Previous Article | Next Article 
Journal of Virology, March 1999, p. 2359-2364, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Alterations to both the Primary and Predicted
Secondary Structure of Stem-Loop IIIc of the Hepatitis C Virus 1b
5' Untranslated Region (5'UTR) Lead to Mutants Severely
Defective in Translation Which Cannot Be Complemented in
trans by the Wild-Type 5'UTR Sequence
Shixing
Tang,
Adam J.
Collier, and
Richard M.
Elliott*
Institute of Virology, University of Glasgow,
Glasgow G11 5JR, Scotland, United Kingdom
Received 1 September 1998/Accepted 8 December 1998
 |
ABSTRACT |
Cap-independent translation of the hepatitis C virus (HCV) genomic
RNA is mediated by an internal ribosome entry site (IRES) within the 5'
untranslated region (5'UTR) of the virus RNA. To investigate the
effects of alterations to the primary sequence of the 5'UTR on IRES
activity, a series of HCV genotype 1b (HCV-1b) variant IRES elements
was generated and cloned into a bicistronic reporter construct. Changes
from the prototypic HCV-1b 5'UTR sequence were identified at various
locations throughout the 5'UTR. The translation efficiencies of these
IRES elements were examined by an in vivo transient expression assay in
transfected BHK-21 cells and were found to range from 0.4 to 95.8% of
the activity of the prototype HCV-1b IRES. Further mutational analysis
of the three single-point mutants most severely defective in activity, whose mutations were all located in or near stem-loop IIIc,
demonstrated that both the primary sequence and the maintenance of base
pairing within this stem structure were critical for HCV IRES function. Complementation studies indicated that defective mutants containing either point mutations or major deletions within the IRES elements could not be complemented in trans by a wild-type IRES.
 |
INTRODUCTION |
Hepatitis C virus (HCV) is a
single-stranded, positive-sense RNA virus that is the main causative
agent of posttransfusion non-A, non-B viral hepatitis worldwide.
Infection with HCV frequently leads to chronic hepatitis and cirrhosis
and is associated with the development of hepatocellular carcinoma. The
genome of HCV contains approximately 9,500 nucleotides (nt), including
highly conserved untranslated regions (UTRs) at both the 5' and 3'
termini. The single large open reading frame encodes a polyprotein of
3,010 to 3,037 amino acids which is processed by cellular and viral proteases to produce the structural and nonstructural proteins (10). Based on phylogenetic analysis, it has been proposed
that HCV be classified into six major genotypes, designated 1 to 6, and
subdivided into subtypes a, b, c, etc. (21, 22). HCV
has recently been placed into a separate genus,
Hepacivirus, within the family Flaviviridae.
The HCV 5'UTR ranges in length from 332 to 343 nt and contains up to
five AUG codons, depending on the HCV genotype or subtype (2). The sequence is highly conserved (25) and is
predicted to fold into a complex secondary structure encompassing
multiple stem-loops and an RNA pseudoknot (Fig.
1) (for a review, see reference 13). It is now clear that translation of the HCV
open reading frame is initiated by a cap-independent internal ribosome
entry mechanism mediated by an internal ribosome entry site (IRES)
situated within the 5'UTR (28, 30).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Predicted secondary structure of the HCV 5'UTR based on
the structures of Brown et al. (1) and Honda et al.
(9). Stem-loop structures are labelled for reference. The
sequence shown is that of the prototypic genotype 1b 5'UTR
(14). Mutations described in the text are shown in
boldface.
|
|
Comparison of different 5'UTR sequences from natural isolates of HCV
serves to confirm the predicted secondary structure proposed by Brown
et al. (1) and Honda et al. (9) and indicates
that in addition to the primary sequence, the secondary and tertiary structures are also highly conserved in order to maintain the correct
functioning of the IRES (3, 4, 12, 28). However, the role of
the primary sequence and the sensitivity of different regions of the
IRES to mutagenesis have yet to be fully elucidated (13).
This information may well be important in predicting the mechanisms by
which translation is initiated.
In this study, a series of clones containing point mutations and large
deletions within the 5'UTR of HCV type 1b (HCV-1b) was generated and
sequenced. By using a bicistronic luciferase reporter system
(4), the abilities of different isolates of HCV to initiate
translation of the downstream reporter were assessed. Our results show
that mutations in the IRES of HCV cause a range of effects, depending
on their location, with the region around stem-loop IIIc (Fig. 1) being
particularly sensitive to alterations in the predicted secondary
structure. None of these mutants could be complemented in
trans by the wild-type (wt) IRES of HCV-1b.
 |
MATERIALS AND METHODS |
Plasmids.
DNA manipulations were performed by standard
methods (20). Plasmid DNA was purified with a plasmid
miniprep kit (Qiagen). The bicistronic vector pRL was described
previously (4) and encodes renilla luciferase (RLUC) and
firefly luciferase (FFLUC) under the control of a T7 promoter. HCV-1b
IRES fragments were inserted into the unique BamHI site of
the pRL vector (Fig. 2). A T7 terminator
sequence was amplified by PCR with primer pair T7F
(5'CCGTCTAGAAGCTGAGTTGGCTGCTG3') and T7B
(5'GAGCTGCAGCATCCGGATATAGTTCCTC3'), using plasmid pT7ribo
(6) as a template. The PCR product was digested with
XbaI-PstI and inserted into similarly digested
pHCV1b to produce pHCV1bS (Fig. 2). The monocistronic plasmid
pHCV1bCAT was derived from plasmid pSGNTR (a gift from G. Lounsbach) and contained the chloramphenicol acetyltransferase (CAT)
gene fused to the HCV-1b IRES (Fig. 2).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
Structures of the plasmids transfected into
vTF7-3-infected cells. The two luciferase reporter genes are indicated.
The HCV RNA sequences are shown as open boxes. Restriction enzyme
cleavage sites used for DNA manipulation are indicated over the cDNAs.
T7, T7 promoter sequence; T7 , T7 terminator sequence; c, core
sequence.
|
|
Isolation of HCV cDNAs.
HCV RNA was isolated from sera of
Chinese blood donors who had previously been confirmed to be infected
with HCV-1b (27) by the use of a QIAamp viral RNA kit
(Qiagen) as directed by the manufacturer. The extracted RNA was reverse
transcribed, using antisense primer AC8
(5'CCGACGCTGCAGATGTACCCCATGAG3') and avian myeloblastosis
virus reverse transcriptase (Promega) as previously described
(4). The entire 5'UTR plus the first 15 nt of the coding
region (nt 1 to 356) was amplified by PCR with sense primer AC5
(5'TTGCTGGATCCGGCGACACTCCACCAT3') and antisense primer AC6 (5'AGCAAGGATCCAGGATTCGTGCTCATGGTGC3'), using Taq
DNA polymerase (Gibco-BRL). The PCR involved 30 cycles of heating at
94°C for 45 s, 58°C for 30 s, and 72°C for 1 min. The
resulting PCR products were digested with BamHI and
subsequently cloned into pTZ18R by standard procedures. Twenty positive
recombinant clones were sequenced by the dideoxy-mediated chain
termination method and by automated sequencing on an ABI Prism 377 DNA
sequencer (Perkin-Elmer).
Mutagenesis of the HCV IRES.
Random mutations were
introduced into the HCV 5'UTR in plasmid pHCV1b by high-cycle PCR as
described by van der Velden et al. (29), using primer pair
AC5-AC6. After a total of 55 cycles of amplification, PCR products were
digested with BamHI, cloned into similarly digested pTZ18R,
and sequenced as described above. For PCR-based site-directed
mutagenesis, two sets of reactions were performed, the first with
primer pairs AC5-primer 1 and AC6-primer 2 (Table
1), using the appropriate construct as a
template, and the second with the two gel-purified PCR products from
the first reaction and primers AC5 and AC6. The sequences of these
cDNAs were confirmed and then subcloned into the pRL vector. Deletion mutant
5-20, which lacks domain I of the 5'UTR, was constructed by
PCR amplification with primer pairs AC6 and AC5-20
(5'TTGCTGGATCCGCCAGACACTCCACCATAGATCACTC3'), using pHCV1b as
a template. Again, the amplified fragments were cloned, sequenced, and
subcloned into the pRL vector. Deletion mutant
1-62 was generated
by PCR amplification with 10 ng of pHCV1b as the template and 50 pmol
each of primers AC5B (5'TTCACGCAGAAAGCGTCTAG) and AC6.
Deletion mutant
57-83 was constructed by deletion of the sequence
between the BbsI and NcoI sites followed by
blunt-end repair of the vector and religation of the two ends.
Likewise, mutants
165-287 and
132-317 were created by deletion
of the sequence between the RsaI or SmaI
restriction sites, respectively.
Transient expression assay.
The transient expression assay
used in this study was described previously (4). Briefly,
subconfluent monolayers of BHK-21 cells in 6-well plates were infected
with vTF7-3, a vaccinia virus expressing T7 RNA polymerase
(7) (obtained from B. Moss, National Institutes of Health),
at 5 PFU/cell in 300 µl of serum-free medium (OptiMEM; Gibco-BRL) for
30 min at 37°C. The inoculum was removed, and the cells were washed
once with OptiMEM. The cells were then transfected with plasmid DNA in
500 µl of OptiMEM containing 15 µl of liposomes prepared as
described by Rose et al. (19). Following a 2-h incubation at
37°C, 1 ml of growth medium was added to each of the wells. The cells
were harvested 16 h later and assayed as described below. For each
construct, four replicate wells were transfected, and standard
deviations were calculated from the data obtained for these wells
(4).
The amount of luciferase activity was established by using a dual
luciferase reporter assay system (Promega) and a model M3
benchtop
luminometer (Biotrace). For determination of CAT activity,
50 µl of
cell lysate (diluted 1:1,000) was incubated with 50 µl
of CAT assay
mixture (consisting of 0.2 µCi of
D-
threo-[dichloroacetyl-1-
14C]chloramphenicol,
25 µg of
n-butyryl coenzyme A, and 10 µM Tris-HCl
[pH
8.0]) for 30 min at 37°C. CAT activity was determined by liquid
scintillation counting following tetramethylpentadecane-xylene
phase
extraction. The results presented are the mean values of
data from four
independent determinations (
4).
 |
RESULTS |
In vivo activity of HCV IRES elements with point mutations.
PCR-amplified products of HCV cDNA from three HCV-infected sera
corresponding to the entire 5'UTR and the first 15 nt of the core
coding region were cloned into pTZ18R. A number of recombinant plasmids
from each serum preparation were then sequenced. The sequence of one
such isolate, pHCV1b, was identical to that of the prototype HCV-1b
5'UTR isolate (14) deposited in GenBank (accession no.
D00832). Mutations arising from the presence of HCV quasispecies or
from Taq DNA polymerase misincorporation were identified at
various locations throughout the 5'UTR and were named according to the
nucleotide positions of each change from the prototype sequence. These
single-point mutants, together with the deletion mutants described in
Materials and Methods, were tested for their ability to direct the
translation of the downstream FFLUC reporter in a dual
luciferase-bicistronic reporter assay system. This value was normalized
against the activity of the upstream, control RLUC reporter
(4). The FFLUC/RLUC ratio was then used as an index of IRES
activity, with the translation efficiency of the prototype HCV-1b IRES
being arbitrarily set at 100%. For convenience, BHK cells, rather than
a hepatocyte-derived line, were used for these experiments; we
previously reported that the level of activity of the HCV IRES in BHK
cells was similar to that in the liver-derived cell line HepG2 and was
about twofold lower than that in another liver derived line, HuH7
(4).
The relative translation initiation efficiencies (RTEs) of the
different point mutants studied differed considerably (Fig.
3). IRES domain II (Fig.
1) mutations
U63C and A74G showed a marginal
effect on translation, resulting in
RTEs of 70.7 and 74.8%, respectively,
while domain II mutants A72G
(28.6% RTE) and A50U (49.2% RTE)
were intermediate in their activity.
The RTEs of domain III mutants
U194C (75.0%) and G245A (95.8%) also
were only marginally affected.
However, the three mutations at
positions A172G, G229A, and G235A,
which are all located within or near
stem-loop IIIc (Fig.
1),
had a more drastic effect on IRES activity
(3.9 to 12.7% RTE).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of mutations in the 5'UTR of HCV-1b on IRES
activity. IRES activity was assessed by measuring the ratio of the
levels of RLUC and FFLUC produced from transfected bicistronic plasmid
constructs in vTF7-3-infected cells. The activity of the prototype
HCV-1b sequence (1b) was taken as 100%. (A) The activities of six
5'UTRs containing single point mutations expressed relative to that of
the prototypic HCV-1b sequence are shown. (B) Complementation of
mutated 5'UTRs with the prototypic genotype 1b 5'UTR was attempted.
Biscistronic constructs expressing mutated 5'UTRs were transfected
alone (black bars) or cotransfected with pHCV1bS (hatched bars) or with
pHCV1bCAT (white bars) DNA. IRES activity was assessed as described
above. Mutant 5'UTRs are designated according to the position of the
changed nucleotide.
|
|
With regard to the five deletion mutations studied (Fig.
4), the loss of domain I (

5-20)
caused a marginal effect on the
translational efficiency, reducing the
RTE to about 85%. A low
RTE (less than 5% of the prototype level) was
observed when the
IRES was truncated from the 5' end (

1-62) and
when domains II
and III were partially deleted (

57-83 and

165-287, respectively).
Deletion of all of domain III (

132-317)
completely abolished
the function of the HCV IRES, resulting in
background levels of
FFLUC expression.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Attempted complementation of mutants with deletions in
the HCV-1b 5'UTR. Different HCV-1b 5'UTR deletion mutants either were
transfected into vTF7-3-infected cells alone (black bars) or were
cotransfected with pHCV1bS (hatched bars) or pHCV1bCAT (white bars)
DNA. Relative IRES activity was calculated as described in the legend
to Fig. 3.
|
|
Site-specific mutagenesis of stem-loop IIIc.
In the
secondary-structure model of the 5'UTR of HCV (9), base
pairing is predicted to occur between nt A172 and U227 and between nt
G229 and C238 while nt C232 and G235 form part of a tetranucleotide
loop, all within stem-loop IIIc (Fig. 1). According to this model,
point mutations at nt 172 or 229 will disrupt the base pairing required
to form the structures in and around stem-loop IIIc, while a mutation
at nt 235 alters only the primary sequence. It was stated above that
all three mutants (A172G, G229A, and G235A) displayed a dramatic
reduction in translation initiation. The large decrease in the ability
of these mutants to function efficiently suggests that the stem
structures around domain IIIc are particularly important to IRES
activity. To investigate further the relevance of the base interactions
in these mutants, compensatory base substitutions were introduced into
mutants A172G and G229A in order to restore the predicted secondary
structure. In addition, a C232U change was introduced into mutant G235A
to confirm the single-stranded nature of the proposed IIIc tetraloop.
Results from in vivo translation studies of these compensatory mutants are shown in Fig. 5. When predicted base
pairings were restored by the introduction of compensatory mutations
(A172G/U227C and G229A/C238U), the translation initiation efficiency
was only partially recovered (40% RTE), suggesting that maintenance of
the secondary structure alone is insufficient for IRES function and
that the primary sequence also has an important role to play. Indeed,
the computer-generated secondary structures (M-fold
[32]) for the wt and the A172G and A172G/U227C mutants
were identical, despite their wide differences in IRES activity,
although, of course, the possibility that subtle changes to the
secondary structure were not detected by the computer program cannot be
discounted. Interestingly, mutant G235A/C232U showed increased activity
compared to that of mutant G235A; this could be interpreted as
indicating that in this system, nt 232 to 235 may not represent a
single-stranded loop but may be involved in base pair interactions in a
context other than the one suggested in the predicted secondary
structure.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
Comparison of the IRES activities of severely defective
point mutants of HCV-1b 5'UTRs and constructs containing compensatory
mutations which restore the predicted base pairing. Relative IRES
efficiencies were calculated as described in the legend to Fig. 3.
|
|
To substantiate further the importance of the primary sequence in this
region, two other mutants, G229C/C238G and C232G/G235C,
were analyzed.
The data showed that sequence alterations in mutant
C232G/G235C
resulted in a significant decrease in translation
efficiency (25%
RTE), while translation was essentially abolished
in mutant G229C/C238G
(1.5% RTE). Taken together, these results
suggest a functional
importance for both the primary sequence
and the maintenance of a
secondary structure within stem-loop
IIIc.
Complementation of defective IRES elements in vivo.
In 1992, Percy et al. (15) showed that a defective poliovirus IRES
could be complemented in trans by a complete infectious poliovirus cDNA. It was presumed that poliovirus infection, resulting in the down-regulation of cap-dependent translation, allowed the otherwise-defective poliovirus IRES to function efficiently. It was
further suggested that this occurred by the increased availability of
the canonical cellular translational machinery. Subsequently it has
been shown that this is not the case and that complementation of a
defective poliovirus IRES requires neither poliovirus-encoded proteins
nor the inhibition of cap-dependent translation (26). These
studies have since been extended to other members of the family
Picornaviridae, such as foot-and-mouth disease virus
(5) and encephalomyocarditis virus (EMCV) (29).
In the present study, using the mutants described above, we
investigated whether these findings might also apply to the HCV
IRES.
Bicistronic constructs containing HCV-1b IRES point and
deletion
mutants were transfected into BHK-21 cells together with
plasmid
pHCV1bS, which contains the prototype (wt) HCV-1b IRES
under the
control of a T7 promoter, followed by a T7 terminator
sequence. All of
the plasmids tested expressed RLUC, but only
the pRL:HCV1b bicistronic
construct, containing the prototype
HCV-1b IRES, produced FFLUC
efficiently, albeit at a slightly
reduced level. No enhancement of
expression of FFLUC was shown
by any of the constructs containing a
defective HCV-1b IRES under
these conditions (Fig.
3b and
4).
To confirm that the prototypic HCV-1b IRES sequence was
functional under the conditions described above, the experiments
were
repeated, using a monocistronic plasmid, pHCV1bCAT, in place
of
pHCV1bS. pHCV1bCAT contains the prototype HCV-1b IRES element
with a
downstream CAT reporter gene. Hence, CAT, RLUC, and FFLUC
could
be assayed simultaneously. As expected, significant CAT
activity
was detected in all lysates of cells transfected with
pHCV1bCAT (data
not shown). As with the previous set of experiments,
however, no
enhancement of the translation efficiency of the defective
IRES
elements in the bicistronic luciferase construct was achieved
(Fig.
3b
and
4).
To ensure that the failure of the prototype HCV-1b IRES to complement
the activity of various defective mutants was not an
artifact of the
experimental system employed, an attempt was made
to complement the
activity of a defective EMCV IRES with a wt
EMCV sequence, using
constructs generously supplied by G. Belsham
(
18,
29).
BHK-21 cells were transfected with bicistronic reporter
constructs
pGEM-CAT/EMC/LUC, containing a wt EMCV IRES sequence,
or
pGEM-CAT/DAvr/LUC, containing a defective EMCV IRES sequence.
Cells
transfected with pGEM-CAT/DAvr/LUC were cotransfected with
pD1+D2+D3,
which represents the entire EMCV IRES sequence without
any reporter
sequences present, or a mock control. In the absence
of pD1+D2+D3,
pGEM-CAT/DAvr/LUC showed an activity of 0.35% compared
to the activity
of pGEM-CAT/EMC/LUC (100%). However, when cells
were cotransfected
with pD1+D2+D3, the activity of pGEM-CAT/DAvr/LUC
increased to 10.5%
of the wt activity (data not
shown).
 |
DISCUSSION |
Domain III of the HCV 5'UTR represents a relatively large
secondary structure with multiple stem-loops (Fig. 1), and deletion analysis (31) has demonstrated that the integrity of this
domain is important for translation initiation. We have found that
single point mutations in one of these stem-loops, domain IIIc, cause a
dramatic loss of IRES function. However, a point mutation in the apical
loop of domain III (domain IIIb, U194C) had only a marginal effect on
translation, similar to results reported by Wang et al. (31)
and Buratti et al. (3). The available data (this work and
reference 17) suggest that the structure
encompassing stem-loops IIIa and IIIc is critical for IRES function,
and it is interesting that sequences in this region are also highly
conserved among different genotypes of HCV, GB virus B (23),
and the animal pestiviruses responsible for bovine viral diarrhea and
hog cholera (1). This high degree of conservation also
implies that this region is important for IRES function. One
possibility is that these sequences are involved in the maintenance of
the secondary and/or tertiary structure of the HCV IRES. Another
possibility is that domain IIIc is a binding site for cellular or viral
proteins. This is particularly relevant in light of the recent
publications of Pestova et al. (16) and Sizova et al.
(24), whose work suggests that the apical region of domain
III, including stem-loops IIIa and IIIc, represents a binding site for
the canonical eukaryotic initiation factor eIF-3 and that this
structure may influence the binding of the ribosome at the initiation codon.
Complementation of defective picornavirus IRES elements has been
described for poliovirus (15, 26), foot-and-mouth disease virus (5), and EMCV (18, 29). From these studies,
it can be concluded that complementation takes place in
trans in a highly sequence-specific manner and possibly
involves RNA-RNA interactions. This might occur either by
complementation of the defective IRES structure with regions of the wt
IRES or by transfer of translational machinery between the two.
However, when we used the prototypic IRES of HCV-1b (pHCV1bS and
pHCV1bCAT) to attempt complementation of defective single-point and
large deletion mutants, no complementation was observed. Two particular
controls were employed to ensure that the failure of the wt HCV IRES to
complement a defective IRES was not an artifact of the experimental
system. First, the complementation of a defective EMCV IRES
(29) was repeated and confirmed by using our expression
system. Second, as described above, the inclusion of a third reporter,
CAT, in the complementation experiments confirmed that the protypic
HCV-1b IRES was active in this setting. It therefore seems unlikely
that the failure to complement defective HCV IRES elements was due to
our experimental conditions. It is also unlikely that it is a function
of the mutants used in the study, since several mutants with mutations
in different regions of the HCV IRES were randomly chosen for attempted
complementation. Thus, these data suggest that unlike picornavirus IRES
elements, HCV IRES elements can act only in cis.
To date, there is little understanding of the mechanism of IRES
function. Based on the observation that mutations in different areas of
the picornavirus IRES require distinct regions of the wt IRES for
complementation, Roberts and Belsham (18) speculate that a
discontinuous transfer of an initiation complex may be performed by the
IRES and that this may occur in trans as well as in
cis. According to our results, such a mechanism is not
operative in translation of HCV RNA. Kamoshita et al. (12)
recently utilized allele replacement experiments to identify the
structures that influence the efficiency of HCV 5'UTR-directed
translation initiation and found that IRES activity is determined by
multiple regions within the IRES. Their results suggest that HCV IRES
function is supported by a highly ordered structure formed by the
entire IRES segments. The strong requirement for both the complete
5'UTR and some coding sequence is in sharp contrast to IRES elements of
most picornaviruses (although recently Graff and Ehrenfeld [8] reported that viral coding sequences enhanced
hepatitis A virus IRES activity in vitro and Kaminiski and Jackson
(11) reported that the presence of EMCV coding sequences
could have an influence on the cognate IRES, depending on the nature of
the downstream reporter). This model is also supported by the results of studies by other groups (reviewed in references
13 and 16) which provide strong
evidence that ribosomes enter the HCV IRES directly on the initiation
codon, prior to translation initiation. This would allow little scope
for transfer of translational machinery from one IRES to another. These
previous observations, combined with the results of our complementation
study, suggest another fundamental difference between the IRES elements
of HCV and picornaviruses.
 |
ACKNOWLEDGMENTS |
This work was supported by a Medical Research Council (ROPA)
project grant to R.M.E., a Wellcome Trust travelling fellowship (047027/2/96/2) to S.T., and a Wellcome Trust equipment grant (046745/Z/96).
We thank G. Belsham for reagents and helpful discussion and L. Taylor
for automated sequencing.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Virology, University of Glasgow, Church St., Glasgow G11 5JR, Scotland, United Kingdom. Phone: (44) 141 330 4024. Fax: (44) 141 337 2236. E-mail: elliott{at}vir.gla.ac.uk.
Present address: HIV and AIDS Malignancy Branch, National Cancer
Institute, National Institutes of Health, Bethesda, MD 20892.
 |
REFERENCES |
| 1.
|
Brown, E. A.,
H. Zhang,
L. H. Ping, and S. M. Lemon.
1992.
Secondary structure of the 5' nontranslated regions of hepatitis C virus and pestivirus genomic RNAs.
Nucleic Acids Res.
20:5041-5045[Abstract/Free Full Text].
|
| 2.
|
Bukh, J.,
R. H. Purcell, and R. H. Miller.
1992.
Sequence analysis of the 5' noncoding region of hepatitis C virus.
Proc. Natl. Acad. Sci. USA
89:4942-4946[Abstract/Free Full Text].
|
| 3.
|
Buratti, E.,
M. Gerotto,
P. Pontisso,
A. Alberti,
S. G. Tisminetzky, and F. E. Baralle.
1997.
In vivo translational efficiency of different hepatitis C virus 5'-UTRs.
FEBS Lett.
411:275-280[Medline].
|
| 4.
|
Collier, A. J.,
S. X. Tang, and R. M. Elliott.
1998.
Comparison of the translation efficiencies of the six major genotypes of hepatitis C virus using a new novel bicistronic reporter assay system.
J. Gen. Virol.
79:2359-2366[Abstract].
|
| 5.
|
Drew, J., and G. J. Belsham.
1994.
trans complementation by RNA of defective foot-and-mouth disease virus internal ribosome entry site elements.
J. Virol.
68:697-703[Abstract/Free Full Text].
|
| 6.
|
Dunn, E. F.,
D. C. Pritlove,
H. Jin, and R. M. Elliott.
1995.
Transcription of a recombinant bunyavirus RNA template by transiently expressed bunyavirus proteins.
Virology
211:133-143[Medline].
|
| 7.
|
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126[Abstract/Free Full Text].
|
| 8.
|
Graff, J., and E. Ehrenfeld.
1998.
Coding sequences enhance internal initiation of translation by hepatitis A virus in vitro.
J. Virol.
72:3571-3577[Abstract/Free Full Text].
|
| 9.
|
Honda, M.,
E. A. Brown, and S. M. Lemon.
1996.
Stability of a stem loop involving the initiator AUG controls the efficiency of internal initiation of translation of hepatitis C virus.
RNA
2:955-968[Abstract].
|
| 10.
|
Houghton, M.,
M. Selby,
A. Weiner, and Q.-L. Choo.
1994.
Hepatitis C virus.
Curr. Stud. Hematol. Blood Transfus.
61:1-11.
|
| 11.
|
Kaminski, A., and R. J. Jackson.
1998.
The polypyrimidine tract binding protein (PTB) requirement for internal initiation of cardiovirus RNAs is conditional rather than absolute.
RNA
4:626-638[Abstract].
|
| 12.
|
Kamoshita, N.,
K. Tsukiyama-Kohara,
M. Kohara, and A. Nomoto.
1997.
Genetic analysis of internal ribosome entry site on hepatitis C virus RNA: implication for involvement of the highly ordered structure and cell type-specific transacting factors.
Virology
233:9-19[Medline].
|
| 13.
|
Lemon, S. M., and M. Honda.
1997.
Internal ribosome entry sites within the RNA genomes of hepatitis C virus and other flaviviruses.
Semin. Virol.
8:274-288.
|
| 14.
|
Okamoto, H.,
S. Okada,
Y. Sugiyama,
K. Hurai,
H. Iizuka,
A. Machida,
Y. Miyakawa, and M. Mayumi.
1991.
Nucleotide sequence of the genomic RNA of hepatitis C virus isolated from a human carrier: comparison with reported isolates for conserved and divergent regions.
J. Gen. Virol.
72:2697-2704[Abstract/Free Full Text].
|
| 15.
|
Percy, N.,
G. J. Belsham,
J. K. Brangwyn,
M. Sullivan,
D. M. Stone, and J. W. Almond.
1992.
Intracellular modifications induced by poliovirus reduce the requirement for structural motifs in the 5' noncoding region of the genome involved in internal initiation of protein synthesis.
J. Virol.
66:1695-1701[Abstract/Free Full Text].
|
| 16.
|
Pestova, T. V.,
I. N. Shatsky,
S. P. Fletcher,
R. T. Jackson, and C. U. T. Hellen.
1998.
A prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon during internal translation initiation of hepatitis C and classical swine fever virus RNA.
Genes Dev.
12:67-83[Abstract/Free Full Text].
|
| 17.
|
Rijnbrand, R.,
P. Bredenbeek,
T. van der Straaten,
L. Whetter,
G. Inchauspé,
S. Lemon, and W. Spaan.
1995.
Almost the entire 5' non-translated region of hepatitis C virus is required for cap-independent translation.
FEBS Lett.
365:115-119[Medline].
|
| 18.
|
Roberts, L., and G. J. Belsham.
1997.
Complementation of defective picornavirus internal ribosome entry site (IRES) elements by the coexpression of fragments of the IRES.
Virology
227:53-62[Medline].
|
| 19.
|
Rose, J. K.,
L. Buonocore, and M. A. Whitt.
1991.
A new cationic liposome reagent mediating nearly quantitative transfection of animal cells.
BioTechniques
10:520-525[Medline].
|
| 20.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 21.
|
Simmonds, P.,
E. C. Holmes,
T. A. Cha,
S. W. Chan,
F. McOmish,
B. Irvine,
E. Beall,
P. L. Yap,
J. Kolberg, and M. S. Urdea.
1993.
Classification of hepatitis C virus into 6 major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region.
J. Gen. Virol.
74:2391-2399[Abstract/Free Full Text].
|
| 22.
|
Simmonds, P.,
A. Alberti,
H. J. Alter,
F. Bonino,
D. W. Bradley,
C. Brechot,
J. T. Brouwer,
S. W. Chan,
K. Chayama,
D. S. Chen,
Q. L. Choo,
M. Colombo,
H. T. M. Cuypers,
T. Date,
G. M. Dusheiko,
J. L. Esteban,
O. Fay,
S. J. Hadziyannis,
J. Han,
A. Hatzakis,
E. C. Holmes,
H. Hotta,
M. Houghton,
B. Irvine,
M. Kohara,
J. A. Kolberg,
G. Kuo,
J. Y. N. Lau,
P. N. Lelie,
G. Maertens,
F. McOmish,
T. Miyamura,
M. Mizokami,
A. Nomoto,
A. M. Prince,
H. W. Reesink,
C. Rice,
M. Roggendorf,
S. W. Schalm,
T. Shikata,
K. Shimotohno,
L. Stuyver,
C. Trepo,
A. Weiner,
P. L. Yap, and M. S. Urdea.
1994.
A proposed nomenclature of hepatitis C genotypes.
Hepatology
19:1321-1324[Medline].
|
| 23.
|
Simons, J. N.,
T. J. Pilot-Matias,
T. P. Leary,
G. J. Dawson,
S. M. Desai,
G. G. Schlauder,
A. S. Muerhoff,
J. C. Erker,
S. L. Buijk,
M. L. Chalmers,
C. L. Yansant, and I. K. Mushahwar.
1995.
Identification of two flavivirus-like genomes in the GB hepatitis agent.
Proc. Natl. Acad. Sci. USA
92:3401-3405[Abstract/Free Full Text].
|
| 24.
|
Sizova, D. V.,
V. G. Kolupaeva,
T. V. Pestova,
I. N. Shatsky, and C. U. T. Hellen.
1998.
Specific interaction of eukaryotic translation initiation factor 3 with the 5' nontranslated regions of hepatitis C virus and classical swine fever virus RNAs.
J. Virol.
72:4775-4782[Abstract/Free Full Text].
|
| 25.
|
Smith, D. B.,
J. Mellor,
L. M. Jarvis,
F. Davidson,
J. Kolberg,
M. Urdea,
P.-L. Yap,
P. Simmonds, and the International HCV Collaborative Study Group.
1995.
Variation of the hepatitis C virus 5' non-coding region: implications for secondary structure, virus detection and typing.
J. Gen. Virol.
76:1749-1761[Abstract/Free Full Text].
|
| 26.
|
Stone, D. M.,
J. W. Almond,
J. K. Brangwyn, and G. J. Belsham.
1993.
trans complementation of cap-independent translation directed by poliovirus 5' noncoding region deletion mutants: evidence for RNA-RNA interactions.
J. Virol.
67:6215-6223[Abstract/Free Full Text].
|
| 27.
|
Tang, S. X.,
Q. H. Meng,
X. K. Ma,
X. T. Zhang, and Y. T. Jiang.
1994.
HCV RNA detection and genotyping by polymerase chain reaction in anti-HCV positive professional blood donors in China.
Chin. J. Hepatol.
2:33-35.
|
| 28.
|
Tsukiyama-Kohara, K.,
N. Iizuka,
M. Kohara, and A. Nomoto.
1992.
Internal ribosome entry site with hepatitis C virus RNA.
J. Virol.
66:1476-1483[Abstract/Free Full Text].
|
| 29.
|
van der Velden, A.,
A. Kaminski,
R. J. Jackson, and G. J. Belsham.
1995.
Defective point mutants of the encephalomyocarditis virus internal ribosome entry site can be complemented in trans.
Virology
214:82-90[Medline].
|
| 30.
|
Wang, C.,
P. Sarnow, and A. Siddiqui.
1993.
Translation of human hepatitis C virus RNA in cultured cells is mediated by an internal ribosome-binding mechanism.
J. Virol.
67:3338-3344[Abstract/Free Full Text].
|
| 31.
|
Wang, C.,
P. Sarnow, and A. Siddiqui.
1994.
A conserved helical element is essential for internal initiation of translation of hepatitis C virus RNA.
J. Virol.
68:7301-7307[Abstract/Free Full Text].
|
| 32.
|
Zuker, M.
1989.
On finding all suboptimal foldings of an RNA molecule.
Science
244:48-52[Abstract/Free Full Text].
|
Journal of Virology, March 1999, p. 2359-2364, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Barria, M. I., Gonzalez, A., Vera-Otarola, J., Leon, U., Vollrath, V., Marsac, D., Monasterio, O., Perez-Acle, T., Soza, A., Lopez-Lastra, M.
(2009). Analysis of natural variants of the hepatitis C virus internal ribosome entry site reveals that primary sequence plays a key role in cap-independent translation. Nucleic Acids Res
37: 957-971
[Abstract]
[Full Text]
-
Hazari, S., Patil, A., Joshi, V., Sullivan, D. E., Fermin, C. D., Garry, R. F., Elliott, R. M., Dash, S.
(2005). Alpha interferon inhibits translation mediated by the internal ribosome entry site of six different hepatitis C virus genotypes. J. Gen. Virol.
86: 3047-3053
[Abstract]
[Full Text]
-
Ji, H., Fraser, C. S., Yu, Y., Leary, J., Doudna, J. A.
(2004). Inaugural Article: Coordinated assembly of human translation initiation complexes by the hepatitis C virus internal ribosome entry site RNA. Proc. Natl. Acad. Sci. USA
101: 16990-16995
[Abstract]
[Full Text]
-
Thurner, C., Witwer, C., Hofacker, I. L., Stadler, P. F.
(2004). Conserved RNA secondary structures in Flaviviridae genomes. J. Gen. Virol.
85: 1113-1124
[Abstract]
[Full Text]
-
Rubtsova, M. P., Sizova, D. V., Dmitriev, S. E., Ivanov, D. S., Prassolov, V. S., Shatsky, I. N.
(2003). Distinctive Properties of the 5'-Untranslated Region of Human Hsp70 mRNA. J. Biol. Chem.
278: 22350-22356
[Abstract]
[Full Text]
-
Lafuente, E., Ramos, R., Martinez-Salas, E.
(2002). Long-range RNA-RNA interactions between distant regions of the hepatitis C virus internal ribosome entry site element. J. Gen. Virol.
83: 1113-1121
[Abstract]
[Full Text]
-
Odreman-Macchioli, F., Baralle, F. E., Buratti, E.
(2001). Mutational Analysis of the Different Bulge Regions of Hepatitis C Virus Domain II and Their Influence on Internal Ribosome Entry Site Translational Ability. J. Biol. Chem.
276: 41648-41655
[Abstract]
[Full Text]
-
Tang, S., Murakami, T., Agresta, B. E., Campbell, S., Freed, E. O., Levin, J. G.
(2001). Human Immunodeficiency Virus Type 1 N-Terminal Capsid Mutants That Exhibit Aberrant Core Morphology and Are Blocked in Initiation of Reverse Transcription in Infected Cells. J. Virol.
75: 9357-9366
[Abstract]
[Full Text]
-
Lauer, G. M., Walker, B. D.
(2001). Hepatitis C Virus Infection. NEJM
345: 41-52
[Full Text]
-
Jubin, R., Vantuno, N. E., Kieft, J. S., Murray, M. G., Doudna, J. A., Lau, J. Y. N., Baroudy, B. M.
(2000). Hepatitis C Virus Internal Ribosome Entry Site (IRES) Stem Loop IIId Contains a Phylogenetically Conserved GGG Triplet Essential for Translation and IRES Folding. J. Virol.
74: 10430-10437
[Abstract]
[Full Text]
-
Laporte, J., Malet, I., Andrieu, T., Thibault, V., Toulme, J.-J., Wychowski, C., Pawlotsky, J.-M., Huraux, J.-M., Agut, H., Cahour, A.
(2000). Comparative Analysis of Translation Efficiencies of Hepatitis C Virus 5' Untranslated Regions among Intraindividual Quasispecies Present in Chronic Infection: Opposite Behaviors Depending on Cell Type. J. Virol.
74: 10827-10833
[Abstract]
[Full Text]
-
Odreman-Macchioli, F. E., Tisminetzky, S. G., Zotti, M., Baralle, F. E., Buratti, E.
(2000). Influence of correct secondary and tertiary RNA folding on the binding of cellular factors to the HCV IRES. Nucleic Acids Res
28: 875-885
[Abstract]
[Full Text]
-
Chang, M., Marquardt, A. P., Wood, B. L., Williams, O., Cotler, S. J., Taylor, S. L., Carithers, R. L. Jr., Gretch, D. R.
(2000). In Situ Distribution of Hepatitis C Virus Replicative-Intermediate RNA in Hepatic Tissue and Its Correlation with Liver Disease. J. Virol.
74: 944-955
[Abstract]
[Full Text]