Previous Article | Next Article 
Journal of Virology, March 1999, p. 2153-2160, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Extensive Mutagenesis of the Hepatitis B Virus Core
Gene and Mapping of Mutations That Allow Capsid Formation
Matthias
Koschel,
Reiner
Thomssen, and
Volker
Bruss*
Department of Medical Microbiology,
University of Göttingen, D-37075 Göttingen, Germany
Received 27 July 1998/Accepted 20 November 1998
 |
ABSTRACT |
We generated a large number of mutations in the hepatitis B virus
(HBV) core gene inserted into a bacterial expression vector. The new
mutagenesis procedure generated deletions and insertions (as sequence
repeats) of various lengths at random positions between M1 and E145 but
not substitutions. The R-rich 30-amino-acid C-terminal domain was not
analyzed. A total of 50,000 colonies were tested with a polyclonal
human serum for the expression of hepatitis B core or e antigen. A
total of 110 mutants randomly chosen from 1,500 positive colonies were
genotyped. Deletions and insertions were clustered in four regions: D2
to E14, corresponding to the N-terminal loop in a model for the core
protein fold (B. Bottcher, S. A. Wynne, and R. A. Crowther,
Nature 386:88-91, 1997); V27 to P50 (second loop); L60 to V86 (upper
half of the alpha helix forming the N-terminal part of the spike and
the tip of the spike); and V124 to L140 (C-terminal part of the
C-terminal helix and downstream loop). Deletions or insertions in the
remaining parts of the molecule forming the compact center of the fold
seemed to destabilize the protein. Of the 110 mutations, 38 allowed
capsid formation in Escherichia coli. They mapped
exclusively to nonhelical regions of the proposed fold. The mutations
form a basis for subsequent analysis of further functions of the HBV
core protein in the viral life cycle.
 |
INTRODUCTION |
Hepatitis B virus (HBV) is a human
blood-borne pathogen causing acute and chronic liver inflammation,
which is associated with the development of hepatocellular carcinoma
(for a review, see reference 4). This DNA virus is
able to persistently replicate in hepatocytes through an RNA
intermediate by reverse transcription (for a review, see reference
18). The spherical virion has a diameter of 42 nm
and consists of an outer envelope and an internal nucleocapsid, which
is composed of a protein shell surrounding a circular, partially
double-stranded DNA genome of 3.2 kb and a viral reverse transcriptase
(for a review, see reference 17).
The shell of the capsid is formed by multiple copies of a single core
protein of 185 amino acids (aa) for genotype A (19), used in
this work (27). The core protein forms homodimers
(31) which self-assemble at micromolar concentrations
(24) into icosahedral capsids (7) in heterologous
expression systems in the absence of other viral proteins. These
recombinant particles are morphologically and immunologically
indistinguishable from natural capsids. Two kinds of particles are
formed; one type, composed of 90 dimers, has a T=3 symmetry and a
diameter of 32 nm, and the other type, formed by 120 dimers, has a T=4
symmetry and a diameter of 36 nm (10, 32). During the
assembly process in heterologous systems, nonspecific host RNA is
packaged into the particles by interaction with the protamine-like
R-rich C-terminal domain of 30 aa (3). Deletion of this
domain still allows capsid formation but prevents RNA packaging.
Recently, models for the fold of C-terminally truncated core proteins
assembled in bacteria to capsids were proposed (5, 8) (see
Fig. 7). These models are based on computer-aided processing of
cryoelectron microscopic pictures of particles with T=4 symmetry. A
prominent part of the structure is a spike protruding from the surface
of the capsids; the spike is formed by two long antiparallel alpha-helical regions connected by a short loop around A80 at the tip
of the spike. The base of the spike is girdled by the loop-helix-loop
structure of the N-terminal 50 aa of the protein. At the C terminus of
the spike, the peptide chain sharply bends and forms another alpha
helix almost perpendicular to the spike, followed by another nonhelical
region. In the dimer, the two core protein subunits interact with each
other mainly in the region of the spike-forming helices. The four
helices are combined into a compact bundle. The two C-terminal helices
extrude from the structure on opposite sites. They establish the
interdimer contacts at the fivefold and local sixfold symmetries of the
capsids (13).
The capsids react as the highly immunogenic T-cell-independent as well
as the T-cell-dependent hepatitis B core antigen (HBcAg) (16). The HBcAg determinant is conformational and is formed by amino acid residues around A80 (21). Denaturation of
capsids destroys HBcAg reactivity and generates a distinct antigen
specificity (hepatitis B e antigen [HBeAg]). Two linear HBeAg
determinants (HBe1 and HBe2) have been defined around A80 and P138,
respectively (21). Because of their high immunogenicity, HBV
capsids are used as carriers for foreign epitopes in experimental
recombinant vaccines (e.g., 23). Fusions to the N
terminus of the core protein, internal insertions around A80, and
fusions to the C terminus are compatible with particle formation and
result in external exposure of the foreign domains.
The two forms of capsids having different diameters can also be found
in infected liver (12). In this situation, however, a
complex of the RNA pregenome and reverse transcriptase forms a nucleus
for efficient capsid assembly (1) at submicromolar concentrations of core protein dimers, ensuring predominantly packaging
of the pregenome. A complex of the core protein and a chaperonin has
been identified as an intermediate in capsid assembly in a eukaryotic
cell-free expression system (15). Other steps in the HBV
life cycle besides capsid formation also depend on the core protein.
For example, the transport of the nucleocapsid to the nucleus
(11) and disassembly are important for establishing infection and for intracellular amplification of the viral genome during infection (25). Reverse transcription and
second-strand DNA synthesis of the viral genome in the lumen of the
cytoplasmic capsid are influenced by mutations in the core protein
(2). During genomic DNA synthesis, a maturation signal which
is necessary for envelopment is generated on the surface of the
nucleocapsid (28). Finally, the mature nucleocapsid
presumably interacts with internal membranes carrying viral envelope
proteins, and its envelopment probably requires a direct interaction
with envelope proteins (6).
We started to investigate the functions of the core protein in the HBV
life cycle by a genetic approach. The aim of this work was to generate
a panel of core gene mutations which would allow capsid formation and
which could be used in subsequent studies to characterize later
functions of the core protein, such as pregenome packaging, genome
synthesis, intracellular trafficking, or nucleocapsid envelopment. To
achieve this aim, a large number of quasi-random mutations were
generated in the HBV core gene inserted in a bacterial expression
vector. A new mutagenesis procedure which generated deletions or
insertions (as sequence repeats) but no amino acid substitutions in the
core gene was used. The mutants were first screened for the expression
of HBcAg or HBeAg. Positive variants were subsequently tested for
capsid formation. By this approach, 38 core gene mutations which were
compatible with capsid formation were identified. These mutations were
found exclusively in four regions of the primary sequence forming
nonhelical areas, on the basis of a model for the core protein fold
(5).
 |
MATERIALS AND METHODS |
Expression plasmid for bacterial core protein synthesis.
The
hybrid bacterial tac promoter (9) was isolated as
an 89-bp HindIII-BamHI fragment from plasmid
pDR540 (PL Biochemicals, Freiburg, Germany) and inserted into the
HindIII and BamHI sites of plasmid
pBluescript KS(+) (Stratagene). The HBV core gene was PCR amplified
from a plasmid containing a copy of a genotype A HBV genome
(27) (GenBank-EMBL data bank accession no. X02763) with the
oligonucleotides 5'GGTAGGATCCGGGATGGACATTG
(BamHI site underlined; start codon of core gene
boldfaced) and 5'GTGAGTGATTGG (nucleotide [nt] 336 to nt
325 of the HBV genome), cleaved with BamHI at the 5' end in
the primer region and at the 3' end at nt 26 in the HBV sequence, and
inserted into the BamHI site of the tac promoter
plasmid. (Numbering of the plus strand of the HBV genome starts with
the G of the single EcoRI site.) The XbaI site in
the polylinker sequence of pBluescript KS(+) was destroyed by cleaving,
filling in, and religation. The BamHI site 3' of the core
gene was destroyed by partial BamHI digestion, filling in,
and religation. Six restriction enzyme recognition sites were then
introduced stepwise by site-directed in vitro mutagenesis (14) without changing the amino acid sequence of the core
protein (see Fig. 2), resulting in plasmid pMK8.
Mutagenesis.
Five micrograms of plasmid pMK8 (3.46 pmol of
DNA ends) linearized in the core gene at one of eight sites (see Fig. 2
and 3) was incubated with 0.1 U of exonuclease Bal 31 (New
England Biolabs) in 0.1-ml total volume at 37°C. Thirty microliters
was removed after 5, 10, and 15 min, and the reaction was immediately stopped by the addition of 170 µl of 15 mM EGTA, phenol-chloroform extraction, incubation at 65°C for 5 min, and another
phenol-chloroform extraction. The DNA was recovered by ethanol
precipitation. To check the extent of the exonuclease reaction, 1 µg
of each sample was incubated with a restriction enzyme cleaving
approximately 300 bp away from the site used for linearization and
truncation, and the length distributions of the corresponding fragments
were determined by electrophoresis through a 5% polyacrylamide gel. Usually, after 5 or 10 min of incubation, the number of base pairs removed from one DNA end peaked at approximately 50. Samples containing appropriate fragment lengths were combined, the single-stranded ends
were filled in with Klenow DNA polymerase, and the DNA was cleaved with
PflMI at nt 3207 in the HBV sequence (see site X in Fig. 1).
Fragments from the upstream and downstream truncations (see Fig. 3 for
fragment pairs used) were isolated, ligated, and used for the
electroporation of Escherichia coli DH5
. To monitor the
extent and distribution of the truncations produced by the exonuclease
treatment, plasmids from 24 unselected colonies were prepared, and the
ligation sites were determined by sequencing. The experiment was
repeated with altered reaction conditions for the exonuclease treatment
if the distribution was not satisfactory.
Antigen assay on filters.
Bacterial colonies were
transferred from agar plates to nitrocellulose filter replicas
(approximately 2,000 colonies per 12-cm-diameter filter) and incubated
for 12 h on Luria broth plates supplemented with ampicillin and
0.1 mM isopropyl-
-D-thiogalactopyranoside (IPTG). Cells
were lysed in situ with lysozyme-chloroform vapor (22).
After cells were washed in 10% (vol/vol) fetal calf
serum-phosphate-buffered saline, HBcAg or HBeAg was detected on the
filter with human serum F1451 (positive for antibody to HBcAg
[anti-HBc] and for antibody to HBeAg [anti-HBe]; dilution, 1:1,000)
and a peroxidase-labeled secondary antibody (DAKO Diagnostika, Hamburg,
Germany). The colonies around a positive signal on the master plate
were individually transferred to a nitrocellulose filter, and the
antigen assay was repeated to finally identify the positive colony.
Detection of capsids by agarose gel electrophoresis.
Bacteria were grown in 1.5 ml of Terrific broth (22)
supplemented with ampicillin and IPTG overnight and harvested by
centrifugation. The weight of the cell pellet was determined, and the
cells were frozen in liquid nitrogen and thawed at room temperature
three times. The material was resuspended in 1 µl of 10 mM Tris-Cl
(pH 8.0)-150 mM NaCl-1 mg of DNase I (Boehringer GmbH, Mannheim,
Germany) per ml-10 mg of lysozyme (Sigma) per ml per 1 mg of cell
pellet. After incubation at 37°C for 30 min, the sample was spun for
10 min at 4,600 × g, and the cleared lysate was recovered.
RNase A (2 µl; 1 mg/ml; Boehringer) was added to 20 µl of the
cleared lysate. After incubation for 15 min at room temperature, 4 µl of loading buffer (50% [vol/vol] glycerin-0.1% [wt/vol]
bromphenol blue in 50 mM NaPO4 [pH 7.4]) was added, and
the sample was loaded onto a 10-cm 0.8% (wt/vol) agarose gel. The gel
buffer and electrophoresis buffer were 50 mM NaPO4 (pH
7.4). Electrophoresis was done at 80 V for 30 min. The gel was stained
by soaking in ethidium bromide (2 µg/ml) for 30 min and destained by
soaking in water for 10 min. The bacterial RNA in core particles was
visualized by UV light, and a picture was taken.
Detection of capsids by sucrose gradient centrifugation.
The
cleared lysate from core protein-expressing E. coli was
prepared as described above. Lysate (0.5 ml) diluted 1:10 in
phosphate-buffered saline was layered on top of a sucrose gradient (1.3 ml of 15% [wt/vol], 1.3 ml of 30%, 1.3 ml of 45%, and 0.5 ml of
60% sucrose in phosphate-buffered saline) in an SW60 rotor (Beckman)
and spun for 2 h at 20°C and 38,000 rpm. The gradient was
fractionated from the top (11 by 0.44 ml).
HBcAg was measured in the fractions by an enzyme-linked immunosorbent
assay (ELISA). A microtiter plate was coated with a human anti-HBc- and
anti-HBe-positive serum (F1451; 1:1,000 dilution). The samples were
applied at a 1:50 dilution. The peroxidase-labeled secondary antibody
was prepared from sheep serum containing a high anti-HBc titer
(1:100,000) and a low anti-HBe titer (1:128). The sheep had been
immunized with bacterially expressed HBcAg.
HBcAg in combination with HBeAg was detected by a dot blot. Two
microliters of each sucrose gradient fraction was dotted onto a
nitrocellulose filter and dried. Detection of the antigen was done as
with lysed bacterial colonies on filters (see above).
 |
RESULTS |
Mutagenesis procedure.
We used the following generally
applicable procedure to introduce deletions or insertions (as sequence
repeats) of variable lengths at random positions between two
restriction enzyme cleavage sites (Fig.
1A, sites 1 and 2) in a plasmid. The
molecules were linearized separately at each site, and the DNA ends
were truncated by exonuclease Bal 31 (Fig. 1B). The reaction
conditions were chosen so that between a few and approximately 100 bp
were removed from each end (for details, see Materials and Methods).
After the exonuclease treatment was terminated, both samples were
cleaved at a third remote restriction enzyme site (Fig. 1C, site X),
and the DNA fragments from both samples containing the target region were isolated. The fragments were mixed and recombined by ligation (Fig. 1D). The 5' and 3' fragments were joined randomly; therefore, the
distribution and length of deletions or repeats depended primarily on
the distribution of the DNA ends produced during the exonuclease treatment. The mutants are referred to by the C-terminal amino acids
encoded by the upstream fragment of the core gene and the N-terminal
amino acids encoded by the fused downstream fragment; e.g., mutant
A11-E8 contains peptide E8-F9-G10-A11 as a tandem repeat inserted
between K7 and T12, and mutant A11-V13 has a deletion of T12. If the
fusion created a single new codon at the fusion site, the corresponding
amino acid is indicated (e.g., P50-L-D32). Sole amino acid
substitutions cannot be generated by the method because two ligated
fragments creating the wild-type (WT) length of the DNA molecule also
generate the WT sequence.

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 1.
Mutagenesis procedure. (A) Mutations were introduced
between two single restriction enzyme cleavage sites (sites 1 and 2). A
third, remote single restriction enzyme cleavage site (X) was required.
(B) The plasmid was separately linearized at sites 1 and 2 (vertical
arrows), and variable numbers of base pairs were removed from the DNA
ends by exonuclease treatment (triangles). (C) The DNA was cut with
restriction enzyme X, and the fragments containing the regions of
interest (broken lines) were isolated. (D) The fragments from both
samples were recombined by sticky-end ligation at site X and blunt-end
ligation randomly joining a 5' segment of the region to a 3' segment
(hatched box). This procedure generated deletions and insertions (as
sequence repeats) of variable lengths at random positions.
|
|
If the region shortened by the exonuclease is 100 bp long at each DNA
end, the maximum number of mutants attainable by this technique is
(100 × 100)
100, or 9,900. This number increases exponentially
with the length of the truncated DNA segment. In order to keep this
number within reasonable limits and to avoid the generation of very
long insertions or deletions, six single restriction enzyme sites were
introduced into the HBV core gene by in vitro mutagenesis without
changing the amino acid sequence (Fig.
2). These six sites, together with the
natural BglII site at nt 1983 and a BamHI site
between the bacterial promoter and the core gene, were used to apply
the mutagenesis procedure separately to five regions of the gene (Fig.
3, regions A to E). The regions are
between 94 and 153 bp long, and adjacent regions overlap, except for
regions B and C. (The BglII site at nt 1983 could not be
used for downstream mutagenesis because the core gene carries two
additional BglII sites, at nt 2403 and nt 2427.) The five regions cover codons 1 to 149 of the core gene. The R-rich C terminus, which can be deleted without blocking capsid formation (10), was omitted.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
Single restriction enzyme cleavage sites introduced into
the core gene without changing the coding. Six unique restriction
enzyme cleavage sites were introduced by site-directed in vitro
mutagenesis. The sites were used for the mutagenesis of different
regions of the core gene (see Fig. 3) by the method shown in Fig. 1.
Numbers indicate the positions of the peptides in the core protein (top
line) and the positions of the WT nucleotide sequences in the HBV
genome (middle line). The nucleotide sequences in the bottom line show
the point mutations; the recognition sites for the enzymes are
underlined.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 3.
Restriction enzyme pairs used for mutagenesis. The upper
bar represents the HBV core gene. Numbers above the bar indicate codons
where the DNA is cleaved by the indicated restriction enzymes. Numbers
below the bar indicate the first base pair of the corresponding
recognition sites introduced in part by site-directed in vitro
mutagenesis (Fig. 2). Restriction enzyme pairs used for mutagenesis
(corresponding to sites 1 and 2 in Fig. 1) are connected by vertical
and horizontal bars and define regions A to E where deletions and
insertions were introduced.
|
|
The approximate distribution of the DNA ends produced by the
Bal 31 treatment was determined after each round of
mutagenesis by sequencing the plasmids of a number of unselected
colonies (data not shown). When the distribution was unsatisfactory,
additional mutagenesis experiments were carried out with the same region.
Genotype of stable antigen-positive mutants.
For each region,
between 6,200 and 13,600 colonies were tested for the expression of
HBcAg or HBeAg (Table 1) with a
polyclonal human serum containing the corresponding antibodies,
anti-HBc and anti-HBe. The ratio of antigen-positive colonies varied
from 6.3% (region E) to 0% (region D). It is unlikely that
mutagenesis in region D destroyed all core protein epitopes
recognizable by the human antiserum because the main HBcAg and HBeAg
epitopes have been mapped to sequences around A80 (at the extreme 5'
boundary of region D) and P144 (approximately 30 aa downstream of
region D). It is more likely that all insertions and deletions in this area destabilized the protein.
Antigen-positive colonies were randomly chosen (Table 1), and the
fusion sites of the upstream and downstream core gene fragments ligated
in individual mutants were determined by sequencing (Fig. 4). WT genes were found at a low
frequency (approximately 5%) in each mutagenesis round. The genotyped
110 mutations (69 insertions and 41 deletions) formed four clusters
which fixed the limits of four variable domains (domain I from D2 to
E14, domain III from F24 to P50, domain V from L60 to R86, and domain
VII from V124 to L140) and three intervening constant domains carrying few mutations (domain II from L15 to F23) or no mutations (domain IV
from H51 to I59 and domain VI from N87 to G123) (Fig. 4 and Table
2).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Genotypes and phenotypes of 110 HBcAg- or HBeAg-positive
core gene mutants. The abscissa shows the numbered HBV core protein
sequence up to R150 in the one-letter code. The ordinate above (below)
the sequence denotes the number of amino acids repeated (deleted) in
individual mutants. A mutant forming capsids is represented by a dot; a
capsid-defective mutant is represented by a dash. A dot (dash) points
to the N-terminal amino acid of the peptide which is repeated (deleted)
at that site. The position of a dot or dash on the upper (lower)
ordinate indicates the length of the repeat (deletion). For example,
mutant A11-E8 (marked by an asterisk) carries a 4-aa repeat and
contains the sequence
...Y6-K7-E8-F9-G10-A11-E8-F9-G10-A11-T12-V13..., and
mutant A41-E43 (marked by multiplication sign) carries a deletion of 1 aa (L42). A dot or dash connected to the left side of a vertical bar
indicates that the ligation of the upstream and downstream core gene
fragments (Fig. 1) generated a single new codon at the fusion point.
|
|
Assays for capsid formation.
The 110 mutants were tested for
their ability to form capsids in E. coli by the following
indirect method, which has the advantage that a relatively large number
of assays can be done in one experiment. Cleared bacterial lysates were
treated with RNase and DNase. The RNA in the lumen of core particles is
protected from the nuclease attack, while all RNA is destroyed if no
particles are formed. During separation of the treated lysates by
electrophoresis through native agarose gels, the intact capsids run as
a band and can finally be visualized by ethidium bromide staining under
UV light due to the packaged RNA (Fig.
5).

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 5.
Detection of core particles by agarose gel
electrophoresis. Cleared lysates from bacteria expressing WT or mutant
core proteins were treated with DNase and RNase and separated by native
agarose gel electrophoresis. Capsids ran as a band. Only the bacterial
RNA encapsidated in core particles was nuclease protected and became
visible by ethidium bromide staining under UV light.
|
|
In order to evaluate this assay, 13 capsid-forming mutants and 4 non-capsid forming mutants also were tested by sucrose gradient centrifugation for capsid formation. The fractions were assayed (i) for
HBcAg in an HBcAg ELISA which did not recognize HBeAg (Fig.
6A) and (ii) for HBcAg or HBeAg by
blotting aliquots from the fractions on membranes and detecting the
antigen with the same polyclonal human serum as that used in the
initial screening of bacterial colonies (Fig. 6B).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 6.
Detection of core particles by sucrose gradient
centrifugation. Cleared lysates from bacteria expressing WT and mutant
core proteins were separated by sucrose gradient centrifugation. Eleven
fractions were harvested from the top. The fractions were assayed with
an HBcAg ELISA (A) (numbers on the ordinate indicate optical densities)
or by blotting of an aliquot onto a membrane and detecting HBcAg or
HBeAg in a Western blot assay (B). Core particles peaked in fractions 6 and 7. Mutant P79-S81 was negative in the HBcAg ELISA, but capsids
became detectable in the HBcAg or HBeAg blot.
|
|
The results of the two assays for capsid formation (gel electrophoresis
and sucrose gradient centrifugation) were in good accord and justified
the use of agarose gel electrophoresis for detecting capsids (Table
3). Two of the four mutants negative in
the agarose gel assay (L84-R-G63 and V85-G63) also were negative in the
HBcAg ELISA of the sucrose gradients (Fig. 6A). The other two mutants
negative in the agarose gel assay (E14-G10 and E43-A41) showed a very
weak HBcAg signal in the central fractions of the sucrose gradients
(Fig. 6A) and were scored negative in the dot blot. The amount of core
particles produced by these mutants probably was very low and could be
detected by the sensitive HBcAg ELISA but not by the less sensitive
agarose gel assay and dot blot. For mutant E14-G10, the HBcAg or HBeAg
dot blot (Fig. 6B) demonstrated that the majority of the antigen was in
a nonparticulate state and appeared in the upper fractions of the
gradient.
All 13 mutants positive in the agarose gel assay also demonstrated
capsid formation in the sucrose gradients (Table 3). Three mutants,
however, had a unique pattern. Mutant A11-E8 produced only a very weak
signal in the HBcAg ELISA and was negative in the HBcAg or HBeAg dot
blot. The reason for this finding is not clear. The second mutant,
L37-A41, repeatedly produced an antigen peak in fraction 5 instead of
fraction 6 or 7 for unknown reasons (Fig. 6A and B). Also, this mutant
showed a relatively large amount of nonparticulate HBcAg or HBeAg (top
fractions in Fig. 6B). Clearly, the capsid assembly of this variant,
although allowing protection of RNA (Fig. 5), was abnormal. The third
mutant, P79-S81, formed particles but was negative in the HBcAg ELISA.
This result, however, was not surprising because the HBcAg determinant
has been mapped to the region around A80. Consequently, this mutant was
detectable in the HBcAg or HBeAg dot blot (Fig. 6B).
Of the 110 core gene mutants, 38 scored positive in the nuclease
treatment-agarose gel assay for capsid formation (Fig. 4). The ratio of
capsid-forming mutants varied between different domains, from 3%
(domain V) to 63% (domain III) (Table 2).
Distribution of mutations relative to a proposed core protein
fold.
During the course of this work, models for the folding of a
C-terminally truncated HBV core protein in bacterially expressed capsids were proposed by others (5, 8). In our study,
domains I to VII were defined in the core protein primary amino acid
sequence according to the effect of insertions and deletions on stable antigen expression and capsid formation (Table 2). Comparison of these
domains from the N to the C terminus with a model for the protein fold
(5) provided the following results (Table 2 and Fig.
7). Domains I and III correspond to the
N-terminal and second loops of the model, respectively. Mutations in
these domains were partly compatible with capsid formation. Domain II, in which only two small mutations which blocked capsid formation were
identified, coincides with the first alpha helix. The nonchangeable domain IV forms a basal part of the spike. The variable domain V
corresponds to the C-terminal one-third of helix 2 and the third short
loop at the tip of the spike. With the exception of mutation P79-S81,
which maps to the very tip of the spike, mutations in this domain
blocked particle formation. The next three helices, interrupted by a
kink at G94 and a turn at G111, form the constant domain VI. Finally,
domain VII corresponds to the C-terminal part of the C-terminal helix
and the next loop. All mutations in the helical part of this domain
(V124 to T128) blocked particle formation. The two capsid-forming
mutants with mutations in this domain carried a small deletion (1 aa)
and a short insertion (2 aa), and their mutations mapped to the
nonhelical region.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 7.
Comparison of the core protein domains defined in this
work (Table 2) with the proposed fold of the C-terminally truncated
protein (5), using the handedness determined in reference
7a. Alpha-helical regions are drawn as cylinders. Numbers indicate
amino acid residues. Regions where insertions or deletions were
compatible with capsid formation are marked by dots (compare with Fig.
4 and Table 2). They correspond to the nonhelical domains. Areas where
insertions or deletions allowed stable HBcAg or HBeAg expression but no
capsid formation are indicated by bars. No insertions or deletions
could be identified in the center of the structure formed by the first
helix (L15-L30), the N-terminal third of the second helix (P50-L60),
the fourth helix (G94-F110), and the N-terminal part of the fifth helix
(R112-G123). Adapted with permission of Macmillan Magazines Ltd.
(reference 5, copyright 1997).
|
|
In summary, mutations allowing capsid formation were found exclusively
in nonhelical regions of the proposed fold. Such mutations could be
identified in all four loops. Most of the helical regions were devoid
of insertions or deletions; only two of them contained mutations which
blocked capsid formation.
 |
DISCUSSION |
The HBV core protein, only 185 aa long, supports an astonishing
number of complex functions in the life cycle of the virus, such as
capsid formation, selective packaging of the pregenome-reverse transcriptase complex, trafficking of the capsid in the cell, and
envelopment. We were interested in analyzing these functions by
characterizing the phenotypes of core gene mutants. One problem with
this approach is that it is not a trivial matter to generate core gene
mutants with an informative phenotype: mild mutations, such as
single-amino-acid substitutions, often maintain the complete WT
phenotype. More drastic mutations, such as deletions or insertions, are
more likely to generate a mutant phenotype; however, they have the
disadvantage that the resulting proteins are often unstable or blocked
in early functions, such as capsid formation (29), so that
later functions cannot be scored.
We tried to circumvent this problem by generating a large number of
quasi-random mutants carrying insertions and deletions but no amino
acid substitutions and by selecting those allowing capsid formation
with two simple screening steps. With this approach, 38 capsid-forming
mutants were obtained; 30 of them carried insertions of up to 25 aa,
and 8 carried deletions of between 1 and 3 aa (Fig. 4). A new region
which tolerated insertions with respect to capsid formation and which
has not been described earlier (domain III) (Table 2) was identified.
The mutants form the basis for a subsequent analysis of core
protein-dependent functions in the HBV life cycle (unpublished data).
The distribution of the identified mutations reflects to some extent
the general ability of the core protein to be mutated by insertions and
deletions. This notion is based on two facts. (i) The size and position
of insertions or deletions produced in the mutagenesis procedure were
quasi-random and relatively even throughout the analyzed core gene
sequence. These characteristics were achieved by applying the
mutagenesis protocol to different overlapping areas (Fig. 3) and by
controlling the distribution of the DNA ends generated during the
exonuclease treatment by polyacrylamide gel electrophoresis of digested
fragments as well as by sequencing of unselected clones. (ii) All four
domains which tolerated mutations with respect to stable antigen
expression in E. coli (domains I, III, V, and VII; Table 2)
corresponded mainly to nonhelical structures in the proposed fold of
the protein (Fig. 7).
Apparently, insertions and deletions in the less flexible helical parts
of the fold destabilized the protein. An exception was the C-terminal
part of the first spike-forming helix (C61 to D78), where a large
number of repeats and deletions were found. Interestingly, these
insertions or deletions did not preferentially represent multiples of
helix turns (e.g., 3, 7, or 10 aa). These mutant proteins probably are
quite stable in E. coli because the mutations found in this
area did not destroy the central, compact part of the fold. All
mutations in this area, however, prevented core particle morphogenesis.
Also, mutations in the small C-terminal part of the proposed C-terminal
helix from V124 to T128 resulted in this phenotype.
A striking finding is that no single HBcAg- or HBeAg-positive mutant
was found among 6,200 colonies tested after mutagenesis of region D
(Table 1). Apparently, even small insertions and deletions in this part
of the molecule (S81 to V115) destabilized the protein. This
observation is supported by naturally occurring core gene mutants which
carried deletions corresponding to region D and which were also
unstable (30).
It has been shown that insertions into the core protein are compatible
with capsid formation when fused to the N or C terminus or introduced
at the HBcAg determinant around A80 (reviewed in reference
26). The C-terminal R-rich region was not analyzed by us. However, the tolerance of the N terminus for elongation was
found in the present study. The insertion site around A80, however, was
not clearly identified by our approach. In contrast, three mutants
carrying repeats with a length of 2 to 7 aa between E77 and R82 were
blocked in capsid formation (Fig. 4). The simplest explanation for this
discrepancy is that the target site tolerating insertions is extremely
small (3 aa, from P79 to S81), greatly reducing the likelihood of
finding corresponding mutants among the 34 randomly selected HBcAg- or
HBeAg-positive clones from the mutagenesis of region C (Table 1).
Potentially, our approach would be limited if the mutagenesis were to
destroy the antigenicity of stable and possibly capsid-forming protein
variants completely. However, this situation is unlikely in the case of
the core protein and the antiserum used in the initial screening on
filters. The two antigen determinants exposed on the surface of capsids
are apart from each other in the primary sequence and could therefore
not be destroyed simultaneously in the same mutant by our approach:
determinant HBc, near A80 (21), and a determinant between
R127 and R133 (20). Apparently, the human serum used in the
screening recognized both determinants because seven mutations (one
allowing capsid formation) between E77 and R82 and four mutations (one
allowing capsid formation) between R127 and R134 were identified. This
notion is also supported more directly by the antigenicity of the
capsid-forming mutant P79-S81. This mutant was negative in an HBcAg
ELISA with sheep anti-HBc serum because the main HBcAg epitope that
mapped to the sequence around A80 was destroyed. However, the mutant
was recognized by the human antiserum used in the initial screening
(Table 3).
The second screening round designed to find capsid-forming mutants was
done with an indirect assay that identified RNase-protected RNA in the
lumen of capsids (Fig. 5). Clearly, this test was not as specific with
respect to WT capsid formation as, e.g., sucrose gradient
centrifugation. Mutant L37-A41 was scored as WT in the agarose gel
assay and produced a large amount of nonparticulate HBcAg or HBeAg
(Fig. 6B), and the mutant capsids moved in the sucrose gradient
differently from the WT capsids (Fig. 6A). However, the phenotype of
most of the doubly-checked mutants was confirmed by sucrose gradient
centrifugation (Table 3). We therefore believe that the overall picture
of the distribution of capsid-forming mutants is correct even if a
small fraction of mutants is, like L37-A41, not exactly WT with respect
to capsid formation.
We did not investigate at which step in particle morphogenesis the
capsid-negative, HBcAg- or HBeAg-positive mutants were blocked. It is
likely that mutants with changes in domain VII assemble into dimers
because the dimer interface is formed mainly by the spike region. They
are probably defective in establishing interdimer contacts, a step
which is mediated by the C-terminal loop, which corresponds to domain
VII (13).
Twelve of the capsid-forming mutants were characterized by
complementation of a core-negative HBV genome in eukaryotic cell cutures (unpublished data). None of them was WT for all of the functions assayed. This result demonstrates that the HBV core protein,
which is involved in many steps of the viral life cycle, cannot readily
mutate without losing a vital function.
 |
ACKNOWLEDGMENT |
This work was supported in part by the Fritz Thyssen Stiftung.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medical Microbiology, University of Göttingen, Kreuzbergring 57, D-37075 Göttingen, Germany. Phone: 49 551 39 5759. Fax: 49 551 39 5860. E-mail: VBRUSS{at}GWDG.DE.
 |
REFERENCES |
| 1.
|
Bartenschlager, R., and H. Schaller.
1992.
Hepadnaviral assembly is initiated by polymerase binding to the encapsidation signal in the viral RNA genome.
EMBO J.
11:3413-3420[Medline].
|
| 2.
|
Beames, B., and R. E. Lanford.
1993.
Carboxy-terminal truncations of the HBV core protein affect capsid formation and the apparent size of encapsidated HBV RNA.
Virology
194:597-607[Medline].
|
| 3.
|
Birnbaum, F., and M. Nassal.
1990.
Hepatitis B virus nucleocapsid assembly: primary structure requirements in the core protein.
J. Virol.
64:3319-3330[Abstract/Free Full Text].
|
| 4.
|
Blumberg, B. S.
1997.
Hepatitis B virus, the vaccine, and the control of primary cancer of the liver.
Proc. Natl. Acad. Sci. USA
94:7121-7125[Free Full Text].
|
| 5.
|
Bottcher, B.,
S. A. Wynne, and R. A. Crowther.
1997.
Determination of the fold of the core protein of hepatitis B virus by electron cryomicroscopy.
Nature
386:88-91[Medline].
|
| 6.
|
Bruss, V.
1997.
A short linear sequence in the pre-S domain of the large hepatitis B virus envelope protein required for virion formation.
J. Virol.
71:9350-9357[Abstract].
|
| 7.
|
Cohen, B. J., and J. E. Richmond.
1982.
Electron microscopy of hepatitis B core antigen synthesized in E. coli.
Nature
296:677-679[Medline].
|
| 7a.
|
Conway, J. F.,
N. Cheng,
A. Zlotnick,
S. J. Stahl,
P. T. Wingfield,
D. M. Belnap,
U. Kanngiesser,
M. Noah, and A. C. Steven.
1998.
Hepatitis B virus capsid: localization of the putative immunodominant loop (residues 78 to 83) on the capsid surface, and implications for the distinction between c- and e-antigens J.
Mol. Biol.
279:1111-1121[Medline].
|
| 8.
|
Conway, J. F.,
N. Cheng,
A. Zlotnick,
P. T. Wingfield,
S. J. Stahl, and A. C. Steven.
1997.
Visualization of a 4-helix bundle in the hepatitis B virus capsid by cryo-electron microscopy.
Nature
386:91-94[Medline].
|
| 9.
|
de Boer, H. A.,
L. J. Comstock, and M. Vasser.
1983.
The tac promoter: a functional hybrid derived from the trp and lac promoters.
Proc. Natl. Acad. Sci. USA
80:21-25[Abstract/Free Full Text].
|
| 10.
|
Gallina, A.,
F. Bonelli,
L. Zentilin,
G. Rindi,
M. Muttini, and G. Milanesi.
1989.
A recombinant hepatitis B core antigen polypeptide with the protamine-like domain deleted self-assembles into capsid particles but fails to bind nucleic acids.
J. Virol.
63:4645-4652[Abstract/Free Full Text].
|
| 11.
|
Kann, M.,
A. Bischof, and W. H. Gerlich.
1997.
In vitro model for the nuclear transport of the hepadnavirus genome.
J. Virol.
71:1310-1316[Abstract].
|
| 12.
|
Kenney, J. M.,
C. H. von Bonsdorff,
M. Nassal, and S. D. Fuller.
1995.
Evolutionary conservation in the hepatitis B virus core structure: comparison of human and duck cores.
Structure
3:1009-1019[Medline].
|
| 13.
|
Konig, S.,
G. Beterams, and M. Nassal.
1998.
Mapping of homologous interaction sites in the hepatitis B virus core protein.
J. Virol.
72:4997-5005[Abstract/Free Full Text].
|
| 14.
|
Kunkel, T. A.,
K. Bebenek, and J. McClary.
1991.
Efficient site-directed mutagenesis using uracil-containing DNA.
Methods Enzymol.
204:125-139[Medline].
|
| 15.
|
Lingappa, J. R.,
R. L. Martin,
M. L. Wong,
D. Ganem,
W. J. Welch, and V. R. Lingappa.
1994.
A eukaryotic cytosolic chaperonin is associated with a high molecular weight intermediate in the assembly of hepatitis B virus capsid, a multimeric particle.
J. Cell Biol.
125:99-111[Abstract/Free Full Text].
|
| 16.
|
Milich, D. R., and A. McLachlan.
1986.
The nucleocapsid of hepatitis B virus is both a T-cell-independent and a T-cell-dependent antigen.
Science
234:1398-1401[Abstract/Free Full Text].
|
| 17.
|
Nassal, M.
1996.
Hepatitis B virus morphogenesis.
Curr. Top. Microbiol. Immunol.
214:297-337[Medline].
|
| 18.
|
Nassal, M., and H. Schaller.
1996.
Hepatitis B virus replication an update.
J. Viral Hepat.
3:217-226[Medline].
|
| 19.
|
Okamoto, H.,
F. Tsuda,
H. Sakugawa,
R. I. Sastrosoewignjo,
M. Imai,
Y. Miyakawa, and M. Mayumi.
1988.
Typing hepatitis B virus by homology in nucleotide sequence: comparison of surface antigen subtypes.
J. Gen. Virol.
69:2575-2583[Abstract/Free Full Text].
|
| 20.
|
Pushko, P.,
M. Sallberg,
G. Borisova,
U. Ruden,
V. Bichko,
B. Wahren,
P. Pumpens, and L. Magnius.
1994.
Identification of hepatitis B virus core protein regions exposed or internalized at the surface of HBcAg particles by scanning with monoclonal antibodies.
Virology
202:912-920[Medline].
|
| 21.
|
Salfeld, J.,
E. Pfaff,
M. Noah, and H. Schaller.
1989.
Antigenic determinants and functional domains in core antigen and e antigen from hepatitis B virus.
J. Virol.
63:798-808[Abstract/Free Full Text].
|
| 22.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 23.
|
Schodel, F.,
A. M. Moriarty,
D. L. Peterson,
J. A. Zheng,
J. L. Hughes,
H. Will,
D. J. Leturcq,
J. S. McGee, and D. R. Milich.
1992.
The position of heterologous epitopes inserted in hepatitis B virus core particles determines their immunogenicity.
J. Virol.
66:106-114[Abstract/Free Full Text].
|
| 24.
|
Seifer, M.,
S. Zhou, and D. N. Standring.
1993.
A micromolar pool of antigenically distinct precursors is required to initiate cooperative assembly of hepatitis B virus capsids in Xenopus oocytes.
J. Virol.
67:249-257[Abstract/Free Full Text].
|
| 25.
|
Tuttleman, J. S.,
C. Pourcel, and J. Summers.
1986.
Formation of the pool of covalently closed circular viral DNA in hepadnavirus-infected cells.
Cell
47:451-460[Medline].
|
| 26.
|
Ulrich, R.,
M. Nassal,
H. Meisel, and D. H. Kruger.
1998.
Core particles of hepatitis B virus as carrier for foreign epitopes.
Adv. Virus Res.
50:141-182[Medline].
|
| 27.
|
Valenzuela, P.,
M. Quiroga,
J. Zaldivar,
R. Gray, and W. Rutter.
1980.
The nucleotide sequence of the hepatitis B viral genome and the identification of the major viral genes.
UCLA Symp. Mol. Cell. Biol.
18:57-70.
|
| 28.
|
Wei, Y.,
J. E. Tavis, and D. Ganem.
1996.
Relationship between viral DNA synthesis and virion envelopment in hepatitis B viruses.
J. Virol.
70:6455-6458[Abstract].
|
| 29.
|
Yang, W.,
J. Guo,
Z. Ying,
S. Hua,
W. Dong, and H. Chen.
1994.
Capsid assembly and involved-function analysis of 12 core protein mutants of duck hepatitis B virus.
J. Virol.
68:338-345[Abstract/Free Full Text].
|
| 30.
|
Yuan, T. T.,
M. H. Lin,
S. M. Qiu, and C. Shih.
1998.
Functional characterization of naturally occurring variants of human hepatitis B virus containing the core internal deletion mutation.
J. Virol.
72:2168-2176[Abstract/Free Full Text].
|
| 31.
|
Zhou, S., and D. N. Standring.
1992.
Hepatitis B virus capsid particles are assembled from core-protein dimer precursors.
Proc. Natl. Acad. Sci. USA
89:10046-10050[Abstract/Free Full Text].
|
| 32.
|
Zlotnick, A.,
N. Cheng,
J. F. Conway,
F. P. Booy,
A. C. Steven,
S. J. Stahl, and P. T. Wingfield.
1996.
Dimorphism of hepatitis B virus capsids is strongly influenced by the C-terminus of the capsid protein.
Biochemistry
35:7412-7421[Medline].
|
Journal of Virology, March 1999, p. 2153-2160, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Broos, K., Janssens, M. E., De Goeyse, I., Vanlandschoot, P., Leroux-Roels, G., Geysen, D., Guisez, Y.
(2008). Comparison of Serum Humoral Responses Induced by Oral Immunization with the Hepatitis B Virus Core Antigen and the Cholera Toxin B Subunit. CVI
15: 852-858
[Abstract]
[Full Text]
-
Nassal, M., Leifer, I., Wingert, I., Dallmeier, K., Prinz, S., Vorreiter, J.
(2007). A Structural Model for Duck Hepatitis B Virus Core Protein Derived by Extensive Mutagenesis. J. Virol.
81: 13218-13229
[Abstract]
[Full Text]
-
Ponsel, D., Bruss, V.
(2002). Mapping of Amino Acid Side Chains on the Surface of Hepatitis B Virus Capsids Required for Envelopment and Virion Formation. J. Virol.
77: 416-422
[Abstract]
[Full Text]
-
Koschel, M., Oed, D., Gerelsaikhan, T., Thomssen, R., Bruss, V.
(2000). Hepatitis B Virus Core Gene Mutations Which Block Nucleocapsid Envelopment. J. Virol.
74: 1-7
[Abstract]
[Full Text]