RNA transcripts from a full-length cDNA clone of BaMV and the use of this clone to characterize the role of the 3' poly(A) tail in the replication of BaMV RNA. We have used enzymatic and chemical structural mapping techniques to define a potential pseudoknot in the 3' UTR that involves some nucleotides of the poly(A) tail. Disrupting and compensating mutations in one stem of the predicted pseudoknot support a function for this structural element. The effects of mutations in the 3' terminus were consistent with a functional role for the putative pseudoknot in viral amplication.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

BaMV-O infectious cDNA and chimeric viral genomic cDNA construction. Overlapping BaMV cDNA clones used for sequencing (17) were used to construct the full-length cDNA clone. The 5' primer d(GCTCTAGATAATACGACTCACTATAGAAAACCACTCCAAACGAA), containing an XbaI site (italics) and T7 promoter (underlined), and the 5'-BaMV sequence, and downstream primer d(ATCTCCTCTTCTCCGGAA) priming at nucleotide position 421 (17) were used to generate a PCR fragment to provide the 5' region of the full-length clone of the BaMV-O genome.

For the generation of 3'-end mutants, PCR amplification was used to produce small fragments for substitution into pBaMV-O. Mutation pBaMV-O/noA, lacking a poly(A) tail in the 3' noncoding region, was PCR amplified as a 465-bp fragment by using the upstream primer d(CCAAACCGACGTTCGCCA) located at nucleotide position 5910 (17) and the downstream primer d(CGCGGATCCGGAAAAAACTGTAGAAA), which includes a BamHI site (italics) positioned at the 3' end of the genomic sequence. The same strategy was also used to generate mutants with different numbers of adenylate residues at the 3' ends. Mutations pBaMV-O/4A, -O/7A, -O/10A, and -O/15A were made with the downstream primers d(GCGGGATCCTTTTGGAAAAAA), d(GCGGGATCCTTTTTTTGGAAAAAA), d(GCGGGATCCTTTTTTTTTT), and d(GCGGGATCCTTTTTTTTTTTTTTT), respectively. The primer used to generate the mutant fragment with 15 adenine residues contains a run of 15 thymine residues that can anneal at different positions to the 32 adenine residues of the cDNA clone used as template for PCR. Therefore, we could screen the T-vector clones for runs of adenylate residues longer than 15. By this strategy, we obtained mutants with 18, 22, and 25 adenine residues. The mutant, pBaMV-O/TYtRNA, with a tRNA-like structure (TLS) from turnip yellow mosaic virus (TYMV) at the 3' terminus, was produced by a two-step PCR method involving the initial production of a 3' megaprimer (22) comprising the entire 107-bp fragment of TYMV TLS and a short BaMV sequence of the 3' UTR. The second PCR step used the linearized pBaMV-O as a template, the megaprimer as the 3' primer, and the 5' primer as described above. All of the PCR products were cloned into T-vector (Novagen), and the sequence of each mutant was verified before subcloning the NruI (5964) to 3'-end segment into NruI-BamHI-cut pBaMV-O.

The mutants, pBaMV-O/G1, -O/C19, -O/G1C19, -O/C18, -O/G2C18, and -O/C18C19, were constructed in a similar fastion, with the mutagenesis primers d(ACAGTTTTTTCG1AAAAAAAAAA), d(TAAAGACCTTTTGC19TTTCTACAGT), d(TAAAGACCTTTTGC19TTTCTACAGTTTTTTCG1AAAAAAAAAA), d(TAAAGACCTTTTC18GTTTCTACAGT), d(TAAAGACCTTTTC18GTTTCTACAGTTTTTTG2CAAAAAAAAAA), and d(TAAAGACCTTTTC19C18TTTCTACAGT), respectively, used in the first-step PCR to make the megaprimer.

In vitro transcription and inoculation with protoplasts. Plasmid DNAs were prepared from 50-ml bacterial cultures, and the mutated sequences were confirmed by sequencing. Capped genomic transcripts labeled with [alpha -32P]UTP (0.1 Ci/mmol) were generated with T7 RNA polymerase from the BamHI-linearized plasmid templates containing wild-type and chimeric viral genomic cDNAs and analyzed as described previously (29) prior to inoculation. Chenopodium quinoa, Nicotiana benthamiana, and N. tabacum were grown in a greenhouse under natural light or in a growth chamber under a 16-h day length at 28°C. Mesophyll protoplasts (4 × 105) of C. quinoa, N. benthamiana, and N. tabacum were isolated, inoculated with 5 µg of transcript RNAs, and incubated at 25°C for 48 h under constant illumination as described previously (27, 28).

Analysis of viral products by Western and Northern blotting. The levels of coat protein in harvested protoplasts were analyzed in Western blots with anti-BaMV capsid protein serum as a primary antibody (15) and horseradish peroxidase-labeled secondary antibody and the chromogenic substrate 4-chloro-1-naphthol as described previously (29). Results were quantitated by scanning densitometry (Intelligent Quantifier; Bioimage). RNAs were extracted from protoplasts, glyoxalated, electrophoresed through 1% agarose, and transferred to nylon membranes as described previously (27). The hybridization probe was a 32P-labelled RNA transcript complementary to 0.6 kb at the 3' end of BaMV RNA (17).

Prediction of the BaMV 3' UTR structure. To predict the secondary structure of the BaMV 3' UTR, we employed the STAR (structural analysis of RNA) computer program (1). STAR is able to predict not only secondary structures but also aspects of tertiary structures, particularly pseudoknots.

Preparation of end-labeled RNA transcripts for structural mapping. BaMV/6282 RNA (an RNA whose 5' end is at nucleotide position 6282 of the BaMV RNA) was transcribed from PCR-generated DNA amplified from linearized pBaMV-OM (original cDNA clone containing 32 3' adenylate residues and 23 nonviral nucleotides) with the upstream primer T7/6282 d(TAATACGACTCACTATAGGGTTTACACGGACT) located in nucleotide position 6282 of the BaMV genomic sequence (17) and T7 promoter (underlined) and the downstream primer d(CGGCAACGAAGGTACCATGG) located at the nonviral region downstream of the poly(A) sequences. Transcripts were separated on a 5% polyacrylamide gel and eluted by soaking the sliced bands in elution buffer (0.5 M ammonium acetate, 10 mM magnesium acetate, 1 mM EDTA, 0.1% sodium dodecyl sulfate with shaking at 37°C overnight, followed by phenol-chloroform extraction and ethanol precipitation.

In order to label the 5' end of 1.5 µg of gel-purified RNA, dephosphorylation was performed in buffer with 1.5 U shrimp alkaline phosphatase (U.S. Biochemicals) at 37°C for 1 h followed by a phenol-chloroform extraction and ethanol precipitation prior to kinase treatment (23). Labeled transcripts were separated on an 8% sequencing gel and electroeluted from the sliced gel (3 mA per sample for 2 h).

Structural mapping with ribonucleases and chemicals. To localize the cleavage sites within the RNA structure, the size of labeled RNA cleavage fragments was determined by electrophoretic separation on denaturing (7 M urea) polyacrylamide gels. For each assay, a control without enzyme or chemical treatment was run in parallel. DNA sequencing reactions were used as markers to locate the cleavage sites. Primer (5'-GTTTACACGGACT-3'), which corresponds to the 5' ends of the labelled transcripts (except for the lack of two 5' guanine residues) was used in a dideoxy sequencing reaction to provide marker fragments.

Digestions with ribonucleases (A, T1, and T2) were performed at 20°C in 60 µl of RNase cleavage buffer (30 mM Tris-HCl, pH 7.5; 3 mM EDTA; 200 mM NaCl; 100 mM LiCl) (28) containing 1 µl of 5'-end-labeled transcripts (50,000 to 70,000 cpm). For RNase V1, 10 mM MgCl2 was included in the same buffer. Before addition of ribonucleases, the RNAs were denatured by heating at 65°C for 5 min followed by cooling slowly to 20°C. The following amounts of RNases were added: 0.0088 (1×) to 0.0528 (6×) µg of RNase A, 0.05 to 20 U of RNase T1, 0.5 to 16 U of RNase T2, and 0.0175 to 1.4 U of RNase V1. All of the reactions were incubated at 20°C for 10 min except the RNase V1 reactions, which were incubated for 15 min. Reactions were stopped by phenol-chloroform extraction, and the RNA fragments were precipitated with ethanol, washed with 70% ethanol, and then vacuum dried.

Modification of the N-7 position of adenine residues by diethylpyrocarbonate (DEPC) was done according to the method of Peattie and Gilbert (19). The concentration of DEPC used and the incubation times were optimized for BaMV RNA transcripts. The reaction mixture of 100 µl containing 1 µl of labeled transcripts (50,000 to 70,000 cpm) in the RNA cleavage buffer described above was incubated at 30°C for 15 min with a serial dilution of pure DEPC (ca. 97%; Sigma) from 2.5 to 20 µl. After the reaction, the modified RNA fragments were ethanol precipitated with yeast carrier RNAs. The dried RNAs were dissolved in 20 µl of 1 M aniline (redistilled)-acetic acid (pH 4.3) solution and incubated at 60°C for 20 min in the dark; then the cleaved RNA fragments were precipitated again with ethanol (18).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Full-length cDNA cloning and mutant construction. The full-length cDNA clone of BaMV-O, pBL, was constructed by connecting five overlapping cDNA clones previously used to sequence the genome (17) into the BamHI site of the pUC119 vector. In order to obtain a unique restriction site at each end of the full-length cDNA, the BamHI site at the 5' end was replaced with an XbaI site. A primer annealing to nucleotides 404 to 421 of BaMV-O RNA (17) was used for reverse transcription, and the 5'-end primer containing a T7 promoter and an XbaI restriction site was used to synthesize the second strand. This newly synthesized 5' fragment was subcloned into pBL by using 5' XbaI and BspEI (nucleotide 406) restriction sites. The resulting plasmid, pBaMV-OM, contains a unique BamHI site at the 3' end of the viral sequence that can be used for linearization prior to runoff transcription or for subcloning 3'-end mutations (Fig. 1). Since this full-length cDNA clone is mainly constructed from previous clones used for identifying the genomic sequences, the transcripts derived from those clones inherited 32 adenine residues plus 23 nonviral nucleotides at the 3' end when the template was linearized with the BamHI site. To obtain transcripts with fewer nonviral nucleotides, the 3' end of BaMV-OM (32 adenines plus 23 nonviral nucleotides) was replaced with 25 adenines and 5 nonviral nucleotides derived from the restriction site BamHI. The transcript derived from the resulting plasmid, pBaMV-O, was then designated as wild type.

To set up the optimal condition for assaying the BaMV transcripts, we compared the infectivities of BaMV RNA in protoplasts derived from different plants, C. quinoa, N. benthamiana, and N. tabacum, by inoculating the virion RNAs or transcripts into protoplasts and detecting the amounts of coat protein accumulated. We found that the protoplasts isolated from N. benthamiana have a higher viability rate than those from the other two plants. The coat protein accumulation of BaMV in protoplasts of N. benthamiana was also higher than in those of the other two plants (data not shown). Therefore, we chose N. benthamiana as the assay host for studying the efficiency of BaMV RNA replication for the rest of our experiments.

To test the infectivity of the full-length transcripts derived from the pBaMV-O, genomic transcripts and virion RNAs were inoculated onto protoplasts and plants. The infectivity of the transcripts was about one-fifth that of virion RNA in N. benthamiana protoplasts (Fig. 2A). Like virion RNA, transcripts induced light chlorotic mosaic symptoms on the inoculated leaves of C. quinoa with no indication of systemic spread, and asymptomatic systemic movement of virus was observed in N. benthamiana plants.


View larger version (37K):
[in this window]
[in a new window]
 
FIG. 2.   Replication of BaMV RNAs in N. benthamiana protoplasts. Representative experiments that have contributed to the quantitative data in Table 1 are shown. Protoplasts (4 × 105 cells) were inoculated with 1 µg of virion RNA or 5 µg of transcripts from pBaMV-O and its derivatives (indicated at the top of each lane of panels A, B, and C [Western immunoblots] and panel D [Northern blot]). Protoplasts (2 × 105 cells) were harvested 48 h after inoculation for either Western or Northern analysis with the indicated derivatives of BaMV RNA. (A, B, and C) Extracts were separated on a 14% polyacrylamide-sodium dodecyl sulfate gel, blotted, and probed with anti-BaMV coat protein serum. The blot was developed by using horseradish peroxidase-linked second antibodies and 5-chloro-1-naphthol color reagent. (D) Detection of viral genomic (G; 6.4 kb) and two subgenomic (SG; 2.0 and 1.0 kb) RNAs in by Northern blotting. RNAs were probed with a 32P-labelled RNA transcript complementary to 0.6 kb at the 3' end of the genomic RNA.

Effect of poly(A) tail length. To determine the role of the poly(A) tail in the infectivity of BaMV RNA, a series of mutants with changes at the 3' end were constructed. Transcripts lacking a poly(A) tail or with 4, 7, 10, 15, 18, and 22 3' adenines, were generated. Like the wild type containing 25 3' adenines, each RNA terminated with 5 nonviral nucleotides (GGAUC) at the end of the transcripts when the template was linearized with BamHI. To test whether another type of 3'-stabilizing sequence could replace the poly(A) tail, the infectivity of BaMV-O/TYtRNA RNA, in which the TYMV tRNA-like structure replaces the poly(A) tail, was constructed. The tRNA-like structure of TYMV can be aminoacylated at its 3' end with valine (7), and tRNA-like structures are thought to function as telomeres for stable retention of the genomic 3' end (20).

While BaMV transcripts with 18-, 22-, and 25-residue poly(A) tails led to similar viral accumulations in protoplasts (69, 98, and 100% [wild type], respectively, on the basis of coat protein accumulation [Table 1]), inocula with shorter poly(A) tails supported lower or no accumulation of coat protein or viral RNAs (Fig. 2C and D). Inoculation with BaMV-O/15A RNA produced decreased levels of viral products (26% of the wild-type coat protein accumulation), while inoculation of protoplasts with RNA with fewer 3' adenine residues (noA, 4A, 7A, and 10A) failed to yield detectable viral products. Mutant genomes in which the poly(A) tail is replaced by the TYMV tRNA-like structure failed to support detectable virus amplification in N. benthamiana protoplasts (Fig. 2B). These results showed that the poly(A) tail is important in BaMV amplification.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Coat protein accumulations of the BaMV infectious clone (pBaMV-O) and its derivatives in protoplasts of N. benthamiana

Putative pseudoknot involving the poly(A) tail. To determine the structure of the 3' region of the genomic RNA, the 3' end of BaMV RNA was transcribed from a PCR-generated fragment containing a T7 promoter. Three guanine residues including two nonviral guanines at the very 5' end of the transcripts are inherited from the T7 promoter for more efficient transcription. To optimize the reaction conditions for each ribonuclease and DEPC, we tried several buffer systems such as "standard" structure probing buffer (13), RNase digestion buffer (28), TMK buffer (11), and sodium cacodylate buffer (9). The banding patterns generated by the RNase cleavage were the same among all of the buffers tested. However, the condition modified from the RNase digestion buffer (28) could resolve the banding pattern better and give less background than those of the other buffers (data not shown). For each ribonuclease tested, we used a serial dilution of salt or enzyme concentrations to optimize the condition for each cleavage reaction. Selected reactions for each ribonuclease and for DEPC are presented in Fig. 3 and 4. Comparison of the banding patterns of the lanes labeled T2 (single-stranded specific RNase T2) to those of the lanes labeled V1 (double-stranded specific RNase V1) showed clearly complementary banding. The deduced basepairing matches the prediction of the computer algorithm STAR (1), with a classical pseudoknot structure (nucleotides 23 to -12, the first A residue of the poly(A) tail connected to the 3' UTR is numbered -1) comprising at least 13 adenylate residues localized downstream of a major stem-loop (Fig. 5).


View larger version (77K):
[in this window]
[in a new window]
 
FIG. 3.   Chemical and enzymatic probing of the BaMV 3' UTR around the putative pseudoknot region. The RNA transcripts were 5' end labeled and treated with RNase T1 (lanes T1), RNase A (lanes A), RNase T2 (lanes T2), cobra venom nuclease V1 (lanes V1), and DEPC (lane DEPC). The amount of enzyme or chemical used in each reaction is indicated above each lane. The cleavage products were resolved on a 6% sequencing gel. Lane c corresponds to the control untreated RNA sample, whereas lane a corresponds to aniline-treated RNA used for sizing the cleavage fragments. Lanes G, A, T, and C correspond to the sequencing reaction as markers for identifying the cleavage sites.


View larger version (48K):
[in this window]
[in a new window]
 
FIG. 4.   Enzymatic probing of the BaMV 3' UTR corresponding to the pseudoknot region. The RNA transcripts were 5'-end labeled and treated with RNase T1 (lane T1), RNase A (lane A), and RNase T2 (lane T2). The concentration of enzyme used in each reaction is indicated above each lane. The cleavage products were resolved on an 8% sequencing gel. Lane c corresponds to the untreated RNA sample. Lanes G, A, T, and C contain DNA products from dideoxy sequencing reactions that are used as markers; note that the primer used for the dideoxy sequencing reaction was two residues shorter at the 5' end than the otherwise identical primer used for structure probing; there is thus a two-nucleotide offset between the markers and the products of structure probing experiments.


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 5.   Proposed folding of the 3'-end 81 nucleotides of the UTR plus the poly(A) tail of BaMV RNA. Nucleotides are numbered from the 3'-end cytosine just upstream of the poly(A) tail. The structure has been deduced from chemical and enzymatic probing experiments of the predicted structure of BaMV 3' UTR assisted by computer predictions made with the STAR program (1). A summary of the cleavages or modifications induced by enzymatic or chemical probes is indicated by symbols explained in the figure.

A run of six U residues in stem 2 of the pseudoknot was sensitive to RNase V1 (Fig. 3) and resistant to RNase A (Fig. 3 and 4), indicating that these U residues are involved in base-pairing. Further, a stretch of A residues from the poly(A) tail showed decreased accessibility of cleavage by RNase T2 [the middle portion of poly(A) ladders in Fig. 4 lane T2], supporting the pairing of these A and U tracts to form stem 2 of the pseudoknot (Fig. 5). The loops of the proposed pseudoknot were sensitive to RNase T2, with cleavages at nucleotides UACAG13-9 in loop 1 and at least three A residues in loop 2. To determine the exact number of adenylate residues in loop 2 is difficult, since the runs of A residues at the 3' end could be flexible to pair with the six U residues forming stem 2, producing a loop 2 of variable length. However, careful analysis of the banding density showed that three bands (A-5-A-7) were always stronger than the others (Fig. 4), suggestive of three A residues in loop 2 of the pseudoknot, as indicated in Fig. 5.

Effects of mutations in the stem of the putative pseudoknot. Results from structural probing indicated that the pseudoknot might exist in the buffer condition tested. However, we cannot rule out the existence of an alternative structure. To further investigate the pseudoknotted structure involved in BaMV RNA replication, mutations were introduced into the pseudoknot to destabilize stem S1 or to restore it with compensatory changes. Mutants BaMV-O/G1, -O/C19, -O/C18, and -O/C18C19 were expected to disrupt stem S1 of the putative pseudoknot. These mutants accumulated to levels 12 to 17% of the wild-type levels, as measured by coat protein accumulation (Table 2). Combinations of the BaMV-O/G1C19 or BaMV-O/G2C18 mutations, expected to restore stem S1 and pseudoknot formation, resulted in amplification to 75 and 56%, respectively. However, the compensatory mutants could not accumulate the coat protein level to that of the wild type, implying that the primary sequence is involved in the BaMV RNA replication as well as the secondary structure. These data provide strong evidence that maintaining the stem formation of the pseudoknot is important for BaMV RNA replication.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Coat protein accumulations of the BaMV infectious clone (pBaMV-O) and its derivatives in protoplasts of N. benthamiana


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

An infectious cDNA clone is an important tool for studying the RNA viruses at a molecular level. Although the original construct of the full-length cDNA of BaMV, pBaMV-OM, has 23 nonviral extra nucleotides after 32 adenine residues at the very 3' end, it still has substantial replication efficiency in N. benthamiana protoplasts (only fivefold less than the virion RNAs) (Fig. 2A). It has been reported that 28 (32) and even up to 198 (2) nonviral residues at the very 3' end of the transcripts did not significantly affect infectivity. The addition of up to 2,434 nonviral nucleotides at the 3' end of transcripts derived from the papaya mosaic virus infectious cDNA clone decreased but did not abolish infectivity completely (24). However, to prevent any possible artifact of these long nonviral nucleotides at the very 3' end of the genome, the end was replaced with 25 adenylate residues and 5 nonviral nucleotides (GGAUC) derived from the BamHI restriction site. The resulting transcript, BaMV-O, was then designated as wild type.

It has been reported that the transcripts of WClMV with shortened poly(A) tails were less infectious than wild type; however, the transcripts without any 3'-terminal (A) residue still produced three lesions while the wild type (74 A residues) or mutants with 27 or 10 A residues at the 3' end showed 125, 105, or 70 local lesions, respectively, on the inoculated leaves of cowpea plants (10). In contrast to these observations with WClMV, we could not detect any amplification of mutants with no or short poly(A) tails despite higher sensitivities than in the WClMV studies (Fig. 2B). These results suggested that the poly(A) tail may be involved in BaMV amplification, perhaps affecting stability as for mRNA in eukaryotic cells, or else playing a structural role in the recognition by the replicase complex, as in the case of hepatitis A virus, for which the poly(A) tail is part of a recognition element involved in viral replication (14). If the poly(A) tail of the BaMV RNA plays only a stabilizing role, then a tRNA-like structure at the 3' end might support a similar function. However, no signals could be detected in the protoplasts when inoculated with the mutant pBaMV-O/TYtRNA (Fig. 2B and Table 1).

Structural analysis of the 3' noncoding region of BaMV RNA showed a potential classic pseudoknot involving a number of adenylate residues of the poly(A) tail. Besides, a similar structure was found among the most stable structures predicted by MFOLD (program in the Genetics Computer Group sequence analysis software package [33]). If pseudoknot formation is required for BaMV RNA replication, the number of adenylate residues might be a critical factor. Transcripts with only 4 or 7 A residues are unable to form the proposed pseudoknot, but probably form a 6-bp stem with a large loop of 15 nucleotides. Although transcripts with 10 A residues can form a pseudoknot with a shorter S2 stem with the help of two wobble GU pairs, where the two guanine residues next to the 10 adenine residues were derived from BamHI cleavage site (GGAUC), no amplification could be detected in protoplasts. Transcripts with more than 15 A residues can form a stable pseudoknot but also have extra adenylate residues at the very 3' end that might be important for RNA stability in host cells. The transcripts of pBaMV-O/15A, which possessed a pseudoknot and seven unstructured adenylate residues at the end replicated to ca. 26% of the wild-type levels. Replication of transcripts derived from pBaMV-O/18A or -O/22A, which possessed a pseudoknot and 10 or 14 additional nucleotides amplified to 69 or 98%, respectively, the level of the wild type.

Each mutant with disruptions in S1 of the pseudoknot failed to accumulate viral products efficiently, whereas the compensatory mutants with the base-pairing restored could only amplify up to 75% of the level of the wild type. It is likely that the functional properties of this pseudoknot are conferred by both the secondary and primary structure. Based on the structural mapping, the sufficient length of adenylate residues required to maintain the downstream stem formation, and the compensatory mutational analysis of the upstream stem formation of the predicted pseudoknot structure, we conclude that the formation and maintenance of a stable pseudoknot at the 3' UTR of BaMV is important for viral RNA replication.


    ACKNOWLEDGMENTS

We thank Theo Dreher at Oregon State University for discussion and editorial help.

This research was supported by National Science Council of the Republic of China grants NSC 83-0203-B-005-009 and NSC 84-2311-B-005-012 B11.


    FOOTNOTES

* Corresponding author. Mailing address: Graduate Institute of Agricultural Biotechnology, National Chung Hsing University, Taichung 402, Taiwan. Phone: (886)-4-2840451. Fax: (886)-4-2860260. E-mail: chtsail{at}dragon.nchu.edu.tw.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Abrahams, J. P., M. van den Berg, F. H. D. Batenburg, and C. W. A. Pleij. 1990. Prediction of RNA secondary structure, including pseudoknotting, by computer simulation. Nucleic acids Res. 18:3035-3044[Abstract/Free Full Text].
2. Beck, D. L., R. L. S. Forster, M. W. Bevan, K. A. Boxen, and S. C. Lowe. 1990. Infectious transcripts and nucleotide sequence of cloned cDNA of the potexvirus white clover mosaic virus. Virology 177:152-158[Medline].
3. Beck, D. L., P. J. Guilford, D. M. Voot, M. T. Andersen, and R. L. S. Forster. 1991. Triple gene block proteins of white clover mosaic potexvirus are required for transport. Virology 183:695-702[Medline].
4. Boyer, J.-C., and A.-L. Haenni. 1994. Infectious transcripts and cDNA clones of RNA viruses. Virology 198:415-426[Medline].
5. Chapman, S., G. Hills, J. Watts, and D. Baulcombe. 1992. Mutational analysis of the coat protein gene of potato virus X: effects on virion morphology and viral pathogenicity. Virology 191:223-230[Medline].
6. Cui, T., and A. G. Porter. 1995. Localization of binding site for encephalomyocarditis virus RNA polymerase in the 3'-noncoding region of the viral RNA. Nucleic Acids Res. 23:377-382[Abstract/Free Full Text].
7. Dreher, T. W., C. Florentz, and R. Giege. 1988. Valylation of tRNA-like transcripts from cloned cDNA of turnip yellow mosaic virus RNA demonstrate that the L-shaped region at the 3' end of the viral RNA is not sufficient for optimal aminoacylation. Biochimie 70:1719-1727[Medline].
8. Eggen, R., J. Verver, J. Wellink, K. Pleij, A. Van Kammen, and R. Goldbach. 1989. Analysis of sequences involved in cowpea mosaic virus RNA replication by using site specific mutants. Virology 173:456-464[Medline].
9. Felden, B., C. Florentz, R. Giege, and E. Westhof. 1994. Solution structure of the 3'-end of brome mosaic virus genomic RNAs: conformational mimicry with canonical tRNAs. J. Mol. Biol. 235:508-531[Medline].
10. Guilford, P. J., D. L. Beck, and R. L. S. Forster. 1991. Influence of the poly(A) tail and putative polyadenylation signal on the infectivity of white clover mosaic potexvirus. Virology 182:61-67[Medline].
11. Jacobson, S. J., D. A. M. Konings, and P. Sarnow. 1993. Biochemical and genetic evidence for a pseudoknot structure at the 3' terminus of the poliovirus RNA genome and its role in viral RNA amplification. J. Virol. 67:2961-2971[Abstract/Free Full Text].
12. Kavanagh, T., M. Goulden, S. S. Cruz, S. Chapman, I. Barker, and D. Baulcombe. 1992. Molecular analysis of a resistance-breaking strain of potato virus X. Virology 189:609-617[Medline].
13. Knapp, G. 1989. Enzymatic approaches to probing of RNA secondary and tertiary structure. Methods Enzymol. 180:192-212[Medline].
14. Kusov, Y., M. Weitz, G. Dollenmeier, V. Gauss-Muller, and G. Siegl. 1996. RNA- protein interactions at the 3' end of the hepatitis A virus RNA. J. Virol. 70:1890-1897[Abstract].
15. Lin, M. T., E. W. Kitajima, F. P. Cupertino, and C. L. Costa. 1977. Partial purification and some properties of bamboo mosaic virus. Phytopathology 67:1439-1443.
16. Lin, N.-S., F. Z. Lin, T. Y. Huang, and Y.-H. Hsu. 1992. Genome properties of bamboo mosaic virus. Phytopathology 82:731-734.
17. Lin, N.-S., B.-Y. Lin, N.-W. Lo, C.-C. Hu, T.-Y. Chow, and Y.-H. Hsu. 1994. Nucleotide sequence of the genomic RNA of bamboo mosaic potexvirus. J. Gen. Virol. 75:2513-2518[Abstract/Free Full Text].
18. Peattie, D. A. 1979. Direct chemical method for sequencing RNA. Proc. Natl. Acad. Sci. USA 76:1760-1764[Abstract/Free Full Text].
19. Peattie, D. A., and W. Gilbert. 1980. Chemical probes for higher-order structure in RNA. Proc. Natl. Acad. Sci. USA 77:4679-4682[Abstract/Free Full Text].
20. Rao, A. L., T. W. Dreher, L. E. Marsh, and T. C. Hall. 1989. Telomeric function of the tRNA-like structure of brome mosaic virus RNA. Proc. Natl. Acad. Sci. USA 86:5335-5339[Abstract/Free Full Text].
21. Rohll, J. B., D. H. Moon, D. J. Evans, and J. W. Almond. 1995. The 3' untranslated region of picornavirus RNA: features required for efficient genome replication. J. Virol. 69:7835-7844[Abstract].
22. Sarkar, G., and S. S. Sommer. 1990. The "megaprimer" method of site-directed mutagenesis. BioTechniques 8:404-407[Medline].
23. Silberklang, M., A. M. Gillum, and U. RajBshandary. 1977. Photo-induced joining of a transfer RNA with cognate aminoacyl transfer RNA synthetase. J. Mol. Biol. 84:503-513.
24. Sit, T. L., and M. G. AbouHaidar. 1993. Infectious RNA transcripts derived from cloned cDNA of papaya mosaic virus: effect of mutations to the capsid and polymerase proteins. J. Gen. Virol. 74:1130-1140.
25. Skuzeski, J. M., C. S. Bozarth, and T. W. Dreher. 1996. The turnip yellow virus tRNA-like structure cannot be replaced by generic tRNA-like elements or by heterologous 3' untranslated regions known to enhance mRNA expression and stability. J. Virol. 70:2107-2115[Abstract].
26. Sriskanda, V. S., G. Pruss, X. Ge, and V. B. Vance. 1996. An eight-nucleotide sequence in the potato virus X 3' untranslated region is required for both host protein binding and viral multiplication. J. Virol. 70:5266-5271[Abstract/Free Full Text].
27. Tsai, C.-H., and T. W. Dreher. 1991. Turnip yellow mosaic virus RNAs with anticodon loop substitutions that result in decreased valylation fail to replicate efficiently. J. Virol. 65:3060-3067[Abstract/Free Full Text].
28. Tsai, C.-H., and T. W. Dreher. 1992. Second-site suppresser mutations assist in studying the function of the 3' noncoding region of turnip yellow mosaic virus RNA. J. Virol. 66:5190-5199[Abstract/Free Full Text].
29. Weiland, J. J., and T. W. Dreher. 1989. Infectious TYMV RNA from cloned cDNA: effects in vitro and in vivo of point substitutions in the initiation codons of two extensively overlapping ORFs. Nucleic Acids Res. 17:4675-4687[Abstract/Free Full Text].
30. White, K. A., J. B. Bancroft, and G. A. Mackie. 1992. Mutagenesis of a hexanucleotides sequence conserved in potexvirus RNAs. Virology 189:817-820[Medline].
31. Yang, C. C., J. S. Liu, C. P. Lin, and L.-S. Lin. 1997. Nucleotide sequence and phylogenetic analysis of a bamboo mosaic potexvirus isolated from common bamboo (Bambusa vulgaris McClure). Bot. Bull. Acad. Sin. 38:77-84.
32. Ziegler-Graff, V., S. Bouzoubaa, I. Jupin, H. Guilley, G. Jonard, and K. Richards. 1988. Biologically active transcripts of beet necrotic yellow vein virus RNA-3 and RNA-4. J. Gen. Virol. 69:2347-2357.
33. Zuker, M. 1989. Computer prediction of RNA structure. Methods Enzymol. 180:262-288[Medline].


Journal of Virology, April 1999, p. 2703-2709, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Hsu, Y.-H., Chen, H.-C., Cheng, J., Annamali, P., Lin, B.-Y., Wu, C.-T., Yeh, W.-B., Lin, N.-S. (2006). Crucial Role of the 5' Conserved Structure of Bamboo Mosaic Virus Satellite RNA in Downregulation of Helper Viral RNA Replication. J. Virol. 80: 2566-2574 [Abstract] [Full Text]  
  • Chen, I-H., Chou, W.-J., Lee, P.-Y., Hsu, Y.-H., Tsai, C.-H. (2005). The AAUAAA Motif of Bamboo Mosaic Virus RNA Is Involved in Minus-Strand RNA Synthesis and Plus-Strand RNA Polyadenylation. J. Virol. 79: 14555-14561 [Abstract] [Full Text]  
  • Lin, J.-W., Chiu, H.-N., Chen, I-H., Chen, T.-C., Hsu, Y.-H., Tsai, C.-H. (2005). Structural and Functional Analysis of the cis-Acting Elements Required for Plus-Strand RNA Synthesis of Bamboo Mosaic Virus. J. Virol. 79: 9046-9053 [Abstract] [Full Text]  
  • Cheng, J.-H., Peng, C.-W., Hsu, Y.-H., Tsai, C.-H. (2002). The Synthesis of Minus-Strand RNA of Bamboo Mosaic Potexvirus Initiates from Multiple Sites within the Poly(A) Tail. J. Virol. 76: 6114-6120 [Abstract] [Full Text]  
  • Qiu, W., Scholthof, H. B. (2001). Effects of inactivation of the coat protein and movement genes of Tomato bushy stunt virus on early accumulation of genomic and subgenomic RNAs. J. Gen. Virol. 82: 3107-3114 [Abstract] [Full Text]  
  • Huang, C.-Y., Huang, Y.-L., Meng, M., Hsu, Y.-H., Tsai, C.-H. (2001). Sequences at the 3' Untranslated Region of Bamboo Mosaic Potexvirus RNA Interact with the Viral RNA-Dependent RNA Polymerase. J. Virol. 75: 2818-2824 [Abstract] [Full Text]  
  • Spagnolo, J. F., Hogue, B. G. (2000). Host Protein Interactions with the 3' End of Bovine Coronavirus RNA and the Requirement of the Poly(A) Tail for Coronavirus Defective Genome Replication. J. Virol. 74: 5053-5065 [Abstract] [Full Text]  
  • Williams, G. D., Chang, R.-Y., Brian, D. A. (1999). A Phylogenetically Conserved Hairpin-Type 3' Untranslated Region Pseudoknot Functions in Coronavirus RNA Replication. J. Virol. 73: 8349-8355 [Abstract] [Full Text]  
  • Tsai, M.-S., Hsu, Y.-H., Lin, N.-S. (1999). Bamboo Mosaic Potexvirus Satellite RNA (satBaMV RNA)-Encoded P20 Protein Preferentially Binds to satBaMV RNA. J. Virol. 73: 3032-3039 [Abstract] [Full Text]  
  • You, S., Falgout, B., Markoff, L., Padmanabhan, R. (2001). In Vitro RNA Synthesis from Exogenous Dengue Viral RNA Templates Requires Long Range Interactions between 5'- and 3'-Terminal Regions That Influence RNA Structure. J. Biol. Chem. 276: 15581-15591 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsai, C.-H.
Right arrow Articles by Hsu, Y.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsai, C.-H.
Right arrow Articles by Hsu, Y.-H.