Previous Article | Next Article ![]()
Journal of Virology, March 1999, p. 2064-2073, Vol. 73, No. 3
Unité de Biologie des Rétrovirus,
Institut Pasteur, 75724 Paris Cedex 15, France
Received 6 August 1998/Accepted 23 November 1998
We have previously demonstrated that interaction of infected
thymocytes with autologous thymic epithelial cells (TEC) is a prerequisite for a high level of human immunodeficiency virus type 1 (HIV-1) replication in thymocytes (M. Rothe, L. Chêne, M. Nugeyre, F. Barré-Sinoussi, and N. Israël, J. Virol.
72:5852-5861, 1998). We report here that this activation of HIV
replication takes place at the transcriptional level through activation
of the Rel/NF- One explanation (24, 61)
for the depletion in the number of CD4+ T lymphocytes,
which is the hallmark of human immunodeficiency virus (HIV) infection,
is the exhaustion of the T-cell turnover, which has to occur at a very
high rate to replace the cells permanently destroyed by the virus
(9). This high-turnover model does not take into account the
possible impairment of T-cell renewal caused by HIV infection of
primary lymphoid organs (20, 40). A number of studies
suggested a correlation between the rapid progression toward AIDS of
some pediatric seropositive patients and thymic alterations including a
profound disorganization of the epithelial network (28, 45,
47) and thymocyte depletion. Furthermore, antiretroviral
treatment applied to HIV-infected SCID-hu mice did not lead to a
complete renewal of the mature thymocyte population, underlining the
possibility of an impairment either of progenitor thymocyte function or
of stromal cell function (65). To better understand the
pathogenesis of HIV infection in the thymus, it is important to
identify the stimuli and mechanisms controlling the virus replication
and spreading within this organ. Most thymocytes are susceptible to HIV
infection in vitro (58-60) and in the SCID-hu mouse model
(2, 32, 54, 56). We previously determined the factors
physiologically involved in the control of HIV replication in
thymocytes. We showed that interaction of infected thymocytes with
thymic epithelial cells (TEC) is a prerequisite for a high level of HIV
replication in thymocytes. We determined that this cell-to-cell
contact, while necessary, is not per se the effector of HIV replication
but, rather, that soluble factors present in the coculture synergize to
induce HIV replication (48). Two types of factors were
identified according to their role, either in cell activation (such as
tumor necrosis factor [TNF], interleukin-1 [IL-1], and IL-6)
(67) or in cell proliferation or protection against
apoptosis (such as granulocyte-macrophage colony-stimulating factor
[GM-CSF]) (3, 27, 31).
The requirement for TNF and to a lesser extent for IL-1 in HIV
replication during the coculture of thymocytes and TEC suggests that a
major role of this interaction might be the induction of NF- To verify the hypothesis that thymic microenvironment controls HIV
replication at the transcriptional level, we used autologous mixed
culture of TEC and thymocytes as previously described (48). We first demonstrated that NF- We also showed that TNF could not replace the activating effect of the
coculture and that IL-7, a TEC-secreted factor crucial for thymopoiesis
(21, 22, 46), was required to obtain a strong and prolonged
TNF-induced NF- Taking the results together, we show here that cytokines provided by
different cell types within the thymus combine their effects to sustain
a high level of HIV transcription in thymocytes through NF- Reagents. (i) Antibodies.
To characterize both TEC and
thymocytes populations, the monoclonal antibodies (MAbs) used were
against CD3 (X35), CD7 (8H8,1), CD14 (RM052), CD83 (HB15A), cytokeratin
(KL1), and vimentin (vim3B4). Immunoglobulin G1 (IgG1) (MARK1) and
IgG2a (U7.27) were used as negative controls. All these antibodies were
purchased from Immunotech (Marseilles, France), except vim3B4, which
was purchased from Boehringer Mannheim (Meylan, France). Conjugated
MAbs, including CD4-phycoerythrin (PE) (13B8.2), CD8-fluorescein
isothicyanate (FITC) (B9.11), control IgG1-PE (679.1Mc7) and IgG1-FITC
(679.1Mc7), goat-anti-rabbit-FITC, and goat-anti-mouse-FITC, were
purchased from Immunotech.
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
High-Level Replication of Human Immunodeficiency
Virus in Thymocytes Requires NF-
B Activation through Interaction
with Thymic Epithelial Cells
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
B transcription factors. We first demonstrate that an
HIV-1 provirus (SF-2 strain) very effectively replicates in thymocytes
cocultured with TEC whereas this provirus, with
B sites deleted,
fails to replicate. We provide evidence that several NF-
B complexes
are constitutively found in the nuclei of thymocytes either freshly
isolated from the thymus or maintained in coculture with autologous or
heterologous TEC. The prevalent complex is the heterodimer p50-p65.
NF-
B activity is tightly correlated with the transcriptional
activity of a long terminal repeat (LTR) of HIV-1 transfected in
thymocytes. The cotransfection of this LTR with a mutated I
B
molecule formally demonstrates that LTR transactivation is regulated by
members of the Rel/NF-
B family in thymocytes. We also showed that
tumor necrosis factor (TNF) and to a lesser extent interleukin-1
(IL-1), secreted within the coculture, induce NF-
B activity and a
correlative LTR transactivation. However IL-7, a crucial factor for
thymopoiesis that is secreted mainly by TEC, is a necessary cofactor
for NF-
B activation elicited by TNF or IL-1. Together, these data
indicate that NF-
B activation, required for a high level of HIV
replication in thymocytes, is regulated in a specific manner in the
thymic microenvironment which provides the necessary cytokines: TNF,
IL-1, and IL-7.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
B
activation, which in turn would activate transcription from the two
B sites present in the HIV-1 long terminal repeat (LTR). NF-
B is
composed of homodimers and heterodimers of members of the Rel/NF-
B
family. To date, five proteins belonging to the NF-
B family have
been identified: p65, c-Rel, RelB, p50/p105, and p52/p100 (5, 33,
39). NF-
B dimers are sequestered in the cytosol of
unstimulated cells via interactions with a family of inhibitory
proteins called I
Bs (I
B
, I
B
, and I
B
)
(64). Following activation by various immune system and
inflammatory stimuli, I
B molecules are degraded through the
ubiquitin-proteasome pathway, thus allowing nuclear translocation of
NF-
B and activation of its target genes (39).
B activation is a prerequisite for a
high level of HIV replication in thymocytes, since a provirus with its
two
B sites deleted failed to replicate even in coculture with TEC.
We then dissected the mechanism underlying this activation process. We
first demonstrated that coculture with TEC led to the induction of
nuclear NF-
B complexes in thymocytes. The relevance of these NF-
B
complexes was demonstrated by specific inhibition of LTR
transactivation by a mutated form of the I
B
constitutively inhibiting NF-
B.
B activity. We provide correlative evidence that the
association of these two cytokines is sufficient to induce the
transactivation of the NF-
B-dependent HIV LTR.
B activation.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
(B-A15) was purchased from
Diaclone Research (Besançon, France). Mouse MAb against IL-6
(AH65) and mouse MAb against the
chain of the IL-7 receptor
(IL-7R
) CDw127 (R34.34) were purchased from Immunotech.
(ii) Cytokines.
Human recombinant cytokines GM-CSF, IL-1
,
and TNF
were purchased from Genzyme Corp. (Cambridge, Mass.). IL-6
and IL-7 were purchased from R&D Systems.
Plasmids.
All reporter constructs and plasmids used in this
work have been previously described. Briefly, the LTR-luc construct
carries the luciferase reporter gene under the control of the U3R
(BglII-HindIII fragment) of the
HIV-1B-LAI LTR (19). The 3Enh-TK-luc construct contains three copies of a synthetic oligonucleotide encompassing the
two 10-bp repeats of the HIV-1B-LAI enhancer (
107 to
76) cloned upstream of the truncated thymidine kinase (TK) promoter (
105 to +51) of herpes simplex virus in a TK-luc expression vector (19). LTR
B was obtained by insertion into the
pC-luciferase plasmid (52) of the
XhoI-HindIII fragment of the
HIV-1B-LAI LTR from the original construct of Leonard et
al. with the two
B motifs deleted (35). The CMV-tat
plasmid carries the tat cDNA inserted downstream of the
human cytomegalovirus (CMV) immediate-early enhancer/promoter
(19). The EF1-
gal construct, containing the
-galactosidase reporter gene under the control of the basal promoter of elongation factor EF1
, was kindly provided by S. Mémet
(Pasteur Institute, Paris, France). The construct I
B
-DN, carrying
the cDNA of I
B
protein mutated on serines 32 and 36 under the
control of the CMV early promoter, was kindly provided by N. Rice
(63). RcCMV (Invitrogen BV) was the corresponding control
vector which contains no cDNA sequence.
Cells and culture conditions. (i) Isolation of enriched human
populations of TEC and thymocytes.
Fresh thymus fragments were
obtained during elective cardiac surgery on HIV-1-seronegative children
(aged 6 days to 24 months). The enrichment procedures for thymocytes
and TEC have been described previously (48). Cells were then
characterized at day 3 after thymus excision, using different selective
markers (with the various antibodies listed above), indicating that
these populations of TEC and thymocytes were respectively purified at
95 and 99% (48). Prior to mixed culture, TEC were
maintained in a selective medium (McCoy's 5A [GIBCO] containing 10%
fetal calf serum [FCS], 1 mM L-Glu, 50 µg of
penicillin-streptomycin per ml, 100 µg of neomycin per ml, 0.25 µg
of Fungizone per ml, 20 ng of epidermal growth factor per ml, 5 × 10
9 M cholera toxin, 500 ng of hydrocortisone per ml, and
5 × 10
5 M
-mercaptoethanol). Thymocytes were
stored at +4°C in McCoy's 5A supplemented with antibiotics,
L-glutamine, 10 mM HEPES, and 20% FCS.
(ii) Mixed culture of TEC and thymocytes.
Autologous or
heterologous cocultures of TEC and infected or control thymocytes were
carried out 3 days after thymic excision either under conditions
permitting cell-to-cell contact or in transwell chambers (0.45-µm
pore diameter). The ratio of TEC to thymocytes was 1/25. The coculture
medium was McCoy's 5A supplemented with antibiotics, 1 mM
L-glutamine, 10 mM HEPES, and 10% FCS. IL-6 and GM-CSF
were used at 10 ng/ml, TNF-
and IL-1
were used at 5 ng/ml, and
IL-7 was used at 1 ng/ml. MAb against IL-6 was used at 20 µg/ml, and
polyclonal antibody against TNF was used at a serum dilution of 1/300.
IL-1ra was used at 20 µg/ml. Cytokines or cytokine inhibitors were
added at the start of the coculture, except antibody against IL-7R
.
The thymocytes were preincubated with the antibody against IL-7R
(5 µg/ml per 8 × 106 thymocytes) for 6 h at 4°C
before their coculture with TEC. In some experiments, the thymocyte
culture was supplemented with 50% (vol/vol) noninfected TEC
conditioned medium (CM) obtained after 72 h of TEC culture and
then centrifuged and filtered through a 0.45-µm-pore-size membrane.
In experiments with IL-7 antibody, TEC CM was preincubated for 6 h
at 4°C with 10 µg of the antibody per ml before the onset of
thymocyte culture.
Immunostaining and cytofluorometry. Indirect immunostaining with antibodies against cytokeratin and vimentin was performed in Lab-Tech chambers (Corning Costar Corp., Cambridge, Mass.) on cells permeabilized by acetone-methanol treatment (6). Other direct or indirect immunostaining was analyzed by cytofluorometry with an EPICS Profile II fluorometer (Coulter).
Virus and infection procedure.
HIV-1wt and
HIV-1
B-mut were obtained after transfection of Cos-7
cells with the corresponding provirus constructs (4) by
using standard methods with Lipofectamine (GIBCO). HIV-1wt was obtained after transfection of the entire sequence (5'-3') of the
molecular clone HIV-1 SF2 (48). HIV
B-mut,
obtained in the same way, differed from the wild-type construct by
having a 5-bp substitution in the enhancer region of the viral LTR
(17). The p24gag protein was
determined in cell-free supernatants by an enzyme-linked immunosorbent
assay (ELAVIA; Diagnostics Pasteur) and was used in the infection
procedure immediately. All infections were standardized to the
p24gag levels: 10 ng of
p24gag was used to infect 106
thymocytes. Briefly, thymocytes were washed in RPMI and exposed either
to HIV-1wt or to HIV
B-mut for 1 h at
37°C. After infection, the thymocytes were washed three times and
cultured at a density of 8 × 106 per well (12-well
plates) in 2 ml of medium (McCoy's 5A supplemented with antibiotics,
10% FCS, and 1 mM L-Glu) or cocultured with 5 × 104 TEC. On days 6, 8, 11, 13, 15, and 18 after the start
of the coculture, 300 µl of supernatant were collected to determine
the p24gag concentration and was replaced by the
same volume of fresh medium.
Transfection procedure.
Thymocytes were maintained for 0 to
48 h in different culture or coculture conditions prior to
transfection. They were then transfected with 20 to 25 µg of
plasmid(s) by electroporation in MacCoy's 5A medium with 20% FCS. A
single pulse at 875 V/cm and 960 µF was performed. Expression vectors
of the luciferase reporter gene were used, except for EF1-
gal,
expressing
-galactosidase, which was used for standardization of
transfections. After transfection, the thymocytes were washed and were
then returned for an additional 20 h to the previous dishes
containing the conditioned medium of 48 h of culture. At 20 h
posttransfection, the luciferase and
-galactosidase activities were
detected in the cell lysates. Luciferase activity was measured by
standard procedures, as previously described (52), and
-galactosidase activity was measured by using the luminescent
-galactosidase genetic reporter system II (Clontech, Palo Alto,
Calif.). Normalized luciferase activity represents the ratio of
luciferase to
-galactosidase activities.
Electrophoretic mobility shift assay (EMSA). Total extracts were performed as previously described (26). Briefly, after 5 × 106 to 10 × 106 thymocytes cultured under different conditions were harvested, they were washed once in PBS 1×; 30 µl of lysis buffer was added, centrifugation (13,220 × g for 10 min) was performed 10 min later, and the protein concentration in the supernatant was quantified by using the Bradford reagent (Bio-Rad Laboratories, Ivry sur Seine, France). For the band shift assay, the binding-reaction mixture was prepared by adding, in the following order, binding buffer (20 mM HEPES, 2 mM dithiothreitol, 60 mM KCl, 0.01% Nonidet P-40, 0.1 mg of bovine serum albumin/ml, 4% Ficoll), 0.4 µg of sonicated salmon sperm, 10 µg of protein extract, and 30,000 cpm of 32P-labelled DNA probe corresponding to 0.25 ng of probe. The sequence of the oligonucleotide used is:
5' CTAGACGGGGATTTCCGAGAGGT TGCCCCTAAAGGCTCTCCAGATC 5' The NF-
B consensus binding sequence is in boldface type.
Specific binding was controlled by competition with a 40-fold (10-ng)
excess of the same nonlabeled oligonucleotide, added to the protein
extract before the binding reaction was started. To identify the
subunits constituting NF-
B complexes, specific antibodies against
p50, p52, p65, c-Rel, and RelB were used. The p50, p52, p65, and c-Rel
antibodies were a kind gift from A. Israël (Pasteur Institute,
Paris, France), and anti-RelB was provided by Santa Cruz Biotechnology
(Santa Cruz, Calif.). Antibodies were added to the protein extract, and
the mixture was allowed to stand for 5 min at 4°C before incubation
with the radiolabeled probe.
| |
RESULTS |
|---|
|
|
|---|
Coculture-induced activation of HIV replication requires the two
B sites within the HIV-1 LTR.
In an attempt to evaluate the
relevance of NF-
B in the activation of HIV-1 replication in
thymocytes, we compared the replication capacity of a virus mutated in
the two
B sites within the LTR (4, 18) with that of the
corresponding wild-type virus. Wild-type and mutated (
B) viruses
were obtained from the supernatant of Cos-7 cells transfected with the
corresponding provirus constructs. We then carried out infection of
thymocytes and cocultured them with TEC under conditions previously
described by Rothe et al. (48). As shown in Fig.
1, the 
B virus is unable to
replicate in thymocytes even in the presence of TEC, in contrast to the wild-type.
|
B activity is required for HIV
replication in thymocytes and that this activation is provided by their
interaction with TEC.
Interaction with TEC permanently induces NF-
B activity in
thymocytes.
We then determined whether NF-
B activity was
present in the human thymus as a whole by performing EMSAs with protein
extract from a thymus fragment immediately crushed after surgery and a probe representing the HIV-1 LTR
B-derived motifs. As shown in Fig.
2A (lane 2 [control]), we observed a
specific binding activity of NF-
B complexes in this whole-cell
extract. This activity was also observed in whole-cell extracts from
freshly isolated thymocytes (lane 4 [control]). The NF-
B activity,
observed in freshly isolated thymocytes, was very probably present in
these cells within the thymus (since it was also detected in the thymus
as a whole) and was not induced by the enrichment procedure used for
these cells. The NF-
B activity represented specific DNA binding
activities since they were competed by an excess of a nonradiolabeled
B probe (lanes 1 and 3).
|
B activity decreased progressively when thymocytes were
cultured alone (Fig. 2A, lanes 5 and 6). The kinetics of this decrease
in culture varies according to the different preparations of thymocytes
obtained from different thymuses. The minimal levels were observed at
between 24 and 48 h of culture. In any case, this activity was
maintained when thymocytes were cocultivated with autologous TEC (lanes
7 and 8). The same result was obtained with either autologous (from 3 thymuses) or heterologous (from 10 thymuses) TEC, indicating that
induction of NF-
B activity did not result from cellular activation
caused by a mixed lymphocyte reaction but was due to physiological
interactions between thymocytes and TEC. These results demonstrate that
coculture with TEC induces a sustained NF-
B activation in thymocytes.
We then characterized the NF-
B complexes which bind to the HIV
enhancer element by using antibodies against each subunit of the
NF-
B family (p50, p52, p65, RelB, and c-Rel). As shown in Fig. 2B,
in the whole-thymus extract, an antibody against the p50 subunit
abolished the binding of most of the complexes observed, an antibody
against p65 abolished the very faint band corresponding to the upper
complex, and an antibody against RelB abolished the binding of the
upper and intermediate complexes. The antibody against c-Rel did not
significantly modify the binding of any of these complexes. These data
suggest that the lowest complex is p50-p50, the intermediate and major
complex is p50-RelB, and the upper complex probably contains p50, p52
(as a minor component), and p65. As also shown in Fig. 2B, in freshly
isolated thymocytes p50-p65 was the prevalent complex, and coculture
with TEC maintained this complex and to a lesser extent the p50-RelB one.
The presence of NF-
B binding activity in freshly isolated
thymocytes or in thymocytes cultured with TEC is responsible for a high
HIV-1 LTR activity.
We then determined whether the sustained
NF-
B activity observed in thymocytes, either freshly isolated or
cocultured with TEC, correlated with the level of LTR activity in
thymocytes. For this purpose, we determined, in parallel experiments,
NF-
B DNA binding activity and the level of luciferase activity of
the LTR-luc construct transfected in thymocytes. A CMV-tat construct was cotransfected with LTR-luc since expression of the powerful viral
transactivator Tat emphasizes the magnitude of NF-
B-dependent transactivation of the LTR (15). EF1-
gal plasmid
containing the reporter gene
-galactosidase under the control of the
basal promoter of the elongation factor EF1
was also cotransfected to normalize the transfection efficiencies.
gal. The thymocytes were collected from the culture dishes (then
containing a 48-h conditioned medium) for the time of electroporation and were then returned to this conditioned medium for an additional 20 h. LTR activity, expressed as normalized luciferase activity, was then determined. As shown in Fig. 3,
LTR activity correlated with the level of NF-
B binding activity. LTR
activity was high in freshly isolated thymocytes and progressively
decreased (for 24 or 48 h) when these cells were cultured alone,
whereas it was maintained at a high level in those cocultivated with
TEC (for 48 h). However, whereas NF-
B binding activity was
higher in freshly isolated thymocytes than in thymocytes cocultivated
with TEC, LTR activity was comparable in the two cell systems. This can be explained by the fact that NF-
B activity was determined just after thymocyte isolation whereas the luciferase assay was performed 20 h after transfection. This interval is sufficient to allow a
significant decrease of NF-
B binding activity in freshly isolated thymocytes cultured in the absence of TEC.
|
B sites were required for the high
transcriptional activity of the LTR in freshly isolated thymocytes or
in thymocytes in coculture with TEC. As shown in Fig.
4A, the activity of an LTR-
B
mutated in the two
B sites was 5- to 10-fold lower than that
observed with the wild-type LTR construct. The role of the
B-responsive element was further confirmed by comparing the
luciferase activity obtained with the 3Enh-TK-luc construct to that
obtained with the control vector TK-luc (Fig. 4B). In this case, a 10- to 15-fold difference was observed between the two constructs.
|
B was specifically
responsible for transactivation of the HIV-1 LTR by cotransfecting freshly isolated thymocytes with LTR-luc, CMV-tat, and an expression vector encoding the I
B
inhibitory protein mutated on serines 32 and 36 (I
B
-DN) (63). These mutations prevent
phosphorylation and subsequent degradation of I
B
. I
B
-DN
behaves as a specific and constitutive inhibitor of NF-
B activity.
As a control, we replaced I
B
-DN by the vector RcCMV. Indeed,
cotransfection of increasing amounts of this mutant progressively
reduced the transcriptional activity of LTR to a value comparable to
that obtained with the LTR-
B in freshly isolated thymocytes (Fig.
4C) as well as in thymocytes cocultured with TEC (data not shown). As
expected, I
B
-DN did not modify the transcriptional activity of
the LTR-
B promoter (Fig. 4D), confirming against that it
specifically targets NF-
B on the wild-type LTR.
Taken together, these experiments provide evidence of a permanent
induction of NF-
B activity leading to a permanent LTR
transactivation in freshly isolated thymocytes or in thymocytes
cocultured with TEC.
NF-
B activation induced by the interaction of thymocytes with
TEC is mediated mainly by TNF and to a lesser extent by IL-1, but
NF-
B inducibility requires IL-7.
TNF and IL-1 are well-known
triggers of NF-
B activation (10, 26, 44). We have
recently shown that the strong activation of HIV replication in
thymocytes, elicited by their interaction with TEC, is mediated mainly
by soluble factors including IL-1, TNF, IL-6, and GM-CSF
(48). Therefore, we first evaluated whether these cytokines,
particularly IL-1 and TNF, were involved in the permanent induction of
NF-
B observed in thymocytes cocultured with TEC. For this purpose,
we performed cocultures in transwell chambers to prevent cell-to-cell
contact but to allow the exchange of soluble factors. At the start of
the coculture, neutralizing antibodies against IL-1 and TNF were added
to test their ability to block NF-
B activation. An antagonist of the
IL-1 receptor (IL-1ra) was also used. A neutralizing antibody against
IL-6 was used as a negative control, since IL-6 is not an NF-
B inducer.
B activation was sustained by the coculture even in the absence
of cell-to-cell contact, indicating that soluble factors were mainly
involved. As expected, antibody against IL-6 did not reduce NF-
B
activation (lane 6). The effects of IL-1ra or antibody against IL-1
were very modest (lanes 7 and 8). In contrast, anti-TNF almost
completely abolished NF-
B activity in thymocytes (lane 5). The fact
that the extent of inhibition was about the same with anti-TNF as with
the combination of anti-TNF, IL-1ra, and anti-IL-6 in the presence or
absence of cell-to-cell contact (lanes 9 and 11) strongly suggests that TNF is the major inducer of NF-
B activation within the coculture.
|
was sufficient to induce NF-
B
binding activity in thymocytes cultured alone. As shown in Fig.
6, IL-1
had a weak stimulating effect
on NF-
B activity in thymocytes (lane 4), in contrast to TNF, which
was able by itself to sustain a high NF-
B binding activity in
thymocytes cultured for 30 h (lane 3). However, the level of
NF-
B activity obtained with TNF was lower than that observed in
freshly isolated thymocytes (compare lane 3 to lane 1). In addition,
TNF was not efficient in maintaining long-term (for instance, 60-h)
NF-
B activity (lane 6). This suggested that other factors within the microenvironment might be required to maintain NF-
B activity in
thymocytes. This hypothesis was confirmed by the fact that TEC CM, when
supplemented with TNF, was able to maintain NF-
B activity for
60 h (lane 9) whereas TEC CM alone had no effect (lane 8). We
conclude that TNF is mainly required to maintain NF-
B activity in
thymocytes but that its effect requires another factor(s) secreted by
TEC.
|
chain of the IL-7 receptor before coculture. The role of
IL-7 was also confirmed by the fact that IL-7 elicited a strong
costimulatory effect with TNF and to a lesser extent with IL-1 (Fig.
6C, lanes 6 and 7) whereas IL-6 and GM-CSF, which are secreted by TEC
(34) and involved in HIV replication, did not modify the
NF-
B binding activity induced by IL-1 or TNF (lane 4).
NF-
B activation was also observed when thymocytes were treated with
IL-7 alone (Fig. 6C, lane 5, and Fig. 6D, lane 2). However, antibodies
against TNF and IL-1, added simultaneously with IL-7 at the start of
the culture (Fig. 6D, lane 3), prevented this induction, again
indicating that IL-7 plays the role of a cofactor which amplifies the
effect of low levels of TNF (and IL-1) secreted by thymocytes.
Together, these data argue for a major role of TNF in maintaining
NF-
B activation in thymocytes, but this activation requires IL-7,
which is secreted mainly by TEC.
We then determined whether HIV LTR transactivation in thymocytes
was also dependent upon the stimulation by these cytokines. To
emphasize the NF-
B-dependent transactivation, we used a combination of IL-1 and TNF (termed IL-1-TNF), since their pathways of NF-
B activation are known to be synergistic (44). Other
combinations of cytokines were also used, as shown in Fig.
7. Thymocytes were maintained in culture
either unstimulated or treated with the various cytokines for 48 h
prior to transfection. Cotransfection was then performed with CMV-tat,
EF1-
gal, and either LTR-luc or LTR
B-luc. The transfected
thymocytes were then returned for an additional 20 h to the
previous conditioned medium prior to the determination of reporter gene
activities. The activities of the two LTRs, wild type and 
B, were
of the same level in nonactivated Jurkat cells (data not shown) whereas
the activity of the wild-type LTR was 3.5-fold higher than that of
LTR
B in thymocytes (considered the basal activity of the LTR,
independent of NF-
B activation) (Fig. 7A). These data confirmed that
thymocytes left unstimulated even for 48 h were not completely
devoid of NF-
B activity (see also the LTR and NF-
B activity
[Fig. 3]). IL-1-TNF stimulation further enhanced this level
(ninefold). The transactivation level observed with IL-1-TNF was not
further modified by addition of IL-6 and GM-CSF. Only addition of IL-7
to IL-1-TNF led to a dramatic increase in LTR transactivation
(30-fold). However, it should be noted that IL-7 alone also increased
HIV-1 LTR activity (24-fold). This is in agreement with the significant
NF-
B activity elicited by IL-7 acting as a cofactor of low levels of
TNF (and IL-1) constitutively produced by thymocytes (Fig. 6C, lanes 5 through 7). As expected, the effect of TNF-IL-1 required
B sites, since the LTR
B was unresponsive. In contrast, IL-7 triggered LTR
B transactivation, although less efficiently than that of the
wild-type LTR, indicating that this cytokine acts through both
NF-
B-dependent and NF-
B-independent pathways.
|
B-independent transactivation induced
by IL-7 correlates with the weak induction of transcriptional activity
of LTR
B in thymocytes during their interaction with TEC and
suggests that secretion of IL-7 by TEC is mainly responsible for this
effect. However, the induction of the transcriptional activity of the
wild-type LTR by TEC is much more efficient than that of the
LTR
B.
| |
DISCUSSION |
|---|
|
|
|---|
We report here that NF-
B activation is a major prerequisite for
a high level of HIV-1 replication in thymocytes and that the
interaction of infected thymocytes with TEC is necessary for such an
induction. This conclusion was drawn from the fact that an HIV-1
provirus with its
B sites deleted failed to replicate in thymocytes
whereas the wild-type provirus exhibited a high level of replication,
although only in the presence of TEC. The active HIV replication
observed within the thymus (58-60) thus suggested that
NF-
B was permanently induced in the thymic microenvironment. We
confirmed that a high level of NF-
B binding activity was present within this organ, taken as a whole. This is in agreement with the
detection of nuclear NF-
B complexes in vivo in human thymus by in
situ immunostaining (11). We also detected NF-
B binding activity in freshly isolated thymocytes, as assessed by the presence of
distinct NF-
B complexes. p50-p65 was the prevalent complex, but
p50-p50 and p50-RelB were also present. p52-containing complexes, although minor, were also detected. The difference between whole thymus
and thymocytes suggests that the major RelB complexes detected in whole
thymus were mainly derived from TEC, confirming previous reports of
results obtained with murine thymus (7, 37, 62).
We then showed that NF-
B activity observed in freshly isolated
thymocytes was the result of specific signals delivered within the
microenvironment. This activity, which is mainly due to p50-p65 complexes, decreased when thymocytes were cultured alone. Furthermore, we demonstrated that at least part of the activation signals comes from
the interaction with TEC, since addition of TEC to thymocyte culture
prevented this progressive loss of activation. The same effect was
observed with autologous and heterologous TEC, excluding the potential
involvement of a mixed lymphocyte reaction. However, compared to that
observed in freshly isolated thymocytes, the maintenance of NF-
B
activity during coculture with TEC was less efficient, but the nature
and ratio of the complexes were similar. Therefore, we could not
exclude the possible role of other cells or factors within the
microenvironment in strengthening NF-
B activity. We can also argue
that disruption of thymocyte-TEC interaction during thymus preparation
might not be immediately and efficiently restored by mixing these two
cell subpopulations in the same culture dish, particularly with regard
to the necessary accumulation of soluble factors.
The high level of active NF-
B complexes, including p50-p65, in
freshly isolated thymocytes as well as in thymocytes cocultured with
TEC was postulated to correlate with a strong activation of the HIV
LTR. By using transfection assays, we showed that the decrease of
NF-
B activity in thymocytes in culture was accompanied by a decrease
of LTR activity, except in the presence of TEC, which maintained a high
level of both NF-
B and LTR activity. We also confirmed that this
high activity of the LTR was dependent upon
B binding sites since it
was strongly decreased by deletion of these sites (LTR
B-luc). The
involvement of the
B responsive element was further confirmed by
comparing the luciferase activity obtained with the 3Enh-TK-luc
construct with that obtained with the control vector TK-luc.
It should be noted that the migration of the activity indicated as n.s
1 in Fig. 5, observed in EMSA, was not significantly modified by
competition with an excess of the unlabeled probe. In consequence, this
activity was indicated as nonspecific. However, it was shown to be
modulated by certain cytokines of the coculture (Fig. 5 and 6). This
activity is likely to be KBF2/RBP, which has been shown to bind
B
sites (25), albeit with an affinity much lower than that of
NF-
B (25a).
Since certain nucleotides of the
B element within the LTR were found
to participate in the binding of other transcription factors such as
RBP/KBF2 (25), NF-AT (29), ets (53),
and GABP (13), it was necessary to formally demonstrate that
LTR transactivation was regulated by members of the Rel/NF-
B family. We therefore cotransfected a mutated I
B
molecule which cannot be
phosphorylated and degraded (63) together with an HIV LTR. Overexpression of this mutated form of I
B
, acting in competition with endogenous I
B
, led to a dose-dependent decrease in LTR activity. The highest concentration of I
B
-DN decreased the
activity of the wild-type LTR to a value comparable to that obtained
with the LTR-
B. These data confirm that enhanced transactivation of the LTR is triggered by the Rel/NF-
B family and that NF-
B activity in thymocytes is not constitutive but results from a permanent
activation of NF-
B.
The major role of soluble factors in NF-
B activation was first
demonstrated by the fact that thymocyte-TEC interaction was efficient
even in absence of cell-to-cell contact. This does not exclude a role
of the contact in sustaining the levels of these cytokines. We showed
that TNF, secreted mainly by thymocytes, represented a major
requirement for NF-
B activation, since antibodies against TNF
abrogated the inductive effect of the coculture. IL-1, produced by both
TEC and thymocytes (41, 66), modestly participated in this
induction. Unexpectedly, these two cytokines were not sufficient to
maintain a long-term activation of NF-
B in culture. We then
demonstrated that IL-7, secreted mainly by TEC (42, 49),
induced an NF-
B activity in thymocytes by acting as a cofactor of
low levels of TNF and IL-1 constitutively produced by thymocytes
(12, 16, 66). This was confirmed by the fact that the
IL-7-induced NF-
B activity could be abolished by antibodies against
IL-1 and TNF. Together, these data lead to the conclusion that TNF is
the major inducer of NF-
B activity in thymocytes and that IL-1 has a
modest synergistic effect. IL-7 is required for the maintenance of this
activity, acting as an important cofactor. It is at first sight
surprising that in our previous study (48), thymocytes were
capable of replicating the virus in vitro in the absence of IL-7
addition (in the presence of TNF, IL-1, GM-CSF, and IL-6). The possible
explanation is that IL-7 was expressed at low levels in the thymocyte
culture. IL-7 might be provided either by the thymocytes themselves,
which express at least detectable IL-7 mRNA (41, 66), or by
stromal cells (42, 49), which might remain at a low level in
the thymocyte preparation, although the purity of the thymocyte
population was estimated to be 99%. This low level of IL-7 might then
be sufficient to permit NF-
B activity in the presence of saturating
concentrations of TNF and IL-1 added to the thymocyte culture medium.
This hypothesis is in agreement with the fact that HIV-1 replication in
thymocytes cultured with IL-1, IL-6, TNF, and GM-CSF or cocultured with
TEC was delayed when an anti-human IL-7 antiserum was added at the start of the culture (data not shown).
Nevertheless, the level of replication obtained in thymocytes in vitro
when IL-7 was used with TNF, IL-1, GM-CSF, and IL-6 was much higher
than in absence of IL-7 (data not shown). This is in agreement with the
transfection experiments performed on thymocytes after 48 h in
culture, showing that the addition of IL-7 to IL-1-TNF led to a
dramatic increase in LTR transactivation. Several hypotheses might be
proposed to explain the role of IL-7 in the NF-
B-dependent pathway.
IL-7 increases the activity of the AP1 transcription factor
(17), which is able to physically interact and synergize
with NF-
B (55). The increase in AP1 activity could also
directly upregulate the expression of the TNF receptor p75, since an
AP1-responsive element is present in the 5' regulatory region of its
gene (51). This last hypothesis is difficult to demonstrate
by using the total freshly isolated thymocyte population, in which the
number of thymocytes expressing this receptor never exceeded 3% by
cytofluorometric analysis (data not shown). Indeed, IL-7 receptor is
restricted to certain subsets of thymocytes (57). Work to
identify the subpopulations of thymocytes responsible for the high
level of HIV replication is in progress in our laboratory. Use of these
subpopulations, which might be characterized by the expression of both
IL-7 and TNF receptors (and to a lesser extent IL-1 receptor), will
allow us to determine whether IL-7 modulates the expression of the TNF
p75 receptor.
Interestingly, IL-7 also increases the activity of the LTR
B
construct, suggesting that this cytokine is also involved in an
NF-
B-independent pathway. In addition to AP1, IL-7 activates several
other transcription factors including NF-AT (17), Stat 3, and Stat 5 (36, 38). By systematic mutagenesis within the LTR, we are in the process of identifying the sequence responsible for
this effect. The magnitude of transactivation through this pathway is
much lower than that observed through the NF-
B one. This is very
possibly the reason why no virus replication was detectable in the
absence of
B sites. Together, these data suggest that NF-
B
activity is not strictly necessary to induce LTR transactivation but is
necessary to attain a high level of HIV replication. Similar conclusions have been reached concerning the involvement of NF-
B in
HIV replication in T lymphocytes (8). It is worth noting that the regulation of NF-
B-dependent transactivation of the LTR is
highly dependent on the NF-
B complexes present in a given cell and
in its microenvironment. For instance, in peripheral resting T
lymphocytes, an inactive p50 homodimer constitutively occupies the
B
sites, preventing LTR activation by p50-p65 induced by TNF or IL-1. The
major stimulus responsible for an NF-
B-dependent transactivation is
the recognition of a specific antigen (19) permitting an
induction of Bcl-3, a coactivator (14) which generates, with
p50 homodimers, an active trimer on the HIV-LTR (unpublished data). In
contrast, in thymocytes p50 homodimers are underrepresented with
respect to p50-p65 heterodimers, which are permanently activated by TNF
and IL-1 within the thymic microenvironment. Under these conditions,
TNF and IL-1 induce LTR transactivation. Another specificity of the
thymocytes and the thymic microenvironment is that these cytokines
cannot efficiently function without IL-7. Together with our previous
report, we demonstrate here that to sustain efficient HIV replication,
thymocytes require cytokines responsible for their activation through
NF-
B (TNF and IL-1) and for their survival (GM-CSF) (27,
30), as well as a cytokine which seems to fulfill both functions
(IL-7) (1, 23). Through these cytokines, the thymus behaves
as a virus reservoir, since it favors the maintenance of a high viral
load in certain subpopulations of thymocytes (8a), as well
as a prolonged life span of these thymocytes.
| |
ACKNOWLEDGMENTS |
|---|
We thank Sonia Berrih-Aknin and Claude Planché (hospital
Marie Lannelongue, Le Plessis-Robinson, France) for providing us with
thymuses from infants undergoing cardiac surgery. We thank A. Israël for providing us with antibodies against NF-
B subunits and for a review of the manuscript. We thank N. Rice for providing us
with I
B
-DN expression vector, and we thank S. Mémet for the
EF1
-
gal vector.
This work was supported by the Agence Nationale pour la Recherche sur le SIDA (ANRS). L. Chêne is a fellow of the French Ministry of Education and Research (MENESR).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Unité de Biologie des Rétrovirus, Institut Pasteur, 28 rue du Dr Roux, 75724 Paris Cedex 15, France. Phone: 33 1 45 68 89 44/87 33. Fax: 33 1 45 68 89 57. E-mail: nisrael{at}pasteur.fr.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Akashi, K., M. Kondo, U. von Freeden, U. Jeffry, R. Murray, and I. L. Weissman. 1997. Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice. Cell 89:1033-1041[Medline]. |
| 2. | Autran, B., P. Guiet, M. Raphael, M. Grandadam, H. Agut, D. Candotti, P. Grenot, F. Puech, P. Debré, and J.-Y. Cesbron. 1996. Thymocytes and thymic microenvironment alterations during a systemic HIV infection in a severe combined immunodeficient mouse model. AIDS 10:717-727[Medline]. |
| 3. | Bach, M. K., and J. R. Brashler. 1995. Evidence that granulocyte/macrophage-colony-stimulating factor and interferon-gamma maintain the viability of human peripheral blood monocytes in part by their suppression of IL-10 production. Int. Arch. Allergy Immunol. 107:90-92[Medline]. |
| 4. |
Bachelerie, F.,
M. S. Rodriguez,
C. Dargemont,
D. Rousset,
D. Thomas,
J. L. Virelizier, and F. Arenzana-Seisdedos.
1997.
Nuclear export signal of I B interferes with the Rev-dependent posttranscriptional regulation of human immunodeficiency virus type I.
J. Cell Sci.
110:2883-2893[Abstract].
|
| 5. | Baldwin, A. S. 1996. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649-683[Medline]. |
| 6. | Braun, J., H. Valentin, M. T. Nugeyre, H. Ohayon, P. Gounon, and S. F. Barré-Sinoussi. 1996. Productive and persistent infection of human thymic epithelial cells in vitro with HIV-1. Virology 225:413-418[Medline]. |
| 7. | Burkly, L., C. Hession, L. Ogata, C. Reilly, L. A. Marconi, D. Olson, R. Tizard, R. Cate, and D. Lo. 1995. Expression of relB is required for the development of thymic medulla and dendritic cells. Nature 373:531-536[Medline]. |
| 8. |
Chen, B. K.,
M. B. Feinberg, and D. Baltimore.
1997.
The B sites in the human immunodeficiency virus type 1 long terminal repeat enhance virus replication yet are not absolutely required for viral growth.
J. Virol.
71:5495-5504[Abstract].
|
| 8a. | Chêne, L., et al. Unpublished data. |
| 9. | Coffin, J. M. 1995. HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy. Science 267:483-489. |
| 10. |
Duh, E. J.,
W. J. Maury,
T. M. Folks,
A. S. Fauci, and A. B. Rabson.
1989.
Tumor necrosis factor activates human immunodeficiency virus type 1 through induction of nuclear factor binding to the NF- B sites in the long terminal repeat.
Proc. Natl. Acad. Sci. USA
86:5974-5978 |
| 11. | Feuillard, J., C. Dargemont, V. Ferreira, N. Tarantino, P. Debre, M. Raphael, and M. Korner. 1997. Nuclear Rel-A and c-Rel protein complexes are differentially distributed within human thymocytes. J. Immunol. 158:2585-2591[Abstract]. |
| 12. | Fisher, M., I. MacNeil, T. Suda, J. Cupp, K. Shortman, and A. Zlotnik. 1991. Cytokines production by mature and immature thymocytes. J. Immunol. 146:3452-3456[Abstract]. |
| 13. | Flory, E., A. Hoffmeyer, U. Smola, U. R. Rapp, and J. T. Bruder. 1996. Raf-1 kinase targets GA-binding protein in transcriptional regulation of the human immunodeficiency virus type 1 promoter. J. Virol. 70:2260-2268[Abstract]. |
| 14. |
Fujita, T.,
G. P. Nolan,
H. C. Liou,
M. L. Scott, and D. Baltimore.
1993.
The candidate proto oncogene Bcl-3 encodes a transcriptional coactivator that activates through NF-kappa B p50 homodimers.
Genes Dev.
7:1354-1363 |
| 15. | Gaynor, R. B. 1995. Regulation of HIV-1 gene expression by the transactivator protein Tat. Curr. Top. Microbiol. Immunol. 193:51-77[Medline]. |
| 16. |
Giroir, B. P.,
T. Brown, and B. Beutler.
1992.
Constitutive synthesis of tumor necrosis factor in the thymus.
Proc. Natl. Acad. Sci. USA
89:4864-4868 |
| 17. |
Gringhuis, S. I.,
L. Deleij,
E. W. Verschuren,
P. Borger, and E. Vellenga.
1997.
Interleukin-7 upregulates the interleukin-2-gene expression in activated human T lymphocytes at the transcriptional level by enhancing the DNA binding activities of both nuclear factor of activated T cells and activator protein-1.
Blood
90:2690-2700 |
| 18. | Harrich, D., J. Garcia, R. Mitsuyasu, and R. Gaynor. 1990. TAR independent activation of the human immunodeficiency virus in phorbol ester stimulated T lymphocytes. EMBO J. 9:4417-4423[Medline]. |
| 19. |
Hazan, U.,
D. Thomas,
J. Alcami,
F. Bachelerie,
N. Israël,
H. Yssel,
J.-L. Virelizier, and F. Arenzana-Seisdedos.
1990.
Stimulation of a human T-cell clone with anti-CD3 or tumor necrosis factor induces NF- B translocation but not human immunodeficiency virus 1 enhancer-dependent transcription.
Proc. Natl. Acad. Sci. USA
87:7861-7865 |
| 20. | Hellerstein, M. K., and J. M. McCune. 1997. T cell turnover in HIV-1 disease. Immunity 7:583-589[Medline]. |
| 21. | Herbelin, A., F. Machavoine, E. Schneider, M. Papiernik, and M. Dy. 1992. IL-7 is requisite for IL-1-induced thymocyte proliferation. Involvement of IL-7 in the synergistic effects of granulocyte-macrophage colony-stimulating factor or tumor necrosis factor with IL-1. J. Immunol. 148:99-105[Abstract]. |
| 22. | Herbelin, A., F. Machavoine, A. Vicari, E. Schneider, M. Papiernik, H. Ziltener, C. Penit, and M. Dy. 1994. Endogenous granulocyte-macrophage colony-stimulating factor is involved in IL-1- and IL-7-induced murine thymocyte proliferation. J. Immunol. 153:1973-1981[Abstract]. |
| 23. | Hernandez-Caselles, T., M. Martinez-Esparza, D. Sancho, G. Rubio, and P. Aparicio. 1995. Interleukin-7 rescues human activated T lymphocytes from apoptosis induced by glucocorticosteroids and regulates bcl-2 and CD25 expression. Hum. Immunol. 43:181-189[Medline]. |
| 24. | Ho, D. D., A. U. Neumann, A. S. Perelson, W. Chen, J. M. Leonard, and M. Markowitz. 1995. Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature 373:123-126[Medline]. |
| 25. |
Israël, A.,
O. Yano,
F. Logeat,
M. Kieran, and P. Kourilsky.
1989.
Two purified factors bind to the same sequence in the enhancer of mouse MHC class I genes: one of them is a positive regulator induced upon differentiation of teratocarcinoma cells.
Nucleic Acids Res.
17:5245-5257 |
| 25a. | Israël, A. Personal communication. |
| 26. | Israël, N., U. Hazan, J. Alcami, A. Munier, F. Arenzana-Seisdedos, F. Bachelerie, A. Israël, and J. L. Virelizier. 1989. Tumor necrosis factor stimulates transcription of HIV-1 in human T lymphocytes, independently and synergistically with mitogens. J. Immunol. 143:3956-3960[Abstract]. |
| 27. |
Iversen, P. O.,
L. B. To, and A. F. Lopez.
1996.
Apoptosis of hemopoietic cells by the human granulocyte-macrophage colony-stimulating factor mutant E21R.
Proc. Natl. Acad. Sci. USA
93:2785-2789 |
| 28. | Joshi, V. V., J. M. Oleske, S. Saad, C. Gadol, E. Connor, R. Bobila, and A. B. Minnefor. 1986. Thymus biopsy in children with acquired immunodeficiency syndrome. Arch. Pathol. Lab. Med. 110:837-842[Medline]. |
| 29. | Kinoshita, S., L. S. Su, M. Amano, L. A. Timmerman, H. Kaneshima, and G. P. Nolan. 1997. The T cell activation factor NF-ATc positively regulates HIV-1 replication and gene expression in T cells. Immunity 6:235-244[Medline]. |
| 30. | Kinoshita, T., T. Yokoda, K. Arai, and A. Miyajima. 1995. Regulation of Bcl-2 expression by oncogenic Ras protein in hematopoetic cells. Oncogene 10:2207-2212[Medline]. |
| 31. |
Kitano, K.,
C. N. Abboud,
D. H. Ryan,
S. G. Quan,
G. C. Baldwin, and D. W. Golde.
1991.
Macrophage-active colony-stimulating factors enhance human immunodeficiency virus type 1 infection in bone marrow stem cells.
Blood
77:1699-1705 |
| 32. |
Kitchen, S. G.,
C. H. Uittenbogaart, and J. A. Zack.
1997.
Mechanism of human immunodeficiency virus type 1 localization in CD4-negative thymocytes differentiation from a CD4-positive precursor allows productive infection.
J. Virol.
71:5713-5722[Abstract].
|
| 33. | Kopp, E. B., and S. Ghosh. 1995. NF-kappa B and rel proteins in innate immunity. Adv. Immunol. 58:1-27[Medline]. |
| 34. | Le, P. T., S. Lazorick, L. P. Whichard, Y.-C. Yang, S. C. Clark, B. F. Haynes, and K. H. Singer. 1990. Human thymic epithelial cells produce IL-6, granulocyte-monocyte-CSF, and leukemia inhibitory factor. J. Immunol. 145:3310-3315[Abstract]. |
| 35. |
Leonard, J.,
C. Parrott,
W. A. Buckler,
W. Turner,
E. K. Ross,
M. A. Martin, and A. B. Rabson.
1989.
The NF-kappa B binding sites in the human immunodeficiency virus type 1 long terminal repeat are not required for virus infectivity.
J. Virol.
63:4919-4924 |
| 36. | Leonard, W. J., E. W. Shores, and P. E. Love. 1995. Role of the common cytokine receptor gamma chain in cytokine signaling and lymphoid development. Immunol. Rev. 148:97-114[Medline]. |
| 37. | Lernbecher, T., U. Muller, and T. Wirth. 1993. Distinct NF-kappa B/Rel transcription factors are responsible for tissue-specific and inducible gene activation. Nature 365:767-770[Medline]. |
| 38. | Lin, J. X., T. S. Migone, M. Tsang, M. Friedmann, J. A. Weatherbee, L. Zhou, A. Yamauchi, E. T. Bloom, J. Mietz, S. John, and W. J. Leonard. 1995. The role of shared receptor motifs and common Stat proteins in the generation of cytokine pleiotropy and redundancy by IL-2, IL-4, IL-7, IL-13, and IL-15. Immunity 2:331-339[Medline]. |
| 39. | May, M. J., and S. Ghosh. 1997. Rel/NF-kappa B and I kappa B proteins: an overview. Semin. Cancer Biol. 8:63-73[Medline]. |
| 40. | McCune, J. M. 1997. Thymic function in HIV-1 disease. Semin. Immunol. 9:397-404[Medline]. |
| 41. | Montgomery, R. A., and M. J. Dallman. 1997. Semi-quantitative polymerase chain reaction analysis of cytokine and cytokine receptor gene expression during thymic ontogeny. Cytokine 9:717-726[Medline]. |
| 42. |
Murray, R.,
T. Suda,
N. Wrighton,
F. Lee, and A. Zlotnik.
1989.
IL-7 is a growth and maintenance factor for mature and immature thymocyte subsets.
Int. Immunol.
1:526-531 |
| 43. | Okazaki, H., M. Ito, T. Sudo, M. Hattori, S. Kano, Y. Katsura, and N. Minato. 1989. IL-7 promoters thymocyte proliferation and maintains immunocompetent thymocytes bearing alpha beta or gamma delta T-cell receptors in vitro: synergism with IL-2. J. Immunol. 143:2917-2922[Abstract]. |
| 44. |
Osborn, L.,
S. Kunkel, and G. J. Nabel.
1989.
Tumor necrosis factor alpha and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor kappa B.
Proc. Natl. Acad. Sci. USA
86:2336-2340 |
| 45. |
Papiernik, M.,
Y. Brossard,
N. Mulliez,
J. Roume,
C. Brechot,
F. Barin,
A. Goudeau,
J. F. Bach,
C. Griscelli,
R. Henrion, and R. Vazeux.
1992.
Thymic abnormalities in fetuses aborted from human immunodeficiency virus type 1 seropositive women.
Pediatrics
89:297-301 |
| 46. |
Plum, J.,
S. M. De,
G. Leclercq,
B. Verhasselt, and B. Vandekerckhove.
1996.
Interleukin-7 is a critical growth factor in early human T-cell development.
Blood
88:4239-4245 |
| 47. | Rosenzweig, M., D. P. Clark, and G. N. Gaulton. 1993. Selective thymocyte depletion in neonatal HIV-1 thymic infection. AIDS 7:1601-1605[Medline]. |
| 48. |
Rothe, M.,
L. Chêne,
M. Nugeyre,
F. Barré-Sinoussi, and N. Israël.
1998.
Contact with thymic epithelial cells as a prerequisite for cytokines enhanced HIV-1 replication in thymocytes.
J. Virol.
72:5852-5861 |
| 49. | Sakata, T., S. Iwagami, Y. Tsuruta, H. Teraoka, Y. Tatsumi, Y. Kita, S. Nishikawa, Y. Takai, and H. Fujiwara. 1990. Constitutive expression of IL-7 mRNA and production of IL-7 by a cloned thymic stromal cell line. J. Leukoc. Biol. 48:205-209[Abstract]. |
| 50. |
Sanchez-Pescador, R.,
M. Power,
P. Barr,
K. Steimer,
M. Stempien,
S. Brown-Shimer,
W. Gee,
A. Renard,
A. Randolph, and J. Levy.
1985.
Nucleotide sequence and expression of an AIDS-associated retrovirus (ARV-2).
Science
227:484-494 |
| 51. |
Santee, S. M., and S. L. Owen.
1996.
Human tumor necrosis factor receptor p75/80 (CD120b) gene structure and promoter characterization.
J. Biol. Chem.
271:21151-21159 |
| 52. | Schwartz, O., J. Virelizier, L. Montagnier, and U. Hazan. 1990. A microtransfection method using the luciferase encoding reporter gene for the assay of HIV LTR promoter activity. Gene 88:197-205[Medline]. |
| 53. | Seth, A., D. R. Hodge, D. M. Thompson, L. Robinson, A. Panayiotakis, D. K. Watson, and T. S. Papas. 1993. ETS family proteins activate transcription from HIV-1 long terminal repeat. AIDS Res. Hum. Retroviruses 9:1017-1023[Medline]. |
| 54. |
Stanley, S. K.,
J. M. McCune,
H. Kaneshima,
J. S. Justement,
M. Sullivan,
E. Boone,
M. Baseler,
J. Adelsberger,
M. Bonyhadi,
J. Orenstein,
C. H. Fox, and A. S. Fauci.
1993.
Human immunodeficiency virus infection of the human thymus and disruption of the thymic microenvironment in the SCID-hu mouse.
J. Exp. Med.
178:1151-1163 |
| 55. | Stein, B., A. S. Baldwin, D. W. Ballard, W. C. Greene, P. Angel, and P. Herrlich. 1993. Cross-coupling of the NF-kappa-B p65 and Fos/Jun transcription factors produces potentiated biological function. EMBO J. 12:3879-3891[Medline]. |
| 56. | Su, L., H. Kaneshima, M. Bonyhadi, S. Salimi, D. Kraft, L. Rabin, and J. M. McCune. 1995. HIV-1-induced thymocyte depletion is associated with indirect cytopathicity and infection of progenitor cells in vivo. Immunity 2:25-36[Medline]. |
| 57. |
Sudo, T.,
S. Nishikawa,
N. Ohno,
N. Akiyama,
M. Tamakoshi,
H. Yoshida, and S. Nishikawa.
1993.
Expression and function of the interleukin 7 receptor in murine lymphocytes.
Proc. Natl. Acad. Sci. USA
90:9125-9129 |
| 58. | Tanaka, K. E., W. C. Hatch, Y. Kress, R. Soeiro, T. Calvelli, W. K. Rashbaum, A. Rubinstein, and W. D. Lyman. 1992. HIV-1 infection of human fetal thymocytes. J. Acquired Immune Defic. Syndr. 5:94-101. |
| 59. | Uittenbogaart, C. H., D. J. Anisman, B. D. Jamieson, S. Kitchen, I. Schmid, J. A. Zack, and E. F. Hays. 1996. Differential tropism of HIV-1 isolates for distinct thymocyte subsets in vitro. AIDS 10:9-16[Medline]. |
| 60. |
Valentin, H.,
M.-T. Nugeyre,
F. Vuillier,
L. Boumsell,
M. Schmid,
F. Barré-Sinoussi, and R. Pereira.
1994.
Two subpopulations of human triple-negative thymic cells are susceptible to infection by human immunodeficiency virus type 1 in vitro.
J. Virol.
68:3041-3050 |
| 61. | Wei, X., S. K. Ghosh, M. E. Taylor, V. A. Johnson, E. A. Emini, P. Deutsch, J. D. Lifson, S. Bonhoefer, M. A. Nowak, B. H. Hahn, M. S. Saag, and G. M. Shaw. 1995. Viral dynamics in human immunodeficiency virus type 1 infection. Nature 373:117-122[Medline]. |
| 62. | Weih, F., D. Carrasco, and R. Bravo. 1994. Constitutive and inducible Rel/NF-kappa B activities in mouse thymus and spleen. Oncogene 9:3289-3297[Medline]. |
| 63. |
Whiteside, S.,
M. Ernst,
O. Lebail,
C. Laurent-Winter,
N. Rice, and A. Israel.
1995.
N- and C-terminal sequences control degradation of MAD3/I B in response to inducers of NF-kappa B activity.
Mol. Cell. Biol.
15:5339-5345[Abstract].
|
| 64. | Whiteside, S. T., and A. Israël. 1997. I kappa B proteins: structure, function and regulation. Semin. Cancer Biol. 8:75-82[Medline]. |
| 65. | Withersward, E. S., R. G. Amado, P. S. Koka, B. D. Jamieson, A. H. Kaplan, I. Chen, and J. A. Zack. 1997. Transient renewal of thymopoiesis in HIV-infected human thymic implants following antiviral therapy. Nat. Med. 3:1102-1109[Medline]. |
| 66. | Wolf, S. S., and A. Cohen. 1992. Expression of cytokines and their receptors by human thymocytes and thymic stromal cells. Immunology 77:362-368[Medline]. |
| 67. |
Zuniga-Pflücker, J. C.,
D. Jiang, and M. J. Lenardo.
1995.
Requirement for TNF- and IL-1 in fetal thymocyte commitment and differentiation.
Science
268:1906-1909 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»