Previous Article | Next Article 
Journal of Virology, March 1999, p. 2425-2433, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mutant Influenza Viruses with a Defective NS1
Protein Cannot Block the Activation of PKR in Infected Cells
Eriko
Hatada,1
Sakura
Saito,2 and
Ryuji
Fukuda1,*
Department of Biochemistry, Kanazawa
University School of Medicine, Kanazawa, Ishikawa
920-0934,1 and
Laboratory of Cytokines,
Department of Viral Disease and Vaccine Control, National Institute
of Health of Japan, Musashimurayama, Tokyo
208-0011,2 Japan
Received 4 August 1998/Accepted 1 December 1998
 |
ABSTRACT |
A short model genome RNA and also the genome RNA of influenza A
virus bearing both 5'- and 3'-terminal common sequences activated the
interferon-induced double-stranded-RNA-dependent protein kinase, PKR,
by stimulating autophosphorylation in vitro. The activated PKR
catalyzed phosphorylation of the alpha subunit of eucaryotic translation initiation factor 2 (eIF2
). The NS1 protein efficiently eliminated the PKR-activating activity of these RNAs by binding to
them. Two mutant NS1 proteins, each harboring a single amino acid
substitution at different regions, exhibited temperature sensitivity in
their RNA binding activity in the mutant virus-infected cell lysates as
well as when they were prepared as fusion proteins expressed in
bacteria. The virus strains carrying these mutant NS1 proteins
exhibited temperature sensitivity in virus protein synthesis at the
translational level, as reported previously, and could not repress the
autophosphorylation of PKR developing during the virus growth, which is
normally suppressed by a viral function(s). As a result, the level of
eIF2 phosphorylation was elevated 2.5- to 3-fold. The defect in
virus protein synthesis was well correlated with the level of
phosphorylation of PKR and eIF2.
| |
INTRODUCTION |
The genome of influenza A virus is
composed of eight RNA segments with negative polarity. RNA segment 8 encodes two overlapping proteins, designated nonstructural protein 1 (NS1) and NS2, which are found abundantly in infected cells (reviewed
in reference 20). The NS2 protein exists also in
virions (32, 41), and the recent assignment of its function
has led to a proposal of a new designation, NEP (26). So far
there is no report indicating the presence of the NS1 protein in the
virus particle. Various RNA binding activities of the NS1 protein have
been reported and correlated to regulation operating at various
posttranscriptional steps (8, 11, 12, 27, 28, 30, 31, 38),
although no NS1 mutant viruses with the predicted phenotype have been
reported. We previously demonstrated that the NS1 protein exhibits two
modes of RNA binding activity (12, 13). One of them is a
strong binding to double-stranded RNA (dsRNA) and a short model genome RNA (mini-vRNA) bearing both 5'- and 3'-terminal common sequences, which are expected to form a panhandle structure (5).
However, the biological functions of these activities remain unknown.
The interferon-induced dsRNA-dependent protein kinase, PKR (for protein
kinase, RNA activated) (also designated DAI, eIF2 kinase, or p68),
is activated during virus growth, phosphorylates the alpha subunit of
eucaryotic translation initiation factor 2 (eIF2), and leads to
inhibition of the translation initiation of the host cell as well as
that of virus, thus contributing to the interferon-mediated antiviral
response (reviewed in references 36 and
40). Many viruses, including influenza virus, have evolved various devices to overcome this host defense mechanism (reviewed in reference 16). Katze et al.
(15) showed that PKR, which is first activated by some viral
RNA products during influenza virus infection, is then suppressed, thus
relieving the translational block exerted on the infected cells. As a
suppressor of the PKR function, they purified a p58 cellular protein,
which represses the phosphorylation of eIF2 by the already-activated PKR (21). Lu et al. (22) have reported that the
NS1 protein can prevent the activation of PKR by binding to the dsRNA
activator, thus suggesting the presence of another mechanism for the
virus to escape the PKR translational block. On the other hand, the RNA
species which activate PKR in influenza virus infection remain elusive,
though they may be dsRNAs of virus origin.
In this study, we showed that the model mini-vRNA as well as the
influenza virus genome RNA (vRNA) with their higher-order structure led
to the activation of PKR in vitro, which was eliminated by
preincubating them with the NS1 protein. We then analyzed two temperature-sensitive (ts) mutants affected in the NS1 gene
to examine the possibility that the protein works as a suppressor of
the activation of PKR in the virus-infected cells.
| |
MATERIALS AND METHODS |
Cells and viruses.
HeLa cells were grown in Eagle's minimal
essential medium (MEM) supplemented with 5% calf serum and were
infected with viruses at 34 or 40°C as previously described
(10). Wild-type influenza virus strain A/Udorn/72 (H3N2
subtype) and the ts mutants SPC45 and ICR1629
(37), which have a point mutation in the NS1 protein (10), were grown in the allantoic cavities of 11-day-old
embryonated chicken eggs for 2 days at 34°C.
Construction of expression plasmids for GST-NS1 fusion
proteins.
The unique BamHI site of the NS1 gene of
strain PR8 was connected to the BamHI site of the pGEX-1
expression vector (Amersham Pharmacia Biotech), providing the
glutathione S-transferase (GST)-NS1 fusion proteins. To
introduce deletions into the NS1 gene, one of the HaeIII
sites and the unique SspI site of the NS DNA were individually connected in frame to two tandem UAA codons of an oligonucleotide linker. The fragment carrying the linker-ligated HaeIII site encodes a truncated NS1 protein containing the
N-terminal 82 amino acid residues (and two extra residues, E and F),
providing NS82, while the fragment carrying the linker-ligated
SspI site gives NS144, containing the N-terminal 144 residues. The plasmids for the NS1 mutant proteins with the inner
residues deleted, NS
(34-39) and NS(50-85) (the numbers in
parentheses indicate the deleted amino acid residues), and those for
the proteins having a point mutation corresponding to SPC45 or ICR1629
NS1s were constructed by in vitro mutagenesis (19) with the
following oligonucleotide primers:
5'GATGCCCCATTCCTTCAGAATCCCTAAG3' for NS(34-39),
5'GGAAGGGGCAGCACTCCTGCGTCGCGTTACC3' for NS(50-85),
5'CCCATGTTGGAAATCAGATAGTAGAG3' for SPC45, and 5'CATCATGTTGAAAACGAATTTCAGTG3' for ICR1629.
Northwestern blotting.
By using the plasmids described
above, the GST-NS1 fusion proteins were induced in Escherichia
coli cells and purified as described previously (39).
Influenza virus-infected HeLa cells were lysed with a lysis-loading
buffer (0.125 M Tris-HCl [pH 6.8], 4.6% sodium dodecyl sulfate
[SDS], 5% 
-mercaptoethanol, 10% glycerol, 0.01% bromphenol
blue). The purified GST fusion proteins (9.5 pmol each) or the
virus-infected HeLa cell lysates were subjected to SDS-polyacrylamide
gel electrophoresis (SDS-PAGE) and electroblotted onto nitrocellulose
membranes (Bio-Rad) as described previously (17) with the
following modifications. After blocking treatment with 5% bovine serum
albumin and 0.1% Tween 20, the membrane was incubated in an RNA
binding buffer (6.6 mM Tris-HCl [pH 7.6], 33 mM KCl, 1 mM EDTA, 1 mM
dithiothreitol, and 0.02% Tween 20) containing 32P-dsRNA
or 32P-mini-vRNA probe (2 × 106 cpm/ml)
(prepared as described previously [12]) and 10 µg
tRNA per ml for 1 h at room temperature or 40°C. After being
washed with the RNA binding buffer, the membrane was processed for
autoradiography. The radioactivity of the binding complex was measured
with a BAS 1000 image analyzer (Fuji film).
Preparation of PKR.
HeLa cells were grown in Eagle's MEM
supplemented with 5% calf serum and were treated with natural beta
interferon (300 U/ml) (Torey) for 24 h at 37°C. From these
cells, the PKR fraction was prepared and further purified by using a
DEAE-cellulose column by a method described previously (35).
Preparation of eIF2.
eIF2 was prepared from rabbit
reticulocytes as described previously (18) with some modifications.
In vitro phosphorylation assay.
Poly(A)-poly(U),
poly(I)-poly(C), and tRNA were from Sigma, while the mini-vRNA
(12) and the virion RNA (10) were prepared as
described previously. Various RNAs were preincubated in the absence or
in the presence of NS1 proteins (0.5 µg) for 30 min at 30°C in a
standard reaction mixture containing 15 mM HEPES (pH 7.5), 63 mM KCl, 3 mM Mg acetate, 1 mM dithiothreitol, and 0.25% Nonidet P-40. ATP (to 10 mM) and [
-32P]ATP (3 to 5 µCi) (Amersham Pharmacia
Biotech) were then added to the mixture, followed by the PKR fraction
(1 µg of protein), to carry out the PKR autophosphorylation reaction
for 20 min at 30°C (final volume of 15 µl) essentially as described
previously (34). To examine eIF2 phosphorylation by PKR
(see Fig. 3), this PKR autophosphorylation reaction was carried out in
the absence of labeled ATP. Thereafter, [-32P]ATP (3 to 5 µCi) and the eIF2 fraction (1 µg of protein) were added to the
reaction mixtures, which were further incubated for 20 min at 30°C.
The phosphorylated proteins were analyzed by SDS-PAGE followed by autoradiography.
In vivo phosphorylation assay.
Confluent monolayers of HeLa
cells in 35-mm-diameter dishes were infected with viruses at a
multiplicity of infection (MOI) of 10 in Eagle's MEM at 34 or 40°C,
and after 1, 3, 4, and 5 h postinfection (p.i.), cells were washed
with a phosphate-free buffer (118 mM NaCl, 4.75 mM KCl, 1.2 mM
MgCl2, 0.26 mM CaCl2, 25 mM NaHCO3,
20 mM HEPES [pH 7.4]) and labeled with [32P]
orthophosphate (500 µCi/ml) (American Radiolabeled Chemicals) in
Dulbecco modified Eagle MEM lacking both phosphate and pyruvate. After
being labeled for 2 h, the cells were washed with
phosphate-buffered saline without Ca2+ and Mg2+
and disrupted by the procedure described previously by Katze et al.
(15). The labeled cell lysates were reacted with a
polyclonal antibody against human PKR (provided by H. Taira, Faculty of
Agriculture, Iwate University) or with a polyclonal antibody against
human eIF2 (C-20) (Santa Cruz Biotech) in the presence of protein
G-Sepharose (Amersham Pharmacia Biotech) for 1 h at room
temperature and then were processed as described previously
(11). The immunoprecipitates were subjected to SDS-PAGE
followed by autoradiography to examine PKR phosphorylation.
Western immunoblotting.
Total cell lysates were separated by
SDS-PAGE. After electrotransfer from the gel to a nitrocellulose
filter, the NS1 protein was reacted with a rabbit polyclonal antibody
against NS1 (11) and detected by the enhanced
chemiluminescence technique (ECL; Amersham Pharmacia Biotech).
| |
RESULTS |
NS1 eliminates the PKR activation induced by various RNAs,
including the mini-vRNA.
The stable panhandle structure of vRNA
with a short stretch of double helix (1) was suspected to
work as an activator of PKR. Therefore, we examined the effect of vRNA
and a short (70-base) mini-vRNA (13) on the PKR
autophosphorylation reaction in vitro. The PKR fraction was prepared
from interferon-treated HeLa cells, and incubated with various RNAs.
The mini-vRNA prepared in vitro activated the PKR autophosphorylation
at a concentration of 1 µg/ml (4.3 × 10
8 M) but
did not do so at 5 µg/ml (2.1 × 107 M) (Fig.
1B, lanes 4 and 5). Similarly,
poly(I)-poly(C) and poly(A)-poly(U) dsRNAs, the commonly used
activators of PKR, activated it at a concentration of 0.1 to 1 µg/ml
(Fig. 1A, lanes 2 and 5) but did not do so at 10 µg/ml (data not
shown). The vRNA isolated from virions activated PKR
autophosphorylation at a concentration of 10 or 34 µg/ml (Fig. 1C,
lanes 4 and 5), which was in the range of the activation concentration
of the mini-vRNA on a molar basis (1.7 × 108 and
6.0 × 108 M, respectively). The mini-vRNA as well
as poly(I)-poly(C) stimulated the phosphorylation of histones (data not
shown) or eIF2 (see Fig. 3, lane 1), the substrates of PKR, which
were added to the autophosphorylation reaction mixture. The mini-vRNA
lost its PKR-activating ability when it was heat denatured or when
either terminal common sequence was removed from it (data not shown).
View larger version (76K):
[in this window]
[in a new window]
|
FIG. 1.
Autophosphorylation of PKR stimulated by various RNAs
and eliminated by preincubation with the NS1 protein. (A) Various RNAs
were preincubated in the absence ( ) or presence (+) of the GST-NS1
protein (0.5 µg) for 30 min at 30°C in the kinase reaction mixture
as indicated above the lane number. ATP and [-32P]ATP
were then added to the mixture, followed by the PKR fraction (1 µg of
protein) for the PKR autophosphorylation reaction as described in
Materials and Methods. The phosphorylated proteins were analyzed by
SDS-10% PAGE. The tested RNAs (1 µg/ml each) were poly(A)-poly(U)
(AU), poly(I)-poly(C) (IC), the mini-vRNA (Min), and tRNA. (B and C)
Increasing amounts of the mini-vRNA (Min) (B) and virion RNA (Vir) (C)
as indicated were preincubated in the absence () or presence (+) of
0.5 µg of GST-NS1 protein. PKR autophosphorylation was examined as
described in for panel A. Migrations of the protein markers (Amersham
Pharmacia Biotech) are indicated on the right of each panel.
|
|
The NS1 protein extinguished the PKR autophosphorylation activated by
vRNA and the mini-vRNA, as well as dsRNAs, when preincubated with them
(Fig. 1B, lanes 7 to 10, and C, lanes 6 to 9, and data not shown). To
investigate the relationship between the extinguishing activity and the
RNA binding ability of NS1, we constructed four GST-NS1 fusion proteins
carrying a deletion mutation in NS1: GST-NS144, GST-NS82,
GST-NS(34-39), and GST-NS(50-84) (see Materials and Methods). The
NS1 regions of these fusion proteins are shown in Fig.
2 (lower panel). Their RNA binding
activities were examined by Northwestern blotting with
32P-labeled dsRNA as the probe (Fig. 2B). GST-NS144 (data
not shown) and GST-NS82 retained the RNA binding activity, but
GST-NS(34-39) and GST-NS(50-84) had lost it (Fig. 2B, lanes 1 to
3, and data not shown). The wild-type GST-NS1 and GST-NS82 inhibited
PKR-catalyzed phosphorylation of eIF2 as well as the PKR
autophosphorylation (Fig. 3, lanes 2 and
3), but the inhibition exerted by GST-NS(50-84) was greatly
diminished for both phosphorylations (Fig. 3, lane 4). These
observations indicated that not only the nuclear localization signal
(amino acid residues 34 to 39) but also residues 50 to 82 of NS1 were
required for the RNA binding and inhibition of PKR activation by these
RNAs, consistent with the results of Qian et al. (29).
View larger version (42K):
[in this window]
[in a new window]
|
FIG. 2.
Structures of NS1 deletion proteins and their RNA
binding abilities. (Lower panel) Structures of NS1 deletion proteins
NS82, NS(34-39), and NS(50-84). The amino acid substitutions in
two ts mutant NS1s are also shown. (A and B) The GST-NS1
fusion proteins were induced in E. coli cells and purified
by using a glutathione-agarose column. Equal molar quantities of the
proteins (9.5 pmol) were subjected to SDS-12% PAGE, and the gel was
stained with Coomassie brilliant blue (A). For Northwestern blotting
(B), proteins in the gel were electroblotted onto a nitrocellulose
membrane and subjected to the RNA binding reaction with a
32P-labeled dsRNA probe as described in Materials and
Methods. Lanes 1, GST-NS82; lanes 2, GST-NS(34-39); lanes 3, GST-NS(50-84); lanes 4, GST protein; lanes 5, GST-NS1 (full length);
lanes 6, GST-NP. Migrations of protein markers (Sigma) are indicated on
the right of panel B.
|
|
View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of the GST-NS1 fusion proteins on PKR-catalyzed
eIF2 phosphorylation. Mini-vRNA (1 µg/ml) was preincubated in the
kinase reaction mixture for 30 min at 30°C without NS proteins (lane
1) or in the presence of GST-wild-type NS1 (lane 2), GST-NS82 (lane
3), GST-NS(50-84) (lane 4), or the GST protein (lane 5). The PKR
autophosphorylation reaction (upper panel) was carried out as described
in the legend to Fig. 1A. For PKR-catalyzed eIF2 phosphorylation
(lower panel), the PKR autophosphorylation reaction was performed as
described above but without addition of the labeled ATP. Thereafter,
[-32P]ATP and eIF2 were added to the reaction
mixtures, which were further incubated for 20 min at 30°C. The
phosphorylated proteins were subjected to SDS-15% PAGE as described
in Materials and Methods. For protein markers on the right, see the
legend to Fig. 1.
|
|
RNA binding ability of ts mutant NS1 proteins.
Previously we identified two ts mutants, SPC45 and ICR1629,
which had single amino acid substitutions in the NS1 protein
(10). We constructed GST-NS1 fusion proteins of each mutant
NS1, and their RNA binding abilities were examined by Northwestern
blotting as described above. Both proteins exhibited the same level of dsRNA binding activity as the wild-type NS1 fusion protein when the
binding reaction was carried out at room temperature (Fig. 4, middle panel, lanes 1 to 3). In
contrast, the binding activity greatly decreased for both mutant
proteins at 40°C (Fig. 4, right panel, lanes 1 to 3).
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 4.
RNA binding abilities of the NS1 ts mutant
proteins. The GST-NS1 fusion proteins for the ts mutant NS1s
(illustrated in Fig. 2) were expressed in E. coli and
purified with a glutathione-agarose column. The temperature
sensitivities of their RNA binding activities were examined by
Northwestern blotting (NW) with 9.5 pmol of each protein as described
in the legend to Fig. 2. The RNA binding reaction was performed with a
32P-labeled dsRNA probe at either room temperature (middle
panel) or 40°C (right panel). The dye-staining pattern of these
proteins is shown (left panel). GST-wild-type NS1, GST-SPC45 NS1,
GST-ICR1629 NS1, and the GST protein were applied to lanes 1, 2, 3, and
4, respectively. For protein markers on the right, see the legend to
Fig. 1.
|
|
Phosphorylation of PKR and eIF2 in cells infected with the NS1
ts mutant viruses.
The above-described observation led
us to examine the phosphorylation levels of PKR and eIF2 and their
relation to the RNA binding activity of NS1 protein in the cells
infected with these mutant viruses. For these experiments, we used HeLa
cells as the virus host, because our PKR antibody could not cross-react
with the canine PKR in MDCK cells, which were the host in the previous work on these ts mutant viruses. The virus production in
HeLa cells at the nonpermissive temperature of 40°C was reduced to 50, <0.5, and 5% of that at 34°C for the wild-type, SPC45, and ICR1629 viruses, respectively. The syntheses of M1 and NS1 proteins at
later times of growth for both mutants greatly decreased at 40°C, in
agreement with the observations for the MDCK cells (10). In
contrast, the synthesis of the nucleoprotein (NP), which was scarcely
affected in MDCK cells for both mutants, was greatly depressed to 10%
in the SPC45-infected HeLa cells but not in the ICR1629-infected cells
(Fig. 5; see Fig. 8D to F).
View larger version (71K):
[in this window]
[in a new window]
|
FIG. 5.
Protein synthesis in virus-infected HeLa cells. Cells
infected with the wild-type, SPC45, and ICR1629 viruses (MOI of 10)
were grown at either 34 or 40°C and labeled with
[35S]methionine (10 µCi/ml) for 30 min beginning from
3, 5, and 6 h p.i., as shown above the panels. For other
experimental details, see reference 10. Lanes m1 and
m2, cells mock infected and labeled during 6 to 6.5 h p.i.
at 34 and 40°C, respectively. Ps, virus polymerase proteins. HA,
hemagglutinin.
|
|
The virus-infected HeLa cells were incubated at 34 or 40°C and
labeled metabolically with [
32P]orthophosphate for 2 h starting from 1, 3, or 5 h p.i. The cell
lysates were prepared
and incubated with the anti-human PKR antibody,
and the resulting
immune complexes were subjected to SDS-PAGE
and autoradiography as
described in Materials and Methods. As
shown in Fig.
6A (also see Fig.
8B),
32P
incorporation into PKR in the cells infected with either of
these
mutant viruses at 34°C, as well as in the wild-type virus-infected
cells at either 34 or 40°C, was at almost the same low level as
in
mock-infected cells during 1 to 7 h p.i. In contrast,
32P in PKR was greatly increased from 3 h p.i. in the
cells infected
with either of these mutant viruses at the nonpermissive
temperature
of 40°C, and more in the SPC45-infected cells than in the
ICR1629-infected
cells (11 and 8 times higher, respectively, during 3 to 5 h p.i.),
consistent with the observation that the former
virus protein
synthesis was more severely depressed than the latter at
40°C.
View larger version (93K):
[in this window]
[in a new window]
|
FIG. 6.
Phosphorylation of PKR and eIF2 in HeLa cells
infected with the ts NS1 mutant viruses. Confluent
monolayers of HeLa cells were infected with the wild-type or
ts mutant viruses (MOI of 10) at either 34 or 40°C,
labeled with [32P]orthophosphate (500 µCi/ml) (ARC) for
2 h, and harvested. Cell lysates were prepared and reacted with
the polyclonal antibody against human PKR (A) or the polyclonal
antibody against human eIF2 (C-20) (1 µg) (B) for 1 h at room
temperature as described in Materials and Methods. The resulting
immunoprecipitates were then analyzed by SDS-PAGE and autoradiography.
(A) Phosphorylation of PKR. The labeling was from 1 to 3 h p.i.
(lanes 1 to 3), from 3 to 5 h p.i. (lanes 3 to 5), and from 5 to
7 h p.i. (lanes 5 to 7), as shown above each panel. Lanes m1 and
m2, cells mock infected and labeled during 5 to 7 h p.i. at 34 and
40°C, respectively. Lane C, 32P-PKR labeled in vitro.
Longer exposures for lanes 5 to 7 and C are shown on the right of the
upper panel (5-7' and C'). For protein markers on the right, see the
legend to Fig. 1. (B) Phosphorylation of eIF2. The viruses were
grown at 34 or 40°C as shown at the top, and the infected cells were
labeled with 32P from 4 to 6 h p.i. The
immunosupernatants of lanes 5 and 6 were treated with the anti-PKR
antibody, and the immunoprecipitates (one-third of total) were analyzed
in lanes 7 and 8, respectively. Lane C1, 32P-labeled
purified PKR and rabbit eIF2.
|
|
The level of
32P labeling in eIF2
was then examined. The
infected cells were labeled for 2 h starting from 4 h p.i.
(which
gave the highest level of the eIF2
labeling). Cell lysates
were
prepared and treated with anti-human eIF2
antibody. The
immunoprecipitates
were analyzed as described above. As shown in Fig.
6B (also see
Fig.
8C),
32P incorporation into eIF2
for
these mutant viruses at 34°C was
at the same level as that for the
wild-type virus at 34 or 40°C.
It was increased from 4 h p.i. in
the cells infected with either
of these mutant viruses at the
nonpermissive temperature of 40°C
(2.9 and 2.3 times more than that
at 34°C for the SPC45 and ICR1629
viruses, respectively). It
decreased in the mutant virus-infected
cells labeled from 5 to 7 h
p.i. at 40°C, probably because the
subunit had already been
phosphorylated at 5 h p.i. and the turnover
of the incorporated
phosphate was slow (data not
shown).
dsRNA binding activity of NS1 in ts
mutant-infected-cell lysates.
The level of dsRNA binding activity
of NS1 protein in mutant virus-infected-cell lysates, which were
prepared 6 h p.i. and separated by SDS-PAGE for Northwestern
blotting as described above, were then examined (Fig.
7A). For estimation of the amount of NS1
protein in the same lysates, increasing amounts were subjected to
SDS-PAGE for ECL immunodetection of NS1 protein with the anti-NS1 antibody. As shown in Fig. 7B, the amounts of NS1 used gave a linear
ECL response. Within this linear range, the amount of NS1 in the
infected-cell lysates was estimated for the mutant and the wild-type
viruses grown at 34 or 40°C, as shown in Fig.
8A. It was greatly reduced for SPC45 even
at 34°C and for both mutants at 40°C. At 6 h p.i., in the
virus-infected-cell lysates grown at 34°C, the amounts of SPC45 and
ICR1629 NS1 proteins were reduced to 30 and 80%, respectively, of the
amount of wild-type NS1, and their RNA binding activities at room
temperature were about 16 and 70%, respectively. When the infected
cells were grown at 40°C, the amounts of both the SPC45 and ICR1629
NS1 proteins in the cell lysates were 25% of the amount of wild-type
NS1, and their RNA binding activities at room temperature were about 15 and 23%, respectively. The RNA binding activities exhibited by these
proteins at room temperature were roughly proportional to their amounts in the cell lysates whether grown at 34 or 40°C. In contrast, the
binding ability of NS1 proteins in these mutant lysates was negligible
when the binding reaction was performed at 40°C. It was thus shown
that the RNA binding activities of these mutant NS1 proteins were also
temperature sensitive in the virus-infected-cell lysates, in agreement
with the observation made for the GST fusion proteins produced in
E. coli (Fig. 4).
View larger version (68K):
[in this window]
[in a new window]
|
FIG. 7.
dsRNA binding activities of NS1 proteins in wild-type-
or ts mutant-infected-cell lysates. The virus-infected cells
(MOI of 10) were grown at either 34 or 40°C and lysed at 6 h
p.i. as described in the legend to Fig. 6 and Materials and Methods.
(A) dsRNA binding activities of NS1 proteins in cell lysates
corresponding to 30 µl of the lysates (300× volume) (3 × 105 cells). Lysates from infected cells grown at either
34°C (lanes 1 to 4) or 40°C (lanes 5 to 8) were subjected to
SDS-PAGE for Northwestern blotting with the 32P-dsRNA probe
as described in the legend to Fig. 2. Lanes 2 and 6, SPC45-infected
cells; lanes 3 and 7, ICR1629-infected cells; lanes 4 and 8, wild-type
virus-infected cells, lanes 1 and 5, mock-infected cells (m1 and m2).
The RNA binding reaction was performed at either room temperature (RT)
or 40°C as indicated on the left. Lanes C and C', 0.6 and 0.15 µg
of purified NS1, respectively. (B) The amounts of NS1 in the cell
lysates were compared. Increasing volumes (1× [0.1 µl of lysate;
103 cells], 2×, and 4×) of the lysates was subjected to
SDS-PAGE for ECL immunodetection of NS1 protein with the anti-NS1
antibody. Lane C, 6 ng of purified NS1.
|
|
View larger version (37K):
[in this window]
[in a new window]
|
FIG. 8.
Quantitation of the results shown in Fig. 5, 6,
and 7. All results shown are derived from at least three separate
experiments and are the averages and standard deviations. (A) Amounts
of NS1 accumulated in the infected cells grown at 34 or 40°C. For
experimental details, see the legend to Fig. 7B. The intensities of the
ECL bands were measured with a microdensitometer (dual-wavelength
flying-spot scanner CS-9000; Shimadzu), and the relative values are
shown, with NS1 in the wild-type lysates 6 h p.i. at 34°C set as
100%. (B to F) Radioactivities of gel bands were measured with a
BAS1000 image analyzer. (B) Phosphorylation of PKR during virus growth.
The radioactivity of the PKR band shown in Fig. 6A is represented as
the relative value, with that of the wild-type virus-infected cells
labeled from 5 to 7 h p.i. at 34°C set as 1.0. (C)
Phosphorylation of eIF2 in virus-infected cells during 4 to 6 h
p.i. (Fig. 6B). The relative values are represented, with the
radioactivity obtained from the wild-type virus-infected cells at
34°C set as 1.0. (D to F) Rates of synthesis of NP (D), M1 (E), and
NS1 (F) (30-min labeling) in the infected cells (Fig. 5), represented
as the relative value, with that of the respective protein in the
wild-type virus-infected cells labeled 6 h p.i. at 34°C set as
100%.
|
|
| |
DISCUSSION |
We have previously shown that the influenza virus NS1 protein
exhibits stable binding to a model mini-vRNA, independently of
temperature, which is very similar to its binding to dsRNA (12,
13). The binding depended on a higher-order structure of the
mini-vRNA. Baudin et al. (1) have analyzed the secondary structure of a model vRNA, the panhandle domain of which is almost identical to ours. Based on their results, we assumed that our mini
vRNA had the same panhandle structure. Hsu et al. (14) have
shown that a panhandle structure is formed by the 5'- and 3'-terminal
nucleotides of the virus ribonucleoprotein (RNP) in the infected cells
as well as in the virions. The mini-vRNA and also vRNA stimulated the
PKR activity at the same level and at the same concentration ranges as
poly(I)-poly(C) or poly(A)-poly(U), the commonly used activators of PKR
in vitro (9, 35) (Fig. 1). It was noteworthy that a dsRNA as
short as 15 bp could effectively activate PKR, in light of the report
showing that dsRNA shorter than 30 bp fails to bind stably to PKR and
does not activate it (23). The bulges or some specific
sequences in the panhandle structure might affect its PKR-stimulating activity.
The NS1 protein and its deletion proteins retaining the RNA binding
ability effectively eliminated the PKR-activating activity of these
panhandle RNAs as well as dsRNAs by interacting with them (Fig. 1 and
2). The RNA species activating PKR in influenza virus infection are
thought to be highly structured viral RNAs or dsRNAs erroneously formed
in the virus replication, with which the NS1 protein may interact and
thereby eliminate their PKR-activating activity (reference
22 and this work). In addition, during the late
phase of virus growth, the replicated vRNAs, with or without internal
deletions, are transported through the nuclear pore to the cytoplasm in
the form of an RNP complex (vRNP) associated with the NP protein and
the viral RNA polymerases. NP could not eliminate the PKR-stimulating
activity of mini-vRNA (our unpublished observations), in keeping with
the observation that it cannot bind to the panhandle structure or to
dsRNA (Fig. 2B) (reference 33 and our unpublished
observations). Therefore, it may be possible that the panhandle
structure of the vRNP complex is exposed in the case of a short supply
of the polymerase proteins and tends to activate PKR in the cytoplasm
especially in the later phase of the virus growth. The NS1 protein may
interact with the panhandle structure and eliminate its PKR activation
ability. Recently, Marion et al. (25) have reported evidence
indicating the interaction of the NS1 protein with viral
transcription-replication complexes in virus-infected cells. We also
obtained similar results (our unpublished observations).
To determine the situation in the influenza virus-infected cells, we
analyzed two ts mutants affected in the NS1 gene, SPC45 and
ICR1629. With both NS1 mutants, the syntheses of two late proteins, the
matrix protein (M1) and hemagglutinin, and also that of the NS1 protein
were greatly reduced at the nonpermissive temperature of 40°C. In
contrast, individual mRNAs, including those for the late proteins,
remained almost at the same levels as those at 34°C, even when the
syntheses of the late proteins and the NS1 protein were severely
reduced (10). As one possible mechanism for these
temperature-sensitive translational defects, we examined the
phosphorylation level of PKR and its relation to the RNA binding
abilities of NS1 proteins of these mutant viruses. At 40°C, the
phosphorylation level of PKR was greatly increased from 3 h p.i.
on the cells infected with these mutant viruses, and more so in
SPC45-infected than in ICR1629-infected cells. The PKR thus activated
led to an elevated phosphorylation level of eIF2, the substrate of
PKR, i.e., 2.5- to 3-fold the level with these mutant viruses at 34°C
or with the wild-type virus at both temperatures, in agreement with
their defect in virus protein synthesis (Fig. 8). The mutant NS1
proteins synthesized in the virus-infected cells, as well as those
produced in E. coli cells as GST fusion proteins, exhibited
temperature sensitivity in their dsRNA binding abilities (Fig. 4 and
7). The amount of SPC45 NS1 in the infected-cell lysates at 5 and
6 h p.i. was reduced to 25 to 30% of that of the NS1 protein in
the wild-type virus-infected cells even when the cells were grown at
34°C, because its synthesis rate and stability were decreased
(10). Yet, such a low level of NS1 could appreciably depress
the activation of PKR. One of the reasons might be the lowered
accumulation of vRNA (one of the candidates for PKR activators) in the
mutant-infected cells (10) and also the underestimation of
the mutant NS1 protein, which is degraded during the preparation of the
cell lysates.
Recently, Egorov et al. (6) have succeeded in obtaining
viruses with large deletions of the C-terminal part of the NS1 protein.
One of these deletion mutants, containing the N-terminal 38 amino
acids, exhibits the normal level of viral protein synthesis and grows
to an high titer in Vero cells. In contrast, it cannot grow in MDCK
cells, in which the level of its M1 protein is greatly reduced. As one
mechanism of the differential virus growth, they suggested a deficiency
in the expression of functional interferons in Vero cells, leading to
lack of PKR induction. The virus with defective NS1 could grow in such cells.
As reported previously, Asn is substituted for Lys(62) in SPC45 NS1,
while Thr is substituted for Ala(132) in ICR1629 NS1 (10).
Both residues are conserved among influenza A viruses. According to the
structure of the N-terminal RNA binding domain of the NS1 protein
recently reported by Chien et al. (2), Lys(62) is located in
helix 3, which is suggested to be one of the RNA binding domains. The
procedure of Chou and Fasman (3) predicts that the
substitution introduces a turn at the helix. This structural change may
bring about unwinding of the helix, leading to instability of the whole
NS1 molecule and temperature sensitivity of its RNA binding ability. As
the N-terminal half of the NS1 protein exhibits the full range of
activities hitherto reported for the full-length NS1 protein (24,
29), it was surprising that the substitution in ICR1629 affected
the RNA binding ability of this protein. In this connection, it is
remarkable that GST-NS82 exhibited a higher RNA binding activity than
the full-length protein (Fig. 2). Somehow, the C-terminal half of the
protein might interfere with the N-terminal RNA binding domain. In the
mutant NS1 protein, the structural changes induced at high temperature
might reinforce the interaction between the two domains, thus
sterically inhibiting the RNA binding or the dimerization of NS1.
Several experiments in vivo have indicated that one functional role of
the NS1 protein is the enhancement of viral mRNA translation, especially that of the late proteins (4, 7, 10, 27). Most of
them have suggested that the NS1 protein enhances the recruitment of
translation factors by interacting with cis-acting elements
on the viral mRNA. Here, we have indicated another role of the NS1
protein in vivo, i.e., the inhibition of PKR activation by binding to
virus RNAs, thus contributing to some part of the translational
enhancement. Moreover, it was indicated that the translational block
exerted by activated PKR in these NS1 mutant-infected cells could not
be relieved by p58 alone, a cellular protein which represses the
phosphorylation of eIF2 by the already-activated PKR
(21).
| |
ACKNOWLEDGMENTS |
We thank K. Shimizu (Nihon University School of Medicine) for
providing the virus strains, H. Taira for donation of anti-human PKR
antibody, and Eiko Sakaguchi for technical assistance.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, Kanazawa University School of Medicine, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934, Japan. Phone: 81 76 265 2175. Fax: 81 76 234 4225. E-mail:
rfukuda{at}med.kanazawa-u.ac.jp.
| |
REFERENCES |
| 1.
|
Baudin, F.,
C. Bach,
S. Cusack, and R. W. H. Ruigok.
1994.
Structure of influenza virus RNP. I. Influenza virus nucleoprotein melts secondary structure in panhandle RNA and exposes the bases to the solvent.
EMBO J.
13:3159-3165.
|
| 2.
|
Chien, C.,
R. Tejero,
Y. Huang,
D. E. Zimmerman,
C. B. Rios,
R. M. Krug, and G. T. Monteilon.
1997.
A novel RNA-binding motif in influenza A virus non-structural protein 1.
Nat. Struct. Biol.
4:891-895[Medline].
|
| 3.
|
Chou, P. Y., and G. D. Fasman.
1978.
Empirical predictions of protein conformation.
Annu. Rev. Biochem.
47:251-276[Medline].
|
| 4.
|
de la Luna, S.,
P. Fortes,
A. Beloso, and J. Ortin.
1995.
Influenza virus NS1 protein enhances the rate of translation initiation of viral mRNA.
J. Virol.
69:2427-2433[Abstract].
|
| 5.
|
Desselberger, U.,
V. R. Racaniello,
J. J. Zazra, and P. Palese.
1980.
The 3' and 5'-terminal sequences of influenza A, B and C virus RNA segments are highly conserved and show partial inverted complementarity.
Gene
8:315-328[Medline].
|
| 6.
|
Egorov, A.,
S. Brandt,
S. Sereinig,
J. Romanova,
B. Ferko,
D. Katinger,
A. Grassauer,
G. Alexandrova,
H. Katinger, and T. Muster.
1998.
Transfectant influenza A viruses with long deletions in the NS1 protein grow efficiently in Vero cells.
J. Virol.
72:6437-6441[Abstract/Free Full Text].
|
| 7.
|
Enami, K.,
T. A. Sato,
S. Nakada, and M. Enami.
1994.
Influenza virus NS1 protein stimulates translation of the M1 protein.
J. Virol.
68:1432-1437[Abstract/Free Full Text].
|
| 8.
|
Fortes, P.,
A. Beloso, and J. Ortin.
1994.
Influenza virus NS1 protein inhibits pre-mRNA splicing and blocks mRNA nucleocytoplasmic transport.
EMBO J.
13:704-712[Medline].
|
| 9.
|
Galabru, J., and A. Hovanessian.
1987.
Autophosphorylation of the protein kinase dependent on double-stranded RNA.
J. Biol. Chem.
262:15538-15544[Abstract/Free Full Text].
|
| 10.
|
Hatada, E.,
M. Hasegawa,
K. Shimizu,
M. Hatanaka, and R. Fukuda.
1990.
Analysis of influenza A virus temperature-sensitive mutants with mutations in RNA segment 8.
J. Gen. Virol.
71:1283-1292[Abstract/Free Full Text].
|
| 11.
|
Hatada, E.,
T. Takizawa, and R. Fukuda.
1992.
Specific binding of influenza A virus NS1 protein to the virus minus-sense RNA in vitro.
J. Gen. Virol.
73:17-25[Abstract/Free Full Text].
|
| 12.
|
Hatada, E., and R. Fukuda.
1992.
Binding of influenza A virus NS1 protein to dsRNA in vitro.
J. Gen. Virol.
73:3325-3329[Abstract/Free Full Text].
|
| 13.
|
Hatada, E.,
S. Saito,
N. Okisio, and R. Fukuda.
1997.
Binding of the influenza virus NS1 protein to model genome RNAs.
J. Gen. Virol.
78:1059-1063[Abstract].
|
| 14.
|
Hsu, M-T.,
J. D. Parvin,
S. Gupta,
M. Krystal, and P. Palese.
1987.
Genomic RNAs of influenza viruses are held in a circular conformation in virions and in infected cells by a terminal panhandle.
Proc. Natl. Acad. Sci. USA
84:8140-8144[Abstract/Free Full Text].
|
| 15.
|
Katze, M. G.,
J. Tomita,
T. Black,
R. M. Krug,
B. Safer, and A. Hovanessian.
1988.
Influenza virus regulates protein synthesis during infection by repressing autophosphorylation and activity of the cellular 68,000-Mr protein kinase.
J. Virol.
62:3710-3717[Abstract/Free Full Text].
|
| 16.
|
Katze, M. G.
1992.
The war against the interferon-induced dsRNA-activated protein kinase: can viruses win?
J. Interferon Res.
12:241-248[Medline].
|
| 17.
|
Kobayashi, M.,
T. Toyoda,
D. M. Adyshev,
Y. Azuma, and A. Ishihama.
1994.
Molecular dissection of influenza virus nucleoprotein: deletion mapping of the RNA binding domain.
J. Virol.
68:8433-8436[Abstract/Free Full Text].
|
| 18.
|
Konieezny, A., and B. Safer.
1983.
Purification of the eukaryotic initiation factor 2-eukaryotic initiation factor 2B complex and characterization of its guanine nucleotide exchange activity during protein synthesis initiation.
J. Biol. Chem.
258:3402-3408[Free Full Text].
|
| 19.
|
Kunkel, T. A.,
J. D. Roberts, and R. A. Zakour.
1987.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Methods Enzymol.
154:367-382[Medline].
|
| 20.
|
Lamb, R. A.
1989.
Genes and proteins of the influenza viruses, p. 1-87.
In
R. M. Krug (ed.), The influenza viruses. Plenum Press, New York, N.Y.
|
| 21.
|
Lee, T. G.,
J. Tomita,
A. G. Hovanessian, and M. G. Katze.
1992.
Characterization and regulation of the 58,000-dalton cellular inhibitor of the interferon-induced, dsRNA-activated protein kinase.
J. Biol. Chem.
267:14238-14243[Abstract/Free Full Text].
|
| 22.
|
Lu, Y.,
M. Wambach,
M. G. Katze, and R. M. Krug.
1995.
Binding of the influenza virus NS1 protein to double-stranded RNA inhibits the activation of the protein kinase that phosphorylates the eIF-2 translation initiation factor.
Virology
214:222-228[Medline].
|
| 23.
|
Manche, L.,
S. R. Green,
C. Schmedt, and M. B. Mathews.
1992.
Interactions between double-stranded RNA regulators and the protein kinase DAI.
Mol. Cell. Biol.
12:5238-5248[Abstract/Free Full Text].
|
| 24.
|
Marion, R. M.,
T. Aragon,
A. Beloso,
A. Nieto, and J. Ortin.
1997.
The N-terminal half of the influenza virus NS1 protein is sufficient for nuclear retention of mRNA and enhancement of viral mRNA translation.
Nucleic Acids Res.
25:4271-4277[Abstract/Free Full Text].
|
| 25.
|
Marion, R. M.,
T. Zurcher,
S. de la Luna, and J. Ortin.
1997.
Influenza virus NS1 protein interacts with viral transcription-replication complexes in vivo.
J. Gen. Virol.
78:2447-2451[Abstract].
|
| 26.
|
O'Neill, R. E.,
J. Talon, and P. Palese.
1998.
The influenza virus NEP (NS2 protein) mediates the nuclear export of viral ribonucleoproteins.
EMBO J.
17:288-296[Medline].
|
| 27.
|
Park, Y. W., and M. G. Katze.
1995.
Translational control by influenza virus.
J. Biol. Chem.
270:28433-28439[Abstract/Free Full Text].
|
| 28.
|
Qian, X.-Y.,
F. Alonso-Capien, and R. M. Krug.
1994.
Two functional domains of the influenza virus NS1 protein are required for regulation of nuclear export of mRNA.
J. Virol.
68:2433-2441[Abstract/Free Full Text].
|
| 29.
|
Qian, X.-Y.,
C.-Y. Chien,
Y. Lu,
G. T. Montelione, and R. M. Krug.
1995.
An amino-terminal polypeptide fragment of the influenza virus NS1 protein possesses specific RNA-binding activity and largely helical backbone structure.
RNA
1:948-956[Abstract].
|
| 30.
|
Qiu, Y., and R. M. Krug.
1994.
The influenza virus NS1 protein is a poly(A)-binding protein that inhibits nuclear export of mRNAs containing poly(A).
J. Virol.
68:2425-2432[Abstract/Free Full Text].
|
| 31.
|
Qiu, Y.,
M. Nemeroff, and R. M. Krug.
1995.
The influenza virus NS1 protein binds to a specific region in human U6-U2 and U6-U4 sn RNA interactions during splicing.
RNA
1:304-316[Abstract].
|
| 32.
|
Richardson, J. C., and R. K. Akkina.
1991.
NS2 protein of influenza virus is found in purified virus and phosphorylated in infected cells.
Arch. Virol.
116:69-80[Medline].
|
| 33.
|
Ruigrok, R. W. H., and F. Baudin.
1995.
Structure of influenza virus ribonucleoprotein particles. II. Purified RNA-free influenza virus ribonucleoprotein forms structures that are indistinguishable from the intact influenza virus ribonucleoprotein particles.
J. Gen. Virol.
76:1009-1014[Abstract/Free Full Text].
|
| 34.
|
Saito, S.
1989.
Possible involvement of virus-induced protein kinase in the antiviral state induced with interferon- against Sindbis virus.
J. Interferon Res.
9:23-34[Medline].
|
| 35.
|
Samuel, C. E.,
G. S. Knutsonk,
M. J. Berry,
J. A. Atwater, and S. R. Lasky.
1986.
Purification of double-stranded RNA-dependent protein kinase from mouse fibroblasts.
Methods Enzymol.
119:499-517[Medline].
|
| 36.
|
Samuel, C. E.
1993.
The eIF2 protein kinases, regulators of translation in eucaryotes from yeasts to humans.
J. Biol. Chem.
268:7603-7606[Free Full Text].
|
| 37.
|
Shimizu, K.,
M. G. Mullinix,
R. M. Chanock, and B. R. Murphy.
1982.
Temperature-sensitive mutants of influenza A/Udorn/72 (H3N2) virus. II. Genetic analysis and demonstration of intrasegmental complementation.
Virology
117:45-61[Medline].
|
| 38.
|
Skorko, R.,
D. F. Summers, and J. M. Galarza.
1991.
Influenza virus in vitro transcription: roles of NS1 and NP proteins in regulating RNA synthesis.
Virology
180:668-677[Medline].
|
| 39.
|
Smith, D. B., and K. S. Johnson.
1988.
Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase.
Gene
67:31-40[Medline].
|
| 40.
|
Staehli, P.
1990.
Interferon-induced proteins and the antiviral state.
Adv. Virus Res.
33:147-200.
|
| 41.
|
Yasuda, J.,
S. Nakada,
A. Kato,
T. Toyoda, and A. Ishihama.
1993.
Molecular assembly of influenza virus: association of the NS2 protein with virion matrix.
Virology
196:249-255[Medline].
|
Journal of Virology, March 1999, p. 2425-2433, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Haye, K., Burmakina, S., Moran, T., Garcia-Sastre, A., Fernandez-Sesma, A.
(2009). The NS1 Protein of a Human Influenza Virus Inhibits Type I Interferon Production and the Induction of Antiviral Responses in Primary Human Dendritic and Respiratory Epithelial Cells. J. Virol.
83: 6849-6862
[Abstract]
[Full Text]
-
Xing, Z., Cardona, C. J., Adams, S., Yang, Z., Li, J., Perez, D., Woolcock, P. R.
(2009). Differential regulation of antiviral and proinflammatory cytokines and suppression of Fas-mediated apoptosis by NS1 of H9N2 avian influenza virus in chicken macrophages. J. Gen. Virol.
90: 1109-1118
[Abstract]
[Full Text]
-
Daher, A., Laraki, G., Singh, M., Melendez-Pena, C. E., Bannwarth, S., Peters, A. H. F. M., Meurs, E. F., Braun, R. E., Patel, R. C., Gatignol, A.
(2009). TRBP Control of PACT-Induced Phosphorylation of Protein Kinase R Is Reversed by Stress. Mol. Cell. Biol.
29: 254-265
[Abstract]
[Full Text]
-
Hale, B. G., Randall, R. E., Ortin, J., Jackson, D.
(2008). The multifunctional NS1 protein of influenza A viruses. J. Gen. Virol.
89: 2359-2376
[Abstract]
[Full Text]
-
Zhu, Q., Yang, H., Chen, W., Cao, W., Zhong, G., Jiao, P., Deng, G., Yu, K., Yang, C., Bu, Z., Kawaoka, Y., Chen, H.
(2008). A Naturally Occurring Deletion in Its NS Gene Contributes to the Attenuation of an H5N1 Swine Influenza Virus in Chickens. J. Virol.
82: 220-228
[Abstract]
[Full Text]
-
Shin, Y.-K., Li, Y., Liu, Q., Anderson, D. H., Babiuk, L. A., Zhou, Y.
(2007). SH3 Binding Motif 1 in Influenza A Virus NS1 Protein Is Essential for PI3K/Akt Signaling Pathway Activation. J. Virol.
81: 12730-12739
[Abstract]
[Full Text]
-
Nallagatla, S. R., Hwang, J., Toroney, R., Zheng, X., Cameron, C. E., Bevilacqua, P. C.
(2007). 5'-Triphosphate-Dependent Activation of PKR by RNAs with Short Stem-Loops. Science
318: 1455-1458
[Abstract]
[Full Text]
-
Burgui, I., Yanguez, E., Sonenberg, N., Nieto, A.
(2007). Influenza Virus mRNA Translation Revisited: Is the eIF4E Cap-Binding Factor Required for Viral mRNA Translation?. J. Virol.
81: 12427-12438
[Abstract]
[Full Text]
-
Newby, C. M., Sabin, L., Pekosz, A.
(2007). The RNA Binding Domain of Influenza A Virus NS1 Protein Affects Secretion of Tumor Necrosis Factor Alpha, Interleukin-6, and Interferon in Primary Murine Tracheal Epithelial Cells. J. Virol.
81: 9469-9480
[Abstract]
[Full Text]
-
Kochs, G., Garcia-Sastre, A., Martinez-Sobrido, L.
(2007). Multiple Anti-Interferon Actions of the Influenza A Virus NS1 Protein. J. Virol.
81: 7011-7021
[Abstract]
[Full Text]
-
Shin, Y.-K., Liu, Q., Tikoo, S. K., Babiuk, L. A., Zhou, Y.
(2007). Influenza A virus NS1 protein activates the phosphatidylinositol 3-kinase (PI3K)/Akt pathway by direct interaction with the p85 subunit of PI3K. J. Gen. Virol.
88: 13-18
[Abstract]
[Full Text]
-
Garcia, M. A., Gil, J., Ventoso, I., Guerra, S., Domingo, E., Rivas, C., Esteban, M.
(2006). Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action. Microbiol. Mol. Biol. Rev.
70: 1032-1060
[Abstract]
[Full Text]
-
Dauber, B., Schneider, J., Wolff, T.
(2006). Double-Stranded RNA Binding of Influenza B Virus Nonstructural NS1 Protein Inhibits Protein Kinase R but Is Not Essential To Antagonize Production of Alpha/Beta Interferon. J. Virol.
80: 11667-11677
[Abstract]
[Full Text]
-
Nakatsu, Y., Takeda, M., Ohno, S., Koga, R., Yanagi, Y.
(2006). Translational Inhibition and Increased Interferon Induction in Cells Infected with C Protein-Deficient Measles Virus. J. Virol.
80: 11861-11867
[Abstract]
[Full Text]
-
Hale, B. G., Jackson, D., Chen, Y.-H., Lamb, R. A., Randall, R. E.
(2006). Influenza A virus NS1 protein binds p85beta and activates phosphatidylinositol-3-kinase signaling. Proc. Natl. Acad. Sci. USA
103: 14194-14199
[Abstract]
[Full Text]
-
Fernandez-Sesma, A., Marukian, S., Ebersole, B. J., Kaminski, D., Park, M.-S., Yuen, T., Sealfon, S. C., Garcia-Sastre, A., Moran, T. M.
(2006). Influenza Virus Evades Innate and Adaptive Immunity via the NS1 Protein.. J. Virol.
80: 6295-6304
[Abstract]
[Full Text]
-
Cardenas, W. B., Loo, Y.-M., Gale, M. Jr., Hartman, A. L., Kimberlin, C. R., Martinez-Sobrido, L., Saphire, E. O., Basler, C. F.
(2006). Ebola Virus VP35 Protein Binds Double-Stranded RNA and Inhibits Alpha/Beta Interferon Production Induced by RIG-I Signaling.. J. Virol.
80: 5168-5178
[Abstract]
[Full Text]
-
Garaigorta, U., Falcon, A. M., Ortin, J.
(2005). Genetic Analysis of Influenza Virus NS1 Gene: a Temperature-Sensitive Mutant Shows Defective Formation of Virus Particles. J. Virol.
79: 15246-15257
[Abstract]
[Full Text]
-
Ong, C. L., Thorpe, J. C., Gorry, P. R., Bannwarth, S., Jaworowski, A., Howard, J. L., Chung, S., Campbell, S., Christensen, H. S., Clerzius, G., Mouland, A. J., Gatignol, A., Purcell, D. F. J.
(2005). Low TRBP Levels Support an Innate Human Immunodeficiency Virus Type 1 Resistance in Astrocytes by Enhancing the PKR Antiviral Response. J. Virol.
79: 12763-12772
[Abstract]
[Full Text]
-
Solorzano, A., Webby, R. J., Lager, K. M., Janke, B. H., Garcia-Sastre, A., Richt, J. A.
(2005). Mutations in the NS1 Protein of Swine Influenza Virus Impair Anti-Interferon Activity and Confer Attenuation in Pigs. J. Virol.
79: 7535-7543
[Abstract]
[Full Text]
-
Stasakova, J., Ferko, B., Kittel, C., Sereinig, S., Romanova, J., Katinger, H., Egorov, A.
(2005). Influenza A mutant viruses with altered NS1 protein function provoke caspase-1 activation in primary human macrophages, resulting in fast apoptosis and release of high levels of interleukins 1{beta} and 18. J. Gen. Virol.
86: 185-195
[Abstract]
[Full Text]
-
Kash, J. C., Basler, C. F., Garcia-Sastre, A., Carter, V., Billharz, R., Swayne, D. E., Przygodzki, R. M., Taubenberger, J. K., Katze, M. G., Tumpey, T. M.
(2004). Global Host Immune Response: Pathogenesis and Transcriptional Profiling of Type A Influenza Viruses Expressing the Hemagglutinin and Neuraminidase Genes from the 1918 Pandemic Virus. J. Virol.
78: 9499-9511
[Abstract]
[Full Text]
-
Jing, X., Cerveny, M., Yang, K., He, B.
(2004). Replication of Herpes Simplex Virus 1 Depends on the {gamma}134.5 Functions That Facilitate Virus Response to Interferon and Egress in the Different Stages of Productive Infection. J. Virol.
78: 7653-7666
[Abstract]
[Full Text]
-
Falcon, A. M., Marion, R. M., Zurcher, T., Gomez, P., Portela, A., Nieto, A., Ortin, J.
(2004). Defective RNA Replication and Late Gene Expression in Temperature-Sensitive Influenza Viruses Expressing Deleted Forms of the NS1 Protein. J. Virol.
78: 3880-3888
[Abstract]
[Full Text]
-
Dauber, B., Heins, G., Wolff, T.
(2004). The Influenza B Virus Nonstructural NS1 Protein Is Essential for Efficient Viral Growth and Antagonizes Beta Interferon Induction. J. Virol.
78: 1865-1872
[Abstract]
[Full Text]
-
Donelan, N. R., Basler, C. F., Garcia-Sastre, A.
(2003). A Recombinant Influenza A Virus Expressing an RNA-Binding-Defective NS1 Protein Induces High Levels of Beta Interferon and Is Attenuated in Mice. J. Virol.
77: 13257-13266
[Abstract]
[Full Text]
-
Unoshima, M., Iwasaka, H., Eto, J., Takita-Sonoda, Y., Noguchi, T., Nishizono, A.
(2003). Antiviral Effects of Geranylgeranylacetone: Enhancement of MxA Expression and Phosphorylation of PKR during Influenza Virus Infection. Antimicrob. Agents Chemother.
47: 2914-2921
[Abstract]
[Full Text]
-
Gonzalez-Lopez, C., Martinez-Costas, J., Esteban, M., Benavente, J.
(2003). Evidence that avian reovirus {sigma}A protein is an inhibitor of the double-stranded RNA-dependent protein kinase. J. Gen. Virol.
84: 1629-1639
[Abstract]
[Full Text]
-
Ludwig, S., Wang, X., Ehrhardt, C., Zheng, H., Donelan, N., Planz, O., Pleschka, S., Garcia-Sastre, A., Heins, G., Wolff, T.
(2002). The Influenza A Virus NS1 Protein Inhibits Activation of Jun N-Terminal Kinase and AP-1 Transcription Factors. J. Virol.
76: 11166-11171
[Abstract]
[Full Text]
-
Wang, X., Basler, C. F., Williams, B. R. G., Silverman, R. H., Palese, P., Garcia-Sastre, A.
(2002). Functional Replacement of the Carboxy-Terminal Two-Thirds of the Influenza A Virus NS1 Protein with Short Heterologous Dimerization Domains. J. Virol.
76: 12951-12962
[Abstract]
[Full Text]
-
Neumann, G., Whitt, M. A., Kawaoka, Y.
(2002). A decade after the generation of a negative-sense RNA virus from cloned cDNA - what have we learned?. J. Gen. Virol.
83: 2635-2662
[Abstract]
[Full Text]
-
Geiss, G. K., Salvatore, M., Tumpey, T. M., Carter, V. S., Wang, X., Basler, C. F., Taubenberger, J. K., Bumgarner, R. E., Palese, P., Katze, M. G., Garcia-Sastre, A.
(2002). Cellular transcriptional profiling in influenza A virus-infected lung epithelial cells: The role of the nonstructural NS1 protein in the evasion of the host innate defense and its potential contribution to pandemic influenza. Proc. Natl. Acad. Sci. USA
99: 10736-10741
[Abstract]
[Full Text]
-
Kim, M.-J., Latham, A. G., Krug, R. M.
(2002). Human influenza viruses activate an interferon-independent transcription of cellular antiviral genes: Outcome with influenza A virus is unique. Proc. Natl. Acad. Sci. USA
99: 10096-10101
[Abstract]
[Full Text]
-
Zhirnov, O. P., Konakova, T. E., Wolff, T., Klenk, H.-D.
(2002). NS1 Protein of Influenza A Virus Down-Regulates Apoptosis. J. Virol.
76: 1617-1625
[Abstract]
[Full Text]
-
Salvatore, M., Basler, C. F., Parisien, J.-P., Horvath, C. M., Bourmakina, S., Zheng, H., Muster, T., Palese, P., Garcia-Sastre, A.
(2002). Effects of Influenza A Virus NS1 Protein on Protein Expression: the NS1 Protein Enhances Translation and Is Not Required for Shutoff of Host Protein Synthesis. J. Virol.
76: 1206-1212
[Abstract]
[Full Text]
-
Bergmann, M., Romirer, I., Sachet, M., Fleischhacker, R., Garcia-Sastre, A., Palese, P., Wolff, K., Pehamberger, H., Jakesz, R., Muster, T.
(2001). A Genetically Engineered Influenza A Virus with ras-Dependent Oncolytic Properties. Cancer Res.
61: 8188-8193
[Abstract]
[Full Text]
-
Samuel, C. E.
(2001). Antiviral Actions of Interferons. Clin. Microbiol. Rev.
14: 778-809
[Abstract]
[Full Text]
-
Schultz-Cherry, S., Dybdahl-Sissoko, N., Neumann, G., Kawaoka, Y., Hinshaw, V. S.
(2001). Influenza Virus NS1 Protein Induces Apoptosis in Cultured Cells. J. Virol.
75: 7875-7881
[Abstract]
[Full Text]
-
Mogensen, T. H., Paludan, S. R.
(2001). Molecular Pathways in Virus-Induced Cytokine Production. Microbiol. Mol. Biol. Rev.
65: 131-150
[Abstract]
[Full Text]
-
Basler, C. F., Reid, A. H., Dybing, J. K., Janczewski, T. A., Fanning, T. G., Zheng, H., Salvatore, M., Perdue, M. L., Swayne, D. E., Garcia-Sastre, A., Palese, P., Taubenberger, J. K.
(2001). From the Cover: Sequence of the 1918 pandemic influenza virus nonstructural gene (NS) segment and characterization of recombinant viruses bearing the 1918 NS genes. Proc. Natl. Acad. Sci. USA
98: 2746-2751
[Abstract]
[Full Text]
-
Wang, X., Li, M., Zheng, H., Muster, T., Palese, P., Beg, A. A., García-Sastre, A.
(2000). Influenza A Virus NS1 Protein Prevents Activation of NF-kappa B and Induction of Alpha/Beta Interferon. J. Virol.
74: 11566-11573
[Abstract]
[Full Text]
-
Basler, C. F., Wang, X., Mühlberger, E., Volchkov, V., Paragas, J., Klenk, H.-D., García-Sastre, A., Palese, P.
(2000). The Ebola virus VP35 protein functions as a type I IFN antagonist. Proc. Natl. Acad. Sci. USA
10.1073/pnas.220398297v1
[Abstract]
[Full Text]
-
Zürcher, T., Marión, R. M., Ortín, J.
(2000). Protein Synthesis Shut-Off Induced by Influenza Virus Infection Is Independent of PKR Activity. J. Virol.
74: 8781-8784
[Abstract]
[Full Text]
-
Talon, J., Horvath, C. M., Polley, R., Basler, C. F., Muster, T., Palese, P., García-Sastre, A.
(2000). Activation of Interferon Regulatory Factor 3 Is Inhibited by the Influenza A Virus NS1 Protein. J. Virol.
74: 7989-7996
[Abstract]
[Full Text]
-
Aragón, T., de la Luna, S., Novoa, I., Carrasco, L., Ortín, J., Nieto, A.
(2000). Eukaryotic Translation Initiation Factor 4GI Is a Cellular Target for NS1 Protein, a Translational Activator of Influenza Virus. Mol. Cell. Biol.
20: 6259-6268
[Abstract]
[Full Text]
-
Bergmann, M., Garcia-Sastre, A., Carnero, E., Pehamberger, H., Wolff, K., Palese, P., Muster, T.
(2000). Influenza Virus NS1 Protein Counteracts PKR-Mediated Inhibition of Replication. J. Virol.
74: 6203-6206
[Abstract]
[Full Text]
-
Gale, M. Jr., Tan, S.-L., Katze, M. G.
(2000). Translational Control of Viral Gene Expression in Eukaryotes. Microbiol. Mol. Biol. Rev.
64: 239-280
[Abstract]
[Full Text]
-
Price, G. E., Gaszewska-Mastarlarz, A., Moskophidis, D.
(2000). The Role of Alpha/Beta and Gamma Interferons in Development of Immunity to Influenza A Virus in Mice. J. Virol.
74: 3996-4003
[Abstract]
[Full Text]
-
Balachandran, S., Roberts, P. C., Kipperman, T., Bhalla, K. N., Compans, R. W., Archer, D. R., Barber, G. N.
(2000). Alpha/Beta Interferons Potentiate Virus-Induced Apoptosis through Activation of the FADD/Caspase-8 Death Signaling Pathway. J. Virol.
74: 1513-1523
[Abstract]
[Full Text]
-
Kaufman, R. J.
(1999). Double-stranded RNA-activated protein kinase mediates virus-induced apoptosis: A new role for an old actor. Proc. Natl. Acad. Sci. USA
96: 11693-11695
[Full Text]
-
Daher, A., Longuet, M., Dorin, D., Bois, F., Segeral, E., Bannwarth, S., Battisti, P.-L., Purcell, D. F., Benarous, R., Vaquero, C., Meurs, E. F., Gatignol, A.
(2001). Two Dimerization Domains in the Trans-activation Response RNA-binding Protein (TRBP) Individually Reverse the Protein Kinase R Inhibition of HIV-1 Long Terminal Repeat Expression. J. Biol. Chem.
276: 33899-33905
[Abstract]
[Full Text]
-
Basler, C. F., Wang, X., Muhlberger, E., Volchkov, V., Paragas, J., Klenk, H.-D., Garcia-Sastre, A., Palese, P.
(2000). The Ebola virus VP35 protein functions as a type I IFN antagonist. Proc. Natl. Acad. Sci. USA
97: 12289-12294
[Abstract]
[Full Text]
Top
Abstract
Introduction
