Previous Article | Next Article 
Journal of Virology, March 1999, p. 2365-2375, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Identification of an Active Reverse Transcriptase
Enzyme Encoded by a Human Endogenous HERV-K Retrovirus
Ben
Berkhout,1,*
Maarten
Jebbink,1 and
Jozsef
Zsíros2
Departments of Human
Retrovirology1 and
Pediatric
Oncology,2 Academic Medical Center,
University of Amsterdam, Amsterdam, The Netherlands
Received 18 September 1998/Accepted 30 November 1998
 |
ABSTRACT |
Of the numerous endogenous retroviral elements that are present in
the human genome, the abundant HERV-K family is distinct because
several members are transcriptionally active and coding for
biologically active proteins. A detailed phylogeny of the HERV-K family
based on the partial sequence of the reverse transcriptase (RT) gene
revealed a high incidence of an intact RT open reading frame within the
HML-2 subgroup of HERV-K elements. In this study, we report the cloning
of six full-length HML-2 RT genes, of which five contain an
uninterrupted open reading frame. The RT enzymes were expressed as
glutathione S-transferase fusion proteins in Escherichia coli, and several HERV-K RT enzymes
demonstrated polymerase as well as RNase H activity. Several
biochemical properties of the RT polymerase were analyzed, including
the template requirements and optimal reaction conditions (temperature,
type of divalent cation). Inspection of the nucleotide sequence of the
HERV-K RT genes demonstrated a mosaic structure, suggesting that a high level of genetic recombination has occurred in this virus family, which
is a hallmark of replication by means of reverse transcription. The
selective pressure to maintain the RT coding potential is illustrated
by the sequence of a particular HERV-K isolate that contains three
1-nucleotide deletions within a small RT segment, thus maintaining the
open reading frame. These combined results may suggest that these
endogenous RT enzymes still have a biological function. It is possible
that the RT activity was involved in the spread of this major class of
retroelements by retrotransposition, and in fact it cannot be excluded
that this retrovirus group is still mobile. The endogenous RT activity
may also have been involved in the shaping of the human genome, e.g.,
by formation of pseudogenes.
| |
INTRODUCTION |
An intrinsic property of the
retroviral replication cycle is the insertion of the
reverse-transcribed viral genome into a chromosome of the host cell.
Infections of germ line cells by exogenous retroviruses will lead to
the stable introduction of new genetic information that is transmitted
vertically to the offspring. Such endogenous retroviruses inhabit the
genomes of all eukaryotes, indicating that such infections have
occurred multiple times. Alternatively, retroviral elements that became endogenous may have remained biologically active, causing intracellular spread by retrotransposition after the initial infection. Over time,
multiple infections and/or reiterative rounds of intracellular transposition can lead to significant expansion of these viral elements
in the host genome. The human genome contains a variety of ancient
endogenous retroviruses (52). Sequence studies imply that
most of these elements are of considerable antiquity, as exemplified by
their coding sequences, which are usually riddled with mutations,
including deletions and in-frame stop codons (5). Nevertheless, the presence of such proviruses might have a variety of
effects on the host. Detrimental effects can be caused by expression of
viral transcripts or by insertional inactivation of important host
genes. On the other hand, endogenous retroviruses may be beneficial for
the host, e.g., by providing resistance to infection by related
exogenous viruses (3). These mechanisms include using the
Env protein of an endogenous virus to block the receptor for an
exogenous virus (the mouse Fv4 gene), using the Gag protein to inhibit
at the postentry level (the Fv1 gene), and using a virus-encoded
protein with superantigen activity to specifically deplete cells that
are the target for an exogenous virus (the sag genes)
(44). Furthermore, these potentially mobile genetic elements
may play a role in the evolution of the host genome by integration,
recombination, duplication, and transposition events. In this study, we
report the cloning and identification of an enzymatically active
reverse transcriptase (RT) enzyme encoded by a human endogenous
retrovirus of the HERV-K family.
The human endogenous retroviruses of the so-called HERV-K family
(36) come closest to being biologically active. This element is relatively abundant, with at least 59 copies per haploid genome (33, 36, 53, 55). Cross-hybridization studies initially revealed nine subgroups (14). More recently, six subgroups
(HML-1 to HML-6) were described with a nucleotide sequence
dissimilarity of approximately 25% for a 244-bp fragment of the RT
gene (33), and this phylogeny could be confirmed for a
larger RT fragment (55). Although the HERV-K element was
first introduced into the human germ line more than 25 million years
ago, as judged from its distribution in different primates (28,
32), several members contain a complete genome with long terminal
repeats and open reading frames encoding Gag, Pol, and Env proteins
(25) and three chromosomes are candidates for harboring a
completely intact HERV-K locus (30, 31). The idea that this
virus group may still be biologically active is further supported by
the finding that several HERV-K elements are transcriptionally active
(1, 34). Perhaps more important, specific enzymatic
activities have been reported for the HERV-K dUTPase, protease, and
endonuclease (15, 20, 45), and we now report data for the
two remaining enzymatic activities, that of the RT polymerase and its
RNase H domain. RT enzyme activity has been found in a variety of
HERV-K-containing biological samples. Viral particles containing an
active RT enzyme have been detected in normal placenta, platelets from
patients with thrombocythemia, culture supernatant of pancreatic cells of diabetic patients, and teratocarcinoma and breast cancer cell lines,
and these particles were reported to contain nucleic acid sequences
belonging to the HERV-K family (6-8, 40, 46, 47). Furthermore, weak RT activity was reported with an HERV-K genome expressed in a recombinant baculovirus system (51). We set
out to clone a functional HERV-K RT enzyme for further biochemical analysis. To do so, we designed PCR primers to amplify the full-length RT gene of members of the HML-2 subgroup, which was previously suggested to contain a significant number of isolates with an intact RT
open reading frame based on the sequence of a partial 600-bp RT
fragment (53). Furthermore, we observed a strong preference for synonymous substitutions within the HERV-K RT open reading frames
(54). In this study, we cloned and sequenced six RT gene fragments of approximately 1,800 bp, and all but one contained a
continuous open reading frame for RT protein. The HERV-K RT enzymes
were expressed as recombinant protein in Escherichia coli, and we measured both RT and RNase H activity for some of the clones. The biological pressure to maintain the HERV-K coding capacity is
further illustrated by the sequence of individual RT clones, in which
multiple insertions and deletions were found within short RT segments,
apparently to restore the RT reading frame. Inspection of the RT gene
sequences revealed that the HERV-K elements have a mosaic genome
structure. This result indicates that these elements were formed by a
process that is recombination prone, which is fully consistent with
amplification by means of reverse transcription. The putative role of
the HERV-K RT enzyme in the shaping of the human genome is discussed.
| |
MATERIALS AND METHODS |
Cloning and sequencing of full-length HERV-K RT genes.
Two
primer sets were used to amplify HERV-K RT genes (Fig.
1). These primers were designed on the
basis of the prototype HERV-K10 sequence (36), which is a
member of the extensive HML-2 subgroup (53). The borders of
the RT gene were estimated by sequence alignment of the HERV-K10
sequence with those of RT genes of a variety of exogenous retroviruses
(results not shown; see also reference 12). A large
(1.8-kb) RT segment was amplified by primers RT-A
(TCAGGATCCAAATCAAGAAAGAGAAGG) and RT-D
(TCAGCGGCCGCTAAGCATGAAGTTCTTGTGC). The second primer set amplifies a shorter RT segment of
approximately 1.7 kb: RT-B
(TCAGGATCCGTAGAGCCTCCTAAACCC) and RT-C
(TCAGCGGCCGCTAAGCATGAAGTTCTTGTGC). The sense and antisense primers contain a BamHI and
NotI restriction enzyme site, respectively (underlined in
the sequences). These sites are not present within the HERV-K10 RT
gene, and they allow the in-frame fusion of the RT open reading frame
with that of the glutathione S-transferase (GST) protein in
the pGEX-4T-1 vector (Pharmacia Biotech). The antisense primers provide
a UAG stop codon (marked in bold in the antisense sequences).
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic of part of the HERV-K genome encompassing the
RT and RNase H domains. This genome structure was originally proposed
by Ono et al. for the prototype HERV-K10 element (36), and
all nucleotide numbers refer to positions in this genome. The protease
gene is in the +1 reading frame compared with RT and ends at stop codon
3915. Thus, a  1 frameshift is expected to occur in the upstream
region to fuse the protease and RT reading frames. The integrase enzyme
(int) is in frame with the RT gene. The protease cleavage sites, which,
by analogy to exogenous retroviruses, will determine the ends of the
mature RT enzyme, are not known. The RT primer sets RT-A plus RT-D and
RT-B plus RT-C (black arrows) were used in this study to amplify
full-length RT genes, and the RT-X1 plus RT-X2 and RT-Y1 through RT-Y3
primers (black arrows) were used to construct N-terminal and C-terminal
deletion variants of the RT enzyme (Fig. 7). The LPQG plus YIDD and
MOP2-5' plus MOP2-3' primer sets shown above the RT gene (grey arrows)
have been used previously to amplify internal RT fragments (24,
33). The sense primers S1 and S2 and the antisense primers AS1
and AS2 (open arrows) were used in this study for sequencing of the
complete RT gene.
|
|
Cellular RNA was isolated from bone marrow mononuclear cells and
converted into cDNA by reverse transcription with random
hexamer
primers and the avian myeloblastosis virus (AMV) RT enzyme
as described
previously (
53). The bone marrow sample used in
this study
was from H6, a patient with common acute lymphoblastic
leukemia, and
was taken for standard diagnostic tests. We suggested
previously that
there is no gross difference in the number and
types of HERV-K elements
expressed in normal and leukemic bone
marrow (
53). The cDNA
was subsequently PCR amplified with the
RT-A plus RT-D and the RT-B
plus RT-C primer sets. The PCR was
performed with 100 µl of PCR
buffer (20 mM Tris-HCl [pH 8.3],
50 mM KCl, 2.5 mM MgCl
2,
0.1 mg of bovine serum albumin per ml)
with 0.5 µl of AmpliTaq (5 U/µl; Perkin-Elmer), 200 ng of each
DNA primer, 1 µl of
deoxynucleoside triphosphate mixture mM (100),
and 1 µl of input cDNA
for 35 cycles (1 min at 95°C, 1 min at
55°C, 2 min at 72°C). The
PCR products were analyzed on Tris-borate-EDTA
1.5% agarose gels and
revealed fragments of the appropriate length
of approximately 1.7 to
1.8 kb. The remainder of the PCR products
were concentrated by ethanol
precipitation and subsequently digested
with
BamHI and
NotI. The fragments were purified over an agarose
gel,
eluted, and ligated into the
BamHI-
NotI-digested
pGEX-4T-1
vector. The ligation mixture was transformed into
E. coli DH5
.
Positive clones were identified by restriction enzyme
digestion
and subsequent sequence
analysis.
The complete sequence of six HERV-K RT genes was analyzed on both
strands with multiple primers on a 373 automated sequencer
(ABI) by
using the dye terminator cycle sequencing protocol. In
addition to the
RT-A through RT-D primers, we used several internal
sequencing primers.
New primers include the sense DNA oligonucleotides
RT-S1
(TTGTCAGACTTTTGTAGG) and RT-S2 (GTTCCAGCAATGGAAAAG)
and
the antisense primers RT-AS-1 (GCTTTTTTACCATCCCTC)
and RT-AS-2
(CATTACCCACAAAACAAAG). Figure
1 gives an
overview of all primers
used in this study and their nucleotide
positions on the HERV-K10
genome. HERV-K RT clone 10.1 was used to
introduce N- and C-terminal
truncations. We used three 5' primers and
four 3' primers to PCR
amplify part of the RT open reading frame. The
5' primers are
RT-B (described above), RT-X1
(TCA
GGATCCCAGTGGCCGCTACCAAAA), and
RT-X2
(TCA
GGATCCATTGAGCCTTCATTCTCG), and the 3'
primers are RT-C
(described above), RT-Y1
(TCA
GCGGCCGCTATAAATTGAATAGCTGGTT),
RT-Y2
(TCA
GCGGCCGCTAATCTTGTAACACTGTAAT),
and RT-Y3
(TCA
GCGGCCGCTAAAATACTGTTAGAGCATT).
Restriction enzyme
sites and stop codons are marked as described
above. Because the
new primers are based on the 10.1 sequence, they may
differ from
the HERV-K10 sequence (e.g., at two positions in RT-X2).
The resulting
DNA fragments were digested with
BamHI and
NotI, whose sites were
encoded by the 5'- and 3'-primer
sequence, respectively. The DNA
fragments were cloned in pGEX-4T1 as
described above. The RT domain
encoded by the different constructs is
schematically depicted
in Fig.
7A.
RT protein expression in E. coli and Western blot
analysis.
An overnight culture of E. coli DH5
harboring one of the pGEX-4T-1 plasmids was diluted 1:10, and 100 ml
was cultured for 2 h at 37°C in brain heart infusion broth.
GST-RT protein expression was induced with 100 µl of 0.1 M
isopropyl-
-D-thiogalactopyranoside (IPTG). The cells
were collected by centrifugation after a 4-h IPTG induction and
resuspended in 1.5 ml of NET-N buffer (100 mM NaCl, 1 mM EDTA, 20 mM
Tris-HCl [pH 8.0], 0.5% Nonidet-P40). The lysate was cleared by
extensive sonication on ice (45-s pulse setting, 50% output microtip).
The cellular debris was removed by centrifugation. The GST-RT fusion
protein was allowed to bind to 25 µl of glutathione-agarose beads
(Sigma; 1:1 suspension in phosphate-buffered saline) at room
temperature for 1 h. The beads were collected by low-speed
centrifugation, washed three times in phosphate-buffered saline, and
incubated for 10 min at room temperature in 25 µl of freshly made
elution buffer (10 mM glutathione in 50 mM Tris-HCl [pH 8.0]). This
elution step was repeated once, and the combined eluate was used either
directly in RT or RNase H assays or brought to 50% glycerol and stored
at 70°C. We used 3 µl of this enzyme preparation in the RT assay
and 0.1, 0.2, and 1.0 µl in the RNase H assay.
Western blotting was performed with the purified GST-RT proteins. The
samples (5 µl of a HERV-K GST-RT preparation) were boiled
in sodium
dodecyl sulfate (SDS) sample buffer, separated on an
SDS-12.5%
polyacrylamide gel, and electrophoretically transferred
to Immobilon
nitrocellulose. The immunoblot was stained with a
GST-specific
monoclonal antibody (anti-GST; Pierce) and developed
by using the
5-bromo-4-chloro-3-indolylphosphate/nitroblue tetrazolium
protocol
(Sigma).
RT and RNase H assays.
The purified GST-RT proteins were
tested for RT activity in a poly(rA)-oligo(dT) assay as described
previously (2). In brief, reaction mixtures contained 60 mM
Tris (pH 7.8), 75 mM KCl, 5 mM MgCl2, 0.1% Nonidet P-40, 1 mM EDTA, 5 µg of poly(rA)7000 per ml, 0.16 µg of
oligo(dT)15 per ml, 4 mM dithiothreitol, and 50 µCi of
[32P]dTTP per ml (3,000 Ci/mmol). In a standard assay, we
used 3 µl of the HERV-K GST-RT preparations and 1 µl of
1:30-diluted human immunodeficiency virus type 1 (HIV-1) GST-RT.
Samples were incubated at 37°C for 2 h. Duplicate 7.5-µl
aliquots were taken after 1 and 2 h and spotted onto DEAE
ion-exchange paper (DE81; Whatman). The filter paper was washed three
times in 5% Na2HPO4 to remove unincorporated
[32P]dTTP and dried after two 96% ethanol washes. The
spots were visualized by autoradiography and quantitated on a
PhosphorImager (Molecular Dynamics). The length distribution of the
cDNA products was analyzed on a 6% polyacrylamide-7.1 M urea
sequencing gel.
The RNase H assay was performed with an internally labeled RNA molecule
that was made in vitro with the T7 RNA polymerase
in the presence of
[
-
32P]UTP. The transcript consists of the HIV-1 leader
sequence and
is fully complementary to the CN1 DNA oligonucleotide. We
mixed
2 µl of RNA transcript (approximately 10 ng) and 0.5 µl of
DNA
oligonucleotide (50 ng) in 9 µl of RT buffer (50 mM Tris-HCl [pH
8.5], 8 mM MgCl
2, 30 mM KCl, 1 mM dithiothreitol) with
0.25 µl
of RNasin (40 U/ml; Boehringer). The samples were incubated
for
1 h at 37°C upon addition of the GST-RT protein (0.1, 0.2, and
1.0 µl). The reaction was stopped by addition of 4 µl of
formamide
sample buffer. The samples were heated at 100°C for 3 min
and
analyzed on a denaturing 6% polyacrylamide-7.1 M urea
gel.
Phylogenetic analyses of nucleic acid and amino acid
sequences.
Nucleotide sequences were either analyzed with the
Clustal program (PC gene software; IntelliGenetics) or the PileUp
program (GCG package). Both programs are based on the method of Higgins and Sharp (16). Clustal permits the alignment of multiple
nucleic acid sequences in three steps: computation of pairwise
similarity scores, construction of a dendrogram, and subsequent
alignment. Similarly, PileUp creates a multiple sequence alignment of a
group of related sequences by using progressive pairwise alignments. We
used standard settings (gap weight, 3.00; gap length weight, 0.10). The
reference strains used in the phylogenetic analysis have the following
accession numbers: STPLU4 = HML-1, AF030038; N8.4 = HML-2,
U87590; P1.3 = HML-3, AF030043; M3.10 = HML-4, AF030046;
N8.4 = HML-2A, U87590; D1.2 = HML-2B, U87595; M3.5 = HML-2C, U87592; P1.4 = HML-2D (which is identical in the small RT
segment to HML2.5 of reference 33); M3.8 = HML-2E, U87587; Stmin2 = HML-2F (which is identical in the small
RT segment to clone HML2.2 of reference 33), and the
prototype HERV-K10, M14123.
Nucleotide sequence accession numbers.
The nucleotide
sequence of six full-length HERV-K RT genes presented in this study
have been deposited in the Genbank database under accession no.
AF080229 (clone 10.1), AF080230 (clone 10.2), AF080231 (clone 10.9),
AF080232 (clone 11.1), AF080233 (clone 11.2), and AF080234 (clone 7.1).
| |
RESULTS |
Cloning of full-length HERV-K RT genes.
Primers were designed
to amplify a complete RT gene on the basis of the nucleotide sequence
of the prototype HERV-K10 isolate, a member of the extensive HML-2
subgroup. Because the exact borders of the protease-RT and RT-integrase
proteins are not known (Fig. 1), we estimated the 5' and 3' ends of the
HERV-K10 RT coding information by alignment with the homologous regions
of several exogenous retroviruses (data not shown; see also reference
12). The complete RT region is expected to be
amplified by the primer set RT-B plus RT-C, but we also amplified a
slightly larger RT fragment with the primer set RT-A plus RT-D (Fig.
1). We restricted this search to the HERV-K elements that are
transcriptionally active, because cellular RNA was used as starting
material. Obviously, transcriptionally inactive genomes may in
principle also be candidates for intact RT genes, but we focused on
expressed HERV-K copies because they are more likely to exhibit a
biological function. Total RNA was isolated from human bone marrow
cells that were demonstrated previously to express numerous members of
the HML-2 subgroup of HERV-K elements (53). The RNA was
converted into cDNA with random primers. This cDNA was subsequently
used for PCR amplification with the two HERV-K10-specific primer sets. Fragments of the expected length were produced by both primer sets and
were cloned into the E. coli expression vector pGEX-4T-1. The upstream primers RT-A and RT-B were designed to fuse the RT gene
in-frame with the GST gene, thus allowing the production of GST-RT
fusion proteins. The downstream primers provided a stop codon to
terminate translation.
We first analyzed the complete nucleotide sequence of three RT genes
obtained with the outer primers (clones 10.1, 10.2, and
10.9), and
three inserts obtained with the inner primer set (clones
7.1, 11.1, and
11.2). All six HERV-K isolates were different from
one another. We
previously estimated that on average one mutation
is generated by the
RT-PCR protocol for a 1,700-bp RT fragment
(
53). Thus,
clones differing by at least two nucleotides are
thought to represent
unique isolates. Strikingly, the new sequences
were also different from
any of the previously reported HERV-K
members, indicating that this
family may be more extended than
was previously estimated. All new
sequences showed the highest
similarity score to the HERV-K10 sequence,
which may not be surprising,
because the PCR primers were based on this
isolate. The similarity
ranged from 93% (clone 10.2), to 95% (clone
10.9) and up to 98%
for all other clones. It is likely that even the
most similar
sequences represent unique HERV-K clones. For instance,
clone
10.1 differs from HERV-K10 at 31 nucleotide positions within the
RT gene. The sequences were analyzed to determine the positions
of the
new isolates in the current HERV-K phylogeny. All six RT
clones belong
to the HML-2 subgroup (Fig.
2A). A more
detailed
comparison with members of the different clusters within the
HML-2
subgroup (
53) revealed that all new RT sequences
belong to the
HML-2A cluster (Fig.
2B). Thus, the six HERV-K RT genes
represent
unique but closely related members of the HML-2A cluster, of
which
HERV-K10 is the prototype member. The result of this specific
PCR
suggests that the HML-2A cluster contains many more members
than was
previously anticipated and that many sequences are closely
related to
the prototype HERV-K10 isolate.
View larger version (7K):
[in this window]
[in a new window]
|
FIG. 2.
Phylogenetic analysis of the HERV-K RT genes. For this
comparison with known HML representatives, we used the 600-bp internal
RT fragment amplified by the MOP-2 primer set (Fig. 1). Sequences were
analyzed with the Clustal program (PC gene package). (A) The novel
isolates described in this study are compared with the prototype
HERV-K10 and members of the HML-1 through HML-4 subgroups
(33). We used the following reference strains: STPLU4
(HML-1), N8.4 (HML-2), P1.3 (HML-3), and M3.10 (HML-4). (B) The new
sequences are compared with HERV-K10 and representative members of the
HML-2 clusters A through F (53). The following
representative clones were used: N8.4 (HML-2A), D1.2 (HML-2B), M3.5
(HML-2C), P1.4 (HML-2D), M3.8 (HML-2E), and Stmin2 (HML-2F). This
analysis unequivocally places all new HERV-K sequences and the HERV-K10
isolate in the HML-2A subgroup.
|
|
The translated RT amino acid sequences are shown in Fig.
3. Some of the conserved RT motifs are
marked, for instance the well-conserved
LPQG motif and the
catalytically important YIDD motif that were
previously used to design
RT-specific primers (see, e.g., Fig.
1). Five of the six HERV-K RT
genes were uninterrupted, testifying
to the apparent conservation of
the RT open reading frame in this
HERV-K subgroup. A premature stop
codon was present in clone 10.2
near the C terminus of the RT protein
(Fig.
3). Obviously, it
cannot be excluded that the single nucleotide
change that creates
this in-frame stop codon was generated during the
RT-PCR procedure.
With five potentially complete HERV-K RT genes in
hand, we set
out to express these enzymes as recombinant protein in
E. coli to test for their activity in polymerase assays.
View larger version (51K):
[in this window]
[in a new window]
|
FIG. 3.
Alignment of the HERV-K RT amino acid sequences. The
prototype HERV-K10 is shown at the top. Dashes indicate amino acids
that are identical to this prototype. Gaps are indicated by dots. The
in-frame stop codon at position 5528 in clone 10.2 is marked by an
asterisk. The conserved LPQG and YIDD motifs are in boldface type.
Numbers refer to the first nucleotide of the respective codons in the
HERV-K10 nucleotide sequence. The nucleotide sequences of the
hypermutated segments of clone 10.2 (starting at position 5192) and
clone 10.1 (position 5240) are shown in detail in Fig. 11. The
prototype HERV-K10 sequence is unique at certain positions, which may
explain the inactivity of the corresponding RT enzyme (see the text for
further details).
|
|
Several HERV-K RT enzymes exhibit RT activity.
The HERV-K RT
enzymes were expressed as GST fusion proteins in E. coli and
purified in a single step with glutathione-agarose beads by a standard
procedure (48). As controls, we expressed and purified the
30-kDa GST domain and an enzymatically active GST-RT fusion of HIV-1
(37). Although reasonable amounts of the GST-RT fusion
proteins were expressed in this system (data not shown), the bulk of
the HERV-K proteins could not be extracted in soluble form, indicating
that this fusion protein is prone to aggregation or formation of
inclusion bodies. Similar but less severe insolubility problems were
encountered for the HIV-1 GST-RT fusion protein. We failed to
significantly optimize the yield of the HERV-K fusion proteins by
adaptation of the culture and/or extraction protocol (e.g., shorter
IPTG induction period, reduced culture temperature, addition of
detergents during extraction). The results of a typical experiment are
presented in Fig. 4. E. coli
cultures (100 ml) were used to prepare a 50-µl stock solution of
purified GST-RT protein, of which 5 µl was analyzed by Western blotting and stained with an anti-GST monoclonal antibody. Whereas the
control GST protein could be isolated in bulk amounts (Fig. 4, lane 3)
and a reasonable yield was obtained for the HIV-1 GST-RT fusion (lane
2), dramatically low yields were apparent for the HERV-K GST-RT fusion
proteins (lanes 4 to 9). The minor differences in migration of the
individual HERV-K proteins on the SDS-gel are consistent with the
length of the cloned RT fragments (primer set RT-A plus RT-D versus
primer set RT-B plus RT-C) and the presence of a premature stop codon
in clone 10.2. Besides a poor yield, we also observed significant
degradation of the GST-RT fusion proteins. In particular, these
proteins seem vulnerable to proteolytic cleavage near the junction of
the GST and RT domains (near the thrombin site encoded by the pGEX-4T-1
vector). This proteolytic activity generates an approximately 30-kDa
GST domain, and it is likely that a separate RT domain is also
produced, but only the former protein could be visualized with the
GST-specific antiserum.
View larger version (62K):
[in this window]
[in a new window]
|
FIG. 4.
Western blot analysis of the HERV-K GST-RT proteins. The
type of HERV-K GST-RT protein that is expressed is indicated at the top
(lanes 4 to 9). As a positive control, we expressed the HIV-1 GST-RT
protein (lane 2). The control pGEX-4T-1 vector produces a large amount
of soluble GST protein (lane 3). Lane 1 contains marker proteins (the
molecular mass in kilodaltons is indicated on the left). The positions
of the 30-kDa GST protein and the approximately 95-kDa GST-RT protein
are indicated on the right. The SDS-12.5% polyacrylamide gel was
electroblotted and stained with an anti-GST monoclonal antibody.
|
|
The purified GST-RT proteins were assayed for RT activity by measuring
dTTP incorporation on a poly(rA)-oligo(dT) template-primer
duplex. The
reaction mixture was incubated at 37°C, and duplicate
samples were
taken after 1 and 2 h. The background activity obtained
with the
GST control sample was subtracted from the incorporation
measured for
the HERV-K GST-RT enzymes. The mean value of the
2-h samples is plotted
in Fig.
5A, but similar results were
measured
for the 1-h samples. Two clones with a large (1.8-kb) RT
insert
(clones 10.1 and 10.9) and one clone with a short (1.7-kb) RT
insert (clone 7.1) demonstrated significant polymerase activity
(Fig.
5A). Three HERV-K RT clones were inactive (clones 10.2,
11.1, and 11.2)
and thus provide additional negative controls.
As a positive control,
we included the RT enzyme of AMV. Inspection
of the amino acid
sequences (Fig.
3) provides some putative explanations
for the apparent
inactivity of some HERV-K RT proteins. For instance,
the RT enzyme of
clone 11.2 is likely to be inactive due to mutation
of the
catalytically important YIDD motif into CIDD, and clone
10.2 may be
inactive due to the presence of the premature stop
codon. The prototype
HERV-K10 RT protein is enzymatically inactive
(
25), which
may be related to the presence of a unique RM-to-HT
amino acid
substitution in the N-terminal domain of this RT enzyme
(Fig.
3).
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Enzyme characteristics of the HERV-K RT polymerase. (A)
Activity of the different HERV-K RT enzymes in a regular
poly(rA)-oligo(dT) assay. Duplicate samples were taken after 1 and
2 h at 37°C. The activity was quantitated with a PhosphorImager,
and background values obtained with the control GST protein were
subtracted. In these RT assays, less than 20% variation was measured
between the duplicate samples. The results of the 2-h incubation are
shown, but similar results were obtained for the 1-h samples. The AMV
RT enzyme (Boehringer; 1 µl of a 1-U/µl stock) was used as a
positive control. (B) dTTP incorporation onto an oligo(dT) primer
annealed to either an RNA or DNA template; poly(rA) versus poly(dA).
The HERV-K enzymes 7.1, 10.1, and 10.9 were compared with HIV-1 GST-RT
and AMV RT. (C and D) Magnesium cation and temperature dependency of
the HERV-K RT enzyme of clone 10.1. This assay was performed with the
poly(rA)-oligo(dT) template primer at 37°C (C) and 5 mM
MgCl2 (D).
|
|
We next tested several characteristics of the HERV-K RT enzyme. First,
we compared dTTP incorporation on RNA and DNA templates
[Fig.
5B,
poly(rA) and poly(dA)]. The HERV-K enzymes were two-
to threefold more
active on the RNA template. This pattern is
consistent with the
behavior of the AMV RT enzyme but differs
from that of the HIV-1 RT
enzyme, which is equally active on these
two templates. A standard RT
assay was performed in the presence
of 5 mM MgCl
2, but some
retroviral RT enzymes are known to be
active in the presence of
Mn
2+ as the divalent cation. However, none of the HERV-K
enzymes demonstrated
polymerase activity in buffers containing
Mn
2+ (not shown). The dose-response curve for
Mg
2+ is illustrated in Fig.
5C and demonstrates an absolute
requirement
for this cation. The temperature optimum of the HERV-K RT
enzyme
was 30 to 37°C (Fig.
5D). A kinetic analysis of this reverse
transcription
reaction is presented in Fig.
6 (right), indicating that the HERV-K
RT
enzyme is relatively stable for up to 4 h at 37°C. A
characteristic
of retroviral RT enzymes is their poor processivity,
which means
that short cDNAs are produced in a single cycle of
polymerization.
To test this, we analyzed some of the cDNA samples on a
denaturing
gel (Fig.
6, left). Indeed, only short cDNAs (less than 20 to
30 nucleotides [nt]) were synthesized by the RT enzymes of HERV-K
(lanes 1 to 3), HIV-1 (lane 5), and AMV (lane 6). The initial
biochemical characterization of this enzyme indicates that it
is very
similar to that of contemporary exogenous retroviruses.
The specific
activity of the HERV-K enzyme appears to be rather
low, which is
consistent with a previous report on the baculovirus-produced
enzyme
(
51). On the basis of GST fusion protein concentrations
as
determined by Western blotting (Fig.
4), we estimate that the
HERV-K
enzyme of clone 10.1 exhibits only 5% of the polymerase
activity of
the HIV-1 enzyme.
View larger version (34K):
[in this window]
[in a new window]
|
FIG. 6.
Kinetics of reverse transcription and processivity the
HERV-K RT enzyme. (Left) HERV-K RT samples of clones 7.1, 10.1, and
10.9 were used in the standard poly(rA)-oligo(dT) assay, and the length
of the cDNA products of the HERV-K RT enzymes was analyzed on a
denaturing sequencing gel (lanes 1 to 3) and compared with the products
of the HIV-1 and AMV RT enzymes (lanes 5 and 6). The GST protein was
used as negative control (lane 4). (Right) Standard RT assay with
clones 7.1, 10.1, and 10.9. Samples were analyzed for dTTP
incorporation at several times up to 4 h. The background values
obtained for the GST control protein were subtracted.
|
|
It is possible that the naturally processed HERV-K RT enzyme, whose N
and C termini are not known, is a more active RT enzyme
than is the
GST-RT protein used in this study. We performed several
additional
experiments to test this. It is possible that the RT
domain is
relatively inactive due to the N-terminal GST extension.
For instance,
such a detrimental effect has been reported in one
study with the HIV-1
RT enzyme (
17), although it could not be
confirmed in
another study (
37). Another RT enzyme of the human
T-cell
leukemia virus type 1 retrovirus was also demonstrated
to be active in
the presence of a N-terminal extension (
39).
We measured no
increase in HERV-K RT activity upon removal of
the N-terminal GST
domain in clone 10.1 by thrombin digestion
(data not shown). To test RT
forms with different N and C termini,
we constructed a nested set of
deletion mutants of RT clone 10.1
(illustrated in Fig.
7A). All truncated RT variants were
expressed
in
E. coli at an extremely low level (Fig.
7B). A
somewhat improved
recovery was apparent for the C-terminally truncated
RT forms
(Fig.
7B, lanes 6 to 9), which may indicate increased protein
stability and/or solubility. However, no increased RT activity
was
measured for these mutants. A modest increase in RT activity
was
measured upon deletion of 36 N-terminal amino acids, but no
further
increase in RT activity was measured upon removal of additional
amino
acids.
View larger version (51K):
[in this window]
[in a new window]
|
FIG. 7.
Deletion mapping of the HERV-K RT domain. (A) The HERV-K
RT gene of clone 10.1, which expresses a relatively active RT enzyme,
was used as the starting material for the generation of a nested set of
5'- and 3'-truncated RT proteins. Indicated are the amino acid
positions, with those of clone 10.1 being arbitrarily set at 1 to 595. The position of the YIDD motif within the catalytic core (positions 192 to 195) and the putative position of the RT-RNase H border are
indicated. (B) The different RT enzymes were expressed in E. coli as GST fusion proteins and visualized by Western blotting
with the GST-specific antiserum. See Fig. 4 for further details. Note
that a different protein marker was used in lane 1. This set of RT
proteins was tested in the poly(rA)-oligo(dT) assay for enzyme
activity. The relative RT activity is listed in panel A, with the
activity of the "full-length" RT clone 10.1 being arbitrarily set
at 1.0.
|
|
The HERV-K RT enzyme has a functional RNase H domain.
Retroviral RT enzymes contain an RNase H domain that degrades the
template RNA after it is copied by the polymerase domain. This activity
is thought to be essential in the intricate process of reverse
transcription (50). The HERV-K10 genome has the potential to
encode a C-terminal RT domain with similarity to RNase H (12, 36). Although the exact borders of this putative RNase H gene are
not known, this domain was included in the PCR strategy (Fig. 1). We
therefore analyzed the RNase H activity of the HERV-K GST-RT proteins
of clones 7.1 and 10.1, which represent the short and long versions of
the biologically active polymerase, respectively. This assay was
performed with an internally labeled RNA transcript to which a
complementary DNA oligonucleotide was annealed (schematic in Fig.
8). Treatment of this RNA-DNA duplex with
the commercially available RNase H of E. coli yielded two
RNA fragments of 139 and 176 nt (Fig. 8, lane 1). Such activity was not
observed with the control GST sample (lanes 2 to 4), and efficient
cleavage was obtained for the HIV-1 GST-RT protein (lanes 5 to 7). Most importantly, we measured low RNase H activity for the HERV-K RT enzyme
of clone 10.1 (lanes 11 to 13). No RNase H activity was demonstrable
for the RT enzyme of clone 7.1 (lanes 8 to 10), which may be related to
the absence of C-terminal amino acids in this clone (Fig. 3). The RNase
H activity measured for the HERV-K GST-RT enzyme of clone 10.1 is much
lower than that of the HIV-1 GST-RT enzyme. These combined results
indicate that this endogenous RT enzyme exhibits low polymerase and
RNase H activities.
View larger version (57K):
[in this window]
[in a new window]
|
FIG. 8.
The HERV-K RT enzyme has RNase H activity. A schematic
of the RNase H assay is indicated at the top of the figure. Cleavage of
the internally labeled 344-nt RNA transcript at the site of the
annealed DNA oligonucleotide will produce a 5'-terminal fragment of 176 nt and a 3'-terminal fragment of 139 nt. The positions of these signals
are indicated in the lower panel, which shows an analysis of the RNA
cleavage products on a denaturing sequencing gel. The mock-treated RNA
is shown in lane 14. We tested increasing amounts (0.1, 0.2, and 1.0 µl) of the GST control (lanes 2 to 4), the HIV-1 GST-RT enzyme (lanes
5 to 7), and the HERV-K 7.1 and 10.1 enzymes (lanes 8 to 10 and 11 to
13, respectively). As a positive control, we used the E. coli RNase H enzyme (Boehringer; 1 µl of 1-U/µl stock)
(lane 1).
|
|
The HERV-K RT gene has a mosaic genome structure due to frequent
recombination.
In the course of this study, we noticed that
phylogenies for the HERV-K sequences differed significantly for the 5'
and 3' parts of the RT gene (Fig. 9B and
C, respectively; analysis of the complete RT gene is shown in Fig. 9A).
The finding of discordant branching orders in the two topologies based
on 5' and 3' sequences prompted us to inspect the actual gene sequences
for signs of recombination. Indeed, the nucleotide sequence of the
HERV-K genes suggested the presence of multiple crossovers. To analyze
this genetic recombination pattern in a more systematic manner, we divided the 1.8-kb RT gene into 15 arbitrary segments around nucleotide positions that differed among the six new HERV-K isolates. Only the
substitutions present in at least two isolates were included, thereby
filtering out mutations that may have been introduced fortuitously
during RT-PCR amplification. These informative nucleotide positions are
shown at the top of Fig. 10 (e.g.,
position 4060, which is C in isolates 10.9, 10.2, and HERV-K10 but T in
the other four isolates), and we subsequently marked the RT segments in an arbitrary manner (see the legend to Fig. 10). This analysis was
performed for all 15 RT segments, and neighboring segments were marked
so that genetic linkages were optimal. The pattern shown in Fig. 10
indicates a mosaic gene structure, suggesting that these sequences were
the subject of multiple recombination events. Such mosaic genomes are
likely to have been formed during reverse transcription, which is known
to be a recombination-prone process (50).
View larger version (9K):
[in this window]
[in a new window]
|
FIG. 9.
The 5' and 3' domains of the HERV-K genes produce a
different phylogeny. A phylogenetic analysis was performed by the
Pileup program (GCG package). The distance along the vertical axis is
proportional to the difference between sequences; the distance along
the horizontal axis has no significance. We analyzed either the
complete RT genes (positions 3929 to 5633) (A), the 5' domains
(positions 4134 to 4313) (B), or the 3' domains (positions 5337 to
5633) (C). Several similarities are apparent; e.g., clone 10.2 is at
the origin of all three trees, but some notable differences in the
branching orders of the trees were observed.
|
|
View larger version (34K):
[in this window]
[in a new window]
|
FIG. 10.
Schematic of the mosaic structure of the HERV-K RT
gene. The HERV-K RT genes were split in segments around the nucleotides
that differ among the isolates. We excluded mutations that were present
in a single isolate, thus filtering out potential sequence errors
introduced in the RT-PCR amplification protocol. The informative
nucleotide positions are indicated at the top. These segments were
arbitrarily marked grey or white (e.g., segment 4060 C is white,
segment 4060 T is grey). We optimized the genetic linkages, starting at
the 3' end, which may explain the absence of crossover sites in the
extreme 3' RT domain (positions 5353 to 5615).
|
|
| |
DISCUSSION |
We describe the identification of a functional RT enzyme encoded
by endogenous retroviruses of the abundant HERV-K family that are
integrated at multiple loci of the human genome. Such RT polymerase
activity may have been instrumental in the evolution of the human
genome, for instance in the formation of pseudogenes. Several candidate
sources of RT activity in human cells have been reported previously. In
addition to both exogenous and endogenous retroviral RTs, at least one
"cellular" form of RT is the telomerase enzyme, an unusual DNA
polymerase with an internal RNA template that encodes a repeat
sequence, which is added to the 3' end of chromosomes (4).
However, telomerase is not active on exogenous templates and is
therefore unlikely to have the properties required for pseudogene
formation. There is convincing evidence that infection of cells with
exogenous retroviruses can result in the formation of pseudogenes,
although such cDNAs have unusual features compared with naturally
occurring pseudogenes (10, 13, 23). Therefore, the focus has
been primarily on endogenous sources of RT activity.
Our results indicate that several members of the extensive HERV-K
endogenous retrovirus family may have provided this RT activity. The
HERV-K virus family has been suggested previously to encode an active
RT enzyme, because polymerase activity was measured in a variety of
biological samples that contain HERV-K-like virion particles (6,
8, 40, 46, 47). Endogenous RT activity has been demonstrated
experimentally in mammalian cells through de novo formation of
pseudogene-like structures (27, 49). By using a newly
developed in vivo assay, it was demonstrated recently that
overexpression of the human endogenous LINE (L1) element yields RT
activity that is able to generate reverse transcripts (11).
It seems possible that both the HERV-K and LINE RT enzymes have played
a role in shaping the human genome during evolution. An argument
against the involvement of the HERV-K RT enzyme in pseudogene formation
is that the RT enzymes of retroviruses prime reverse transcription in a
highly specific manner, with regard to both the type of tRNA primer and
the template RNA (9, 18, 22, 29, 38, 50). Although no
details are currently available on the priming specificity of the
HERV-K RT enzyme, it is unlikely that this endogenous retrovirus will
be significantly different in this respect from the exogenous
counterparts. For instance, the HERV-K RT enzyme is likely to use a
specific tRNALys primer because of the presence of a fully
complementary primer-binding site in the HERV-K genome (36).
The activity of the LINE RT enzyme exhibits no template specificity.
This seems the appropriate characteristic for an enzyme involved in the
copying of random cellular transcripts (11), although there
is also some evidence that particular cellular transcripts are more
prone to pseudogene formation than others (41). Additional
experimentation is required to establish the involvement of the HERV-K
and/or LINE RT enzyme in pseudogene formation.
We and others previously found that purifying or negative selection
seems to operate on the HERV-K genomes. At least in some of the
subgroups, there is a remarkable conservation of the open reading
frames (53, 55), and this result was confirmed in the
present study for the HML-2 RT genes. Furthermore, of the mutations
that are present, a strong prevalence of synonymous nucleotide
substitutions was noted (54). The biological significance of
this retrovirus family is substantiated further by the finding that
multiple members are transcriptionally active. This also holds for the
active RT species identified in this study, which were cloned by an
RT-PCR strategy with cellular RNA as input. The cloning of several
full-length HERV-K RT sequences allowed us to readdress some of the
issues concerning the apparent conservation of these genes. Most
strikingly, we noticed that some HERV-K elements have preserved their
RT-encoding capacity despite the presence of deletions and/or
substitutions that destroy the reading frame. Alignment of the RT
sequence of clone 10.2 with that of HERV-K10 (Fig.
11A) indicates that three 1-nt
deletions are present that are unique for this clone. Whereas any of
the individual mutations would cause a frameshift during translation of
the RT protein, the combination of all three mutations restores the
reading frame and allows the expression of full-length RT with a mutant
8-amino-acid stretch (underlined in Fig. 11A). A somewhat similar
situation is seen in clone 10.1, where a 2-nt insertion is combined
with a 1-nt insertion to restore the RT reading frame, so that only 3 amino acids are read out of frame (Fig. 11B). In general, the identification of an enzymatically active HERV-K RT enzyme may help
define new experiments to test the possible biological function of
HERV-K elements in the host genomes and their contribution to disease
induction. Perhaps most intriguing is the observation that HERV-K virus
expression is induced in the pancreatic islets of diabetes type 1 patients (8), and it was suggested that the viral Env
protein exhibits superantigen activity that may trigger this autoimmune
disease. However, several recent reports put some of these results into
question (21, 26, 35).
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 11.
Multiple insertions and deletions are needed to restore
the RT open reading frame. Part of the HERV-K10 nucleotide and RT amino
acid sequences were compared with those of HERV-K isolate 10.2 (A) and
clone 10.1 (B). (A) RT segment from positions 5186 to 5224. The three
nucleotides deleted in clone 10.2 are marked by triangles in the HERV-K
sequence. An additional T-to-A substitution is underlined. Compared
with all other HERV-K RT genes, translation of clone 10.2 will shift
transiently out of the regular reading frame, producing a unique
8-amino-acid stretch (underlined). (B) For clone 10.1, a shorter RT
segment is shown (positions 5237 to 5249). The positions of a 2-nt
insertion and a 1-nt insertion in the sequences of clone 10.1 are
indicated. This results in a unique 3-amino-acid segment due to
translation in a different reading frame. The complete amino acid
sequences of clones 10.1 and 10.2 are shown in Fig. 3.
|
|
The polymerase and RNase H activities measured with the recombinant
HERV-K GST-RT proteins were very low compared with those of the HIV-1
GST-RT protein. This may reflect the real biological activity of these
endogenous RT enzymes. On the other hand, we analyzed only six RT
enzymes of viruses that belong to the HML-2 subgroup, and it is
possible that more active RT forms are encoded by other HERV-K
elements, for instance in cell types other than the bone marrow cells
used in this study. Furthermore, it cannot be excluded that this enzyme
requires unique reaction conditions for optimal activity. The initial
biochemical analyses suggest that the endogenous RT enzyme is not much
different from that of exogenously replicating retroviruses like AMV or
HIV-1. For instance, HERV-K enzyme has a marked preference for
Mg2+ over Mn2+, which is not surprising because
all retroviral RTs, excluding those from mammalian type C retroviruses,
display such a preference. Nevertheless, this property should not be
used to classify these viruses, because alteration of a single amino
acid in the HIV-1 RT enzyme can result in a loss of the
Mg2+ preference (42). It is possible that the
GST-RT constructs are not optimally active because a suboptimal N- or
C-terminus was chosen in our cloning strategy. To verify this, we
constructed a nested set of N- and C-terminally truncated RT forms of
clone 10.1. Although some increase in RT activity was measured for the 5'-shortened RT forms, no major increase in activity was obtained. We
have also tested whether removal of the N-terminal GST domain did
improve the polymerase properties, but we found no such effect. We did
notice some spontaneous cleavage of the GST-RT proteins at the fusion
site, suggesting that part of the RT protein may have been present in a
GST-free form. It should also be mentioned that only a small inhibitory
effect of the N-terminal GST extension was measured in the context of
the HIV-1 RT enzyme (37) and the human T-cell leukemia virus
type 1 RT enzyme (39).
Inspection of the HERV-K genomic sequences of different HERV-K family
members revealed a high level of intergenic recombination. Initially,
we noticed the lack of congruence in the topologies of phylogenetic
trees constructed for different parts of the RT gene, which suggested
the prevalence of recombination. This was verified by inspection of the
nucleotide sequences. This result suggests that genetic recombination,
a property of the RT enzyme that is observed regularly for contemporary
viruses like HIV-1 (19, 43), is a characteristic of all
retroviruses. Obviously, our results do not tell us when this
recombination occurred. Recombination could have occurred many million
years ago, during the exogenous life cycle of HERV-K precursor viruses.
Alternatively, recombination may have occurred during the spread of
endogenous HERV-K copies by intracellular retrotransposition. Further
experimentation is required to provide more detailed information on the
structure and function of the HERV-K RT enzyme. For instance, it will
be of interest to test whether this "ancient" RT enzyme forms a
dimeric complex, such as is seen for most contemporary RT enzymes
(50).
| |
ACKNOWLEDGMENTS |
We thank Tonja van der Kuyl for critical reading of the
manuscript and P. A. Voûte for support.
This research was sponsored in part by the `Stichting
Kindergeneeskundig Kankeronderzoek' (SKK).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Human Retrovirology, Academic Medical Center, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, P.O. Box 22700, 1100 DE Amsterdam, The Netherlands. Phone: (31-20) 566 4822. Fax: (31-20) 691 6531. E-mail: b.berkhout{at}amc.uva.nl.
| |
REFERENCES |
| 1.
|
Andersson, M.-L.,
P. Medstrand,
H. Yin, and J. Blomberg.
1996.
Differential expression of human endogenous retroviral sequences similar to mouse mammary tumor virus in normal peripheral blood mononuclear cells.
AIDS Res. Hum. Retroviruses
12:833-840[Medline].
|
| 2.
|
Back, N. K. T.,
M. Nijhuis,
W. Keulen,
C. A. B. Boucher,
B. B. Oude Essink,
A. B. P. van Kuilenburg,
A. H. Van Gennip, and B. Berkhout.
1996.
Reduced replication of 3TC-resistant HIV-1 variants in primary cells due to a processivity defect of the reverse transcriptase enzyme.
EMBO J.
15:4040-4049[Medline].
|
| 3.
|
Best, S.,
P. R. Le Tissier, and J. P. Stoye.
1997.
Endogenous retroviruses and the evolution of resistance to retroviral infection.
Trends Microbiol.
5:313-318[Medline].
|
| 4.
|
Blackburn, E. H.
1992.
Telomerases.
Annu. Rev. Biochem.
61:113-130[Medline].
|
| 5.
|
Boeke, J. D., and J. P. Stoye.
1997.
Retrotransposons, endogenous retroviruses, and the evolution of retroelements, p. 343-436.
In
J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 6.
|
Boller, K.,
H. Konig,
M. Sauter,
N. Mueller-Lantzsch,
R. Lower,
J. Lower, and R. Kurth.
1993.
Evidence that HERV-K is the endogenous retrovirus sequence that codes for the human teratocarcinoma-derived retrovirus HTDV.
Virology
196:349-353[Medline].
|
| 7.
|
Boyd, M. T.,
B. Foley, and I. Brodsky.
1997.
Evidence for copurification of HERV-K-related transcripts and a reverse transcriptase activity in human platelets from patients with essential thrombocythemia.
Blood
90:4022-4030[Abstract/Free Full Text].
|
| 8.
|
Conrad, B.,
R. N. Weissmahr,
J. Boni,
R. Arcari,
J. Schupbach, and B. Mach.
1997.
A human endogenous retroviral superantigen as candidate autoimmune gene in type 1 diabetes.
Cell
90:303-313[Medline].
|
| 9.
|
Das, A. T.,
B. Klaver, and B. Berkhout.
1995.
Reduced replication of human immunodeficiency virus type 1 mutants that use reverse transcription primers other than the natural tRNA(3Lys).
J. Virol.
69:3090-3097[Abstract].
|
| 10.
|
Derr, K. L.,
J. N. Strathern, and D. J. Garfinkel.
1991.
RNA-mediated recombination in S. cerevisiae.
Cell
67:355-364[Medline].
|
| 11.
|
Dhellin, O.,
J. Maestre, and T. Heidmann.
1997.
Functional differences between the human LINE retrotransposon and retroviral reverse transcriptases for in vivo mRNA reverse transcription.
EMBO J.
16:6590-6602[Medline].
|
| 12.
|
Doolittle, R. F.,
D.-F. Feng,
M. S. Johnson, and M. A. McClure.
1989.
Origins and evolutionary relationships of retroviruses.
Q. Rev. Biol.
64:1-30[Medline].
|
| 13.
|
Dornburg, R., and H. M. Temin.
1990.
cDNA genes formed after infection with retroviral vector particles lack the hallmarks of natural processed pseudogenes.
Mol. Cell. Biol.
10:68-74[Abstract/Free Full Text].
|
| 14.
|
Franklin, G. C.,
S. Chretien,
I. M. Hanson,
H. Rochefort,
F. E. B. May, and B. R. Westley.
1988.
Expression of human sequences related to those of mouse mammary tumor virus.
J. Virol.
62:1203-1210[Abstract/Free Full Text].
|
| 15.
|
Harris, J. M.,
R. H. Haynes, and E. M. McIntosh.
1997.
A consensus sequence for a functional human endogenous retrovirus K (HERV-K) dUTPase.
Biochem. Cell Biol.
75:143-151[Medline].
|
| 16.
|
Higgins, D. G., and P. M. Sharp.
1989.
Fast and sensitive multiple sequence alignments on a microcomputer.
CABIOS
5:151-153[Abstract/Free Full Text].
|
| 17.
|
Hottiger, M.,
K. Gramatikoff,
O. Georgiev,
C. Chaponnier,
W. Schaffner, and U. Hubscher.
1995.
The large subunit of HIV-1 reverse transcriptase interacts with -actin.
Nucleic Acids Res.
23:736-741[Abstract/Free Full Text].
|
| 18.
|
Isel, C.,
J.-M. Lanchy,
S. F. J. Le Grice,
C. Ehresmann,
B. Ehresmann, and R. Marquet.
1996.
Specific initiation and switch to elongation of human immunodeficiency virus type 1 reverse transcriptase require the post-transcriptional modifications of primer tRNALys3.
EMBO J.
15:917-924[Medline].
|
| 19.
|
Jin, M. J.,
H. Hui,
D. L. Robertson,
M. C. Muller,
F. Barre-Sinoussi,
V. M. Hirsch,
J. S. Allan,
G. M. Shaw,
P. M. Sharp, and B. H. Hahn.
1994.
Mosaic genome structure of simian immunodeficiency virus from West African green monkeys.
EMBO J.
13:2935-2947[Medline].
|
| 20.
|
Kitamura, Y.,
T. Ayukawa,
T. Ishikawa,
T. Kanda, and K. Yoshiike.
1996.
Human endogenous retrovirus K10 encodes a functional integrase.
J. Virol.
70:3302-3306[Abstract].
|
| 21.
|
Lan, M. S.,
A. Mason,
R. Coutant,
Q.-Y. Chen,
A. Vargas,
J. Rao,
R. Gomez,
S. Chalew,
R. Garry, and N. K. Maclaren.
1998.
HERV-K10s and immune-mediated (type 1) diabetes.
Cell
95:14-16[Medline].
|
| 22.
|
Lanchy, J.-M.,
C. Ehresmann,
S. F. J. Le Grice,
B. Ehresmann, and R. Marquet.
1997.
Binding and kinetic properties of HIV-1 reverse transcriptase markedly differ during initiation and elongation of reverse transcription.
EMBO J.
15:7178-7187[Medline].
|
| 23.
|
Levine, K. L.,
B. Steiner,
K. Johnson,
R. Aronoff,
T. J. Quinton, and M. L. Linial.
1990.
Unusual features of integrated cDNAs generated by infection with genome-free retroviruses.
Mol. Carcinog.
10:1891-1900.
|
| 24.
|
Li, M. D.,
T. D. Lemke,
D. L. Bronson, and A. J. Faras.
1996.
Synthesis and analysis of a 640-bp pol region of novel human endogenous retroviral sequences and their evolutionary relationships.
Virology
217:1-10[Medline].
|
| 25.
|
Lower, R.,
J. Lower, and R. Kurth.
1996.
The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences.
Proc. Natl. Acad. Sci. USA
93:5177-5184[Abstract/Free Full Text].
|
| 26.
|
Lower, R.,
R. R. Tonjes,
K. Boller,
J. Denner,
B. Kaiser,
R. C. Phelps,
J. Lower,
R. Kurth,
K. Badenhoop,
H. Donner,
K. H. Usadel,
T. Miethke,
M. Lapatschek, and H. Wagner.
1998.
Development of insulin-dependent diabetes mellitus does not depend on specific expression of the human endogenous retrovirus HERV-K.
Cell
95:11-14[Medline].
|
| 27.
|
Maestre, J.,
T. Tchenio,
O. Dhellin, and T. Heidmann.
1995.
mRNA retrotransposition in human cells: processed pseudogene formation.
EMBO J.
14:595-605.
|
| 28.
|
Mariani-Costantini, R.,
T. Horn, and R. Callahan.
1989.
Ancestry of a human endogenous retrovirus family.
J. Virol.
63:4982-4985[Abstract/Free Full Text].
|
| 29.
|
Marquet, R.,
C. Isel,
C. Ehresmann, and B. Ehresmann.
1995.
tRNAs as primer of reverse transcriptases.
Biochimie
77:113-124[Medline].
|
| 30.
|
Mayer, J.,
E. Meese, and N. Mueller-Lantzsch.
1997.
Multiple human endogenous retrovirus (HERV-K) loci with gag open reading frames in the human genome.
Cytogenet. Cell Genet.
78:1-5[Medline].
|
| 31.
|
Mayer, J.,
E. Meese, and N. Mueller-Lantzsch.
1997.
Chromosomal assignment of human endogenous retrovirus K (HERV-K) env open reading frames.
Cytogenet. Cell Genet.
79:157-161[Medline].
|
| 32.
|
Mayer, J.,
E. Meese, and N. Mueller-Lantzsch.
1998.
Human endogenous retrovirus K homologous sequences and their coding capacity in old world primates.
J. Virol.
72:1870-1875[Abstract/Free Full Text].
|
| 33.
|
Medstrand, P., and J. Blomberg.
1993.
Characterization of novel reverse transcriptase encoding human endogenous retroviral sequences similar to type A and type B retroviruses: differential transcription in normal human tissues.
J. Virol.
67:6778-6787[Abstract/Free Full Text].
|
| 34.
|
Medstrand, P.,
M. Linderskog, and J. Blomberg.
1992.
Expression of human endogenous retroviral sequences in peripheral blood mononuclear cells of healthy individuals.
J. Gen. Virol.
73:2463-2466[Abstract/Free Full Text].
|
| 35.
|
Murphy, V. J.,
L. C. Harrison,
W. A. Rudert,
P. Luppi,
M. Trucco,
A. Fierabracci,
P. A. Biro, and G. F. Bottazzo.
1998.
Retroviral superantigens and type 1 diabetes mellitus.
Cell
95:9-11[Medline].
|
| 36.
|
Ono, M.,
T. Yasunaga,
T. Miyata, and H. Ushikubo.
1986.
Nucleotide sequence of human endogenous retrovirus genome related to the mouse mammary tumor virus genome.
J. Virol.
60:589-598[Abstract/Free Full Text].
|
| 37.
|
Oude Essink, B. B.,
N. K. T. Back, and B. Berkhout.
1997.
Increased polymerase fidelity of the 3TC-resistant variants of HIV-1 reverse transcriptase.
Nucleic Acids Res.
25:3212-3217[Abstract/Free Full Text].
|
| 38.
|
Oude Essink, B. B.,
A. T. Das, and B. Berkhout.
1996.
HIV-1 reverse transcriptase discriminates against non-self tRNA primers.
J. Mol. Biol.
264:243-254[Medline].
|
| 39.
|
Owen, S. M.,
R. B. Lal, and R. A. Ikeda.
1998.
Cloning and expression of a human T-lymphotropic virus type 1 protein with reverse transcriptase activity.
J. Virol.
72:5279-5284[Abstract/Free Full Text].
|
| 40.
|
Patience, C.,
G. R. Simpson,
A. A. Colletta,
H. M. Welch,
R. A. Weiss, and M. T. Boyd.
1996.
Human endogenous retrovirus expression and reverse transcriptase activity in the T47D mammary carcinoma cell line.
J. Virol.
70:2654-2657[Abstract].
|
| 41.
|
Piechaczyk, M.,
J. M. Blanchard,
S. R. E. Sabouty,
S. Dani,
L. Marty, and P. Jeanteur.
1984.
Unusual abundance of vertebrate glyceraldehyde-3-phosphate dehydrogenase pseudogenes.
Nature
312:469-470[Medline].
|
| 42.
|
Prasad, V. R.,
I. Lowy,
T. Santos de los,
L. Chiang, and S. P. Goff.
1991.
Isolation and characterization of a dideoxyguanosine triphosphate-resistant mutant of human immunodeficiency virus reverse transcriptase.
Proc. Natl. Acad. Sci. USA
88:11363-11367[Abstract/Free Full Text].
|
| 43.
|
Robertson, D. L.,
B. H. Hahn, and P. M. Sharp.
1995.
Recombination in AIDS viruses.
J. Mol. Evol.
40:249-259[Medline].
|
| 44.
|
Rosenberg, N., and P. Jolicoeur.
1997.
Retroviral pathogenesis, p. 475-586.
In
J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 45.
|
Schommer, J. C.,
M. Sauter,
H. G. Krausslich,
B. Best, and N. Mueller-Lantzsch.
1996.
Characterization of the human endogenous retrovirus K proteinase.
J. Gen. Virol.
77:375-379[Abstract/Free Full Text].
|
| 46.
|
Seifarth, W.,
H. Skladny,
F. Krieg-Schneider,
A. Reichert,
R. Hehlmann, and C. Leib-Mosch.
1995.
Retrovirus-like particles released from the human breast cancer cell line T47-D display type B- and C-related endogenous retroviral sequences.
J. Virol.
69:6408-6416[Abstract].
|
| 47.
|
Simpson, G. R.,
C. Patience,
R. Lower,
R. R. Tonjes,
H. D. M. Moore,
R. A. Weiss, and M. T. Boyd.
1996.
Endogenous D-type (HERV-K) related sequences are packaged into retroviral particles in the placenta and possess open reading frames for reverse transcriptase.
Virology
222:451-456[Medline].
|
| 48.
|
Smith, D. B., and K. S. Johnson.
1988.
Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase.
Gene
67:31-40[Medline].
|
| 49.
|
Tchenio, T.,
E. Segal-Bendirdjian, and T. Heidmann.
1993.
Generation of processed pseudogenes in murine cells.
EMBO J.
12:1487-1497[Medline].
|
| 50.
|
Telesnitsky, A., and S. P. Goff.
1997.
Reverse transcriptase and the generation of retroviral DNA, p. 121-160.
In
J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 51.
|
Tonjes, R. R.,
K. Boller,
C. Limbach,
R. Lugert, and R. Kurth.
1997.
Characterization of human endogenous retrovirus type K virus-like particles generated from recombinant baculovirus.
Virology
233:280-291[Medline].
|
| 52.
|
Wilkinson, D. A.,
D. L. Mager, and J.-A. Leong.
1994.
Endogenous human retroviruses, p. 465-535.
In
J. A. Levy (ed.), The Retroviridae. Plenum Press, New York, N.Y.
|
| 53.
|
Zsíros, J.,
M. F. Jebbink,
V. V. Lukashov,
P. A. Voûte, and B. Berkhout.
1998.
Evolutionary relationships within a subgroup of HERV-K-related human endogenous retroviruses.
J. Gen. Virol.
79:61-70[Abstract].
|
| 54.
|
Zsíros, J.,
M. F. Jebbink,
V. V. Lukashov,
P. A. Voûte, and B. Berkhout.
1999.
Biased nucleotide composition of the genome of HERV-K-related endogenous retroviruses and its evolutionary implications.
J. Mol. Evol.
48:102-111[Medline].
|
| 55.
|
Zsíros, J.,
M. F. Jebbink,
P. A. Voûte, and B. Berkhout.
1998.
Identification of novel human endogenous retroviral sequences belonging to the HERV-K family.
AIDS Res. Hum. Retroviruses
14:1093-1098[Medline].
|
Journal of Virology, March 1999, p. 2365-2375, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Voisset, C., Weiss, R. A., Griffiths, D. J.
(2008). Human RNA "Rumor" Viruses: the Search for Novel Human Retroviruses in Chronic Disease. Microbiol. Mol. Biol. Rev.
72: 157-196
[Abstract]
[Full Text]
-
Flockerzi, A., Burkhardt, S., Schempp, W., Meese, E., Mayer, J.
(2005). Human Endogenous Retrovirus HERV-K14 Families: Status, Variants, Evolution, and Mobilization of Other Cellular Sequences. J. Virol.
79: 2941-2949
[Abstract]
[Full Text]
-
Sawyer, S. L., Wu, L. I., Emerman, M., Malik, H. S.
(2005). Positive selection of primate TRIM5{alpha} identifies a critical species-specific retroviral restriction domain. Proc. Natl. Acad. Sci. USA
102: 2832-2837
[Abstract]
[Full Text]
-
Lavie, L., Kitova, M., Maldener, E., Meese, E., Mayer, J.
(2005). CpG Methylation Directly Regulates Transcriptional Activity of the Human Endogenous Retrovirus Family HERV-K(HML-2). J. Virol.
79: 876-883
[Abstract]
[Full Text]
-
Seifarth, W., Frank, O., Zeilfelder, U., Spiess, B., Greenwood, A. D., Hehlmann, R., Leib-Mosch, C.
(2005). Comprehensive Analysis of Human Endogenous Retrovirus Transcriptional Activity in Human Tissues with a Retrovirus-Specific Microarray. J. Virol.
79: 341-352
[Abstract]
[Full Text]
-
Bannert, N., Kurth, R.
(2004). Retroelements and the human genome: New perspectives on an old relation. Proc. Natl. Acad. Sci. USA
101: 14572-14579
[Abstract]
[Full Text]
-
Lavie, L., Medstrand, P., Schempp, W., Meese, E., Mayer, J.
(2004). Human Endogenous Retrovirus Family HERV-K(HML-5): Status, Evolution, and Reconstruction of an Ancient Betaretrovirus in the Human Genome. J. Virol.
78: 8788-8798
[Abstract]
[Full Text]
-
Somerville, L., Krynetski, E. Y., Krynetskaia, N. F., Beger, R. D., Zhang, W., Marhefka, C. A., Evans, W. E., Kriwacki, R. W.
(2003). Structure and Dynamics of Thioguanine-modified Duplex DNA. J. Biol. Chem.
278: 1005-1011
[Abstract]
[Full Text]
-
Olivares, M., Garcia-Perez, J. L., Thomas, M. C., Heras, S. R., Lopez, M. C.
(2002). The Non-LTR (Long Terminal Repeat) Retrotransposon L1Tc from Trypanosoma cruzi Codes for a Protein with RNase H Activity. J. Biol. Chem.
277: 28025-28030
[Abstract]
[Full Text]
-
Greenwood, A. D., Lee, F., Capelli, C., DeSalle, R., Tikhonov, A., Marx, P. A., MacPhee, R. D. E.
(2001). Evolution of Endogenous Retrovirus-like Elements of the Woolly Mammoth (Mammuthus primigenius) and its Relatives. Mol Biol Evol
18: 840-847
[Abstract]
[Full Text]
-
Ericsson, T., Oldmixon, B., Blomberg, J., Rosa, M., Patience, C., Andersson, G.
(2001). Identification of Novel Porcine Endogenous Betaretrovirus Sequences in Miniature Swine. J. Virol.
75: 2765-2770
[Abstract]
[Full Text]
-
Bieda, K., Hoffmann, A., Boller, K.
(2001). Phenotypic heterogeneity of human endogenous retrovirus particles produced by teratocarcinoma cell lines. J. Gen. Virol.
82: 591-596
[Abstract]
[Full Text]
-
Tonjes, R. R., Czauderna, F., Kurth, R.
(1999). Genome-Wide Screening, Cloning, Chromosomal Assignment, and Expression of Full-Length Human Endogenous Retrovirus Type K. J. Virol.
73: 9187-9195
[Abstract]
[Full Text]
Top
Abstract
Introduction
