Previous Article | Next Article 
Journal of Virology, March 1999, p. 2038-2044, Vol. 73, No. 3
0022-538X/99/$00.00+0
Identification of Protein Instability Determinants in the
Carboxy-Terminal Region of c-Myb Removed as a Result of Retroviral
Integration in Murine Monocytic Leukemias
Juraj
Bies,1,2
Viktor
Nazarov,1,
and
Linda
Wolff1,*
Laboratory of Cellular Oncology, National
Cancer Institute, National Institutes of Health, Bethesda, Maryland
20892-4255,1 and
Cancer Research
Institute, Slovak Academy of Sciences, Bratislava,
Slovakia2
Received 23 July 1998/Accepted 20 November 1998
 |
ABSTRACT |
The c-myb oncogene has been a target of retroviral
insertional mutagenesis in murine monocytic leukemias. One mechanism by which c-myb can be activated is through the integration of
a retroviral provirus into the central portion of the locus, causing
premature termination of c-myb transcription and
translation. We had previously shown that a leukemia-specific c-Myb
protein, truncated at the site of proviral integration by 248 amino
acids, had approximately a fourfold-increased half-life compared to the
normal c-Myb protein, due to its ability to escape rapid degradation by
the ubiquitin-26S proteasome pathway. Here we provide evidence for the
existence of more than one instability determinant in the
carboxy-terminal region of the wild-type protein, which appear to act
independently of each other. The data were derived from examination of
premature termination mutants and deletion mutants of the normal
protein, as well as analysis of another carboxy-terminally truncated
protein expressed in leukemia. Evidence is provided that one
instability determinant is located in the terminal 87 amino acids of
the protein and another is located in the vicinity of the internal
region that has leucine zipper homology. In leukemias, different
degrees of protein stability are attained following proviral
integration depending upon how many determinants are removed.
Interestingly, although PEST sequences (rich in proline, glutamine,
serine, and threonine), often associated with degradation, are found in
c-Myb, deletion of PEST-containing regions had no effect on protein
turnover. This study provides further insight into how inappropriate
expression of c-Myb may contribute to leukemogenesis. In addition, it
will facilitate further studies aimed at characterizing the specific role of individual regions of the normal protein in targeting to the
26S proteasome.
 |
INTRODUCTION |
The c-myb gene is a
frequent target of insertional mutagenesis in promonocytic leukemias
induced in mice by retroviruses (reviewed in references
8 and 26). Transformation of
myeloid cells by c-myb is probably due, at least in part, to
inappropriate expression of the c-Myb protein. One supporting
observation is that leukemias with retroviral integrations in the 5'
end of c-myb undergo promoter insertion at this locus. The
LTR promoter bypasses the endogenous promoter and a transcriptional
pause site in the first intron (23, 26, 28). The ultimate
effect is that the c-myb gene is constitutively expressed,
thereby avoiding the response to differentiation-related signals that
normally result in the down regulation of the gene. Another observation
supporting the notion that transformation can be due to inappropriate
expression of c-myb is that constitutive ectopic expression
of the full-length or leukemia-derived truncated form of protein in
myeloid cells in vitro causes them to resist growth arrest signals
(3, 4, 22, 27).
Promoter insertion is not the only mechanism involved in the activation
of c-myb by retroviruses. Amino-terminal truncations occur
in every case when the retrovirus inserts its promoter at the 5' end of
the gene, and although the role of this truncation in murine myeloid
leukemia is not clear and may be a consequence of bypassing the
elongation block, removal of similar sequences at the N terminus of
avian c-Myb causes it to be more oncogenic in its induction of B-cell
lymphomas (12). Recently, we have been focusing on a set of
leukemias that have carboxy-terminal truncations due to virus
integration into the central part of the locus, in the absence of
promoter insertion. An example is the retrovirus-induced myeloid
leukemia RI-4-11, where the c-Myb protein is overexpressed and aberrant
expression is due to provirus-induced structural alterations that
result in slower protein turnover (5, 18). Unlike the normal
c-Myb protein that undergoes rapid degradation by the 26S proteasome,
this protein is inefficiently degraded. (5, 17). In RI-4-11,
c-Myb protein is truncated by 248 amino acids (aa) as a consequence of
premature termination at a stop codon in the proviral long terminal
repeat (LTR) in exon 9. This C-terminally truncated protein may be
transforming, at least in part, because of its longer half-life in the
cell. Studies by Gonda and coworkers, using an in vitro transformation assay with fetal liver cells, support this notion (7). They demonstrated that when cells expressing a C-terminally truncated version of c-Myb were seeded at low density, they could produce a
higher level of transformation than cells expressing wild-type c-Myb.
Interestingly, truncated c-Myb protein has an increased potential for
transactivation (10). Protein stabilization may represent a
common mechanism of oncogenic activation, since it has also been
observed for the viral versions of two other transcription factors,
v-Jun and v-Fos. Transduction by retroviruses of the proto-oncogenes
that encode these proteins results in truncations that remove sequences
important for recognition and processing by the 26S proteasome
(20, 25).
The present study was initiated to determine the mechanism of
c-myb activation in a cell line derived from a leukemia
induced by infection of mice with Friend murine leukemia virus (F-MuLV) (19). We have found that this leukemic cell line has a
proviral integration in exon 13, leading to a truncated mRNA and
protein. Interestingly, the c-Myb protein produced in this cell line,
which is truncated by 96 aa, has a longer half-life than the wild-type protein, but it is not as stable as the protein truncated by 248 aa, as
previously described (5). This prompted us to investigate the sequence requirements for c-Myb protein degradation, since this
should ultimately lead to a better understanding of the mechanism involved in targeting the c-Myb protein to the 26S proteasome. This
analysis has led to the identification of two regions, one around the
region that has leucine zipper homology and the other one in the last
87 aa of the C-terminal region, that are involved in destabilization of
the normal full-length protein.
 |
MATERIALS AND METHODS |
Cell lines.
The RI-4-11 and 45-16 cell lines were
established from leukemias that had been serially transplanted at least
once in the peritoneal cavities of pristane-treated DBA/2N mice as
previously described (18). COS-7 cells (American Type
Culture Collection, Manassas, Va.) were maintained in Dulbecco's
modified Eagle's medium with 10% fetal calf serum.
Construction of premature termination and deletion mutants.
Each premature termination mutant was constructed by first amplifying a
unique size fragment from the 3' end of the full length c-myb cDNA and joining this to a previously cloned 5'
fragment in the pcDNA3.1(+) vector. A sense oligonucleotide primer
overlapping an EcoRI site in c-myb (14) was
utilized in the amplification for all the mutants (see Fig. 7A). The
unique antisense oligonucleotides included different c-myb
sequences, a translation termination codon (TGA), and the restriction
site for XbaI. The amplified sequences were digested with
EcoRI and XbaI and cloned directly into the
expression vector pcDNA3.1(+) (In Vitrogen, Carlsbad, Calif.) in which
the 5' end of the c-myb gene up to the EcoRI site
had been previously cloned. Amplification was carried out with
low-error-rate Pwo DNA polymerase (Boehringer Mannheim,
Indianapolis, Ind.). The oligonucleotide primers used for the
amplifications are available upon request. The structures of these
mutants and those described below were verified by sequencing.
The mutants with internal deletion mutations, including those with the
PEST sequences removed (see Fig. 5 and 7), were constructed by
preparing two amplification products corresponding to sequences which
flanked the deletion, one upstream of the deletion and the other
downstream of the deletion. These two products were joined through a
BamHI site which was introduced into the ends of the DNA
during amplification (see Fig. 7A). The 5' amplification product began
upstream of a unique EcoRI site in c-myb and
ended at different sites in c-myb depending on the
particular deletion. The 3' product began at different sites in
c-myb depending on the particular deletion and ended at the
terminus of the coding region of c-myb. An XbaI
site was introduced at the terminus with the antisense oligonucleotide
primer. The two amplification products were joined through the
BamHI site by sequential cloning into Litmus 28 (New England
Biolabs, Inc., Beverly, Mass.). EcoRI-XbaI
fragments containing individual deletions were excised and ligated
separately into pcDNA3.1(+), which already contained DNA encoding the
amino terminus of c-Myb up to the EcoRI site.
DNA transfection.
COS-7 cells were transfected with
pcDNA3.1(+) plasmids containing normal c-myb or mutants by
using the DOSPER liposomal transfection reagent (Boehringer Mannheim)
as specified by the manufacturer.
RT-PCR and sequencing of c-myb mRNA.
Reverse
transcription-PCR (RT-PCR) of mRNA from M1 and 45-16 cells was
performed with the Titan RT-PCR one-tube system (Boehringer Mannheim).
A sense oligonucleotide primer corresponding to a sequence from
c-myb exon 6 (CAAGAACCACTGGAATTCCACC [bp 807 to
828]) (2) was used in conjunction with sense and antisense
long terminal repeat (LTR) oligonucleotides (GAGTGATTGACTACCCGTCTC
[bp 110 to 130] [14] and
CTGCAGCTATCAGGCTAAGC [14], respectively) or an antisense c-myb oligonucleotide
(CACTGAGGTAGCATCTTCAGG [bp 1700 to 1718]
[2]).
To determine the sequence depicted in Fig.
1, one of the PCR products
spanning the virus-
myb junction in leukemic cell line
45-16 was cloned into the pCRII vector (InVitrogen) and partially
sequenced
by BioServe Biotechnologies, Laurel,
Md.
Southern analysis.
Genomic DNA was prepared from the 45-16 cell line with the Wizard genomic DNA purification kit (Promega,
Madison, Wis.). Samples (10 µg) were digested to completion with
restriction endonucleases, electrophoresed through horizontal agarose
gels, and blotted onto nylon membranes. A Stratalinker 1800 (Stratagene, La Jolla, Calif.) was used to UV cross-link DNA to the
membranes, which were then hybridized to either a probe from the
myb locus, exons 12 through 13 (see Fig. 2B), or an F-MuLV
LTR probe. The c-myb probe was labeled by random priming.
The LTR probe was a HinfI-BglI fragment that was
labeled by PCR amplification as described previously (15).
Immunoprecipitation.
For immunoprecipitation,
107 cells were labeled as previously described
(5). Transiently transfected COS-7 cells were metabolically labeled 36 h after transfection. Briefly, the cells were starved for 15 min in methionine- and cysteine-free medium, metabolically labeled for 45 min with 400 µCi of Tran35S-label (ICN),
washed, and then chased by adding prewarmed RPMI 1640 medium plus 10%
horse serum (M1 cells) or Dulbecco's modified Eagle's medium with
10% fetal calf serum (45-16, 3A2-11, and RI-4-11 leukemic cell lines)
for 0, 30, 60, and 120 min. At the indicated time points, the cells
were then disrupted in cold lysis buffer, and immunoprecipitation was
carried out with rabbit antiserum raised against the bacterial fusion
protein glutathione S-transferase-cMyb(I) as described
previously (3). Precipitates were electrophoresed under
reducing conditions on an 8% polyacrylamide gel and visualized by
fluorography. Quantitative analyses of dried gels were performed on a
PhosphorImager 425 with ImageQuant software (Molecular Dynamics), and
the half-lives of the proteins (t1/2) were
calculated from the formula t1/2 = (0.693 × t)/ln (Nt/N0), as
described previously (3).
 |
RESULTS |
Analysis of c-myb gene structure and protein products
in 45-16 leukemia cells.
A promonocytic leukemia cell line, 45-16, was obtained by intravenous inoculation of F-MuLV into irradiated and
pristane-treated DBA/2 mice (19). Interestingly,
c-myb had not undergone activation by promoter insertional
mutagenesis, which is the most common type of alteration observed for
these leukemias (26). However, c-myb seemed to be
involved in the development of the leukemia, because we observed that
the c-myb mRNA from a cell line established from this
leukemia cell line was smaller than that of full-length mRNA (Fig.
1A). To localize a potential deletion in
one of the ends of the coding region, we attempted to amplify
separately by RT-PCR sequences corresponding to either the 5' or 3'
portion of the c-myb mRNA. Although a DNA product of the
predicted size was amplified from the 5' end of c-myb, no
amplification was obtained from the 3' end with a sense oligonucleotide
primer homologous to the central portion of c-myb and an
antisense primer from exon 15, the last exon (data not shown). A
Southern blot analysis was performed to determine if there was an
alteration in the c-myb DNA in this leukemia cell line that
would indicate the presence of a provirus. As shown in Fig.
2A, a rearranged allele was detected in
46-16 when the DNA from this cell line was digested with
EcoRV and XbaI and hybridized with a genomic
c-myb probe spanning the region from exons 12 to 13 (Fig.
2B). A 2-kb leukemia-specific fragment, not detected in normal liver
DNA, also hybridized with an LTR probe, indicating the presence of a
provirus between the EcoRV and XbaI sites. To
determine the position and orientation of the virus, which was
presumably integrated in the central region of the gene, another RT-PCR
analysis was performed with primers homologous to the LTR, in both the
sense and antisense orientations, in conjunction with a primer from
c-myb. The results, depicted in Fig. 1B, demonstrate that
the provirus is positioned in the same orientation as the
c-myb gene. This is evident from lane 4, which contains an
RT-PCR product obtained with a c-myb sense primer homologous
to sequences in exon 6 and the LTR antisense primer. An RT-PCR analysis
performed on M1 cells, which did not have a provirus integrated in the
c-myb locus, served as a control. A positive control for the
RT-PCR assay was the amplification product in lanes 3 (M1) and 6 (45-16) of Fig. 1B, obtained with sense and antisense oligonucleotides
from c-myb. The sequence of the partial cDNA covering the
junction of the c-myb and the LTR in 45-16 cells (Fig. 1C)
reveals that the provirus is integrated in exon 13 and that termination
of translation occurs immediately at the beginning of viral LTR.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
Integration of F-MuLV into exon 13 of c-myb
in the leukemia cell line 45-16. (A) Northern analysis of
c-myb mRNA in a cell line derived from 45-16. Total RNAs
from the myeloblast cell line, M1, and from the 45-16 cell line were
electrophoresed, blotted, and hybridized with c-myb cDNA and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probes. (B) RT-PCR
analysis of 45-16. Total RNA from 45-16 was amplified following reverse
transcription and electrophoresed on a 1% agarose gel containing 1 µg of ethidium bromide per ml. RNAs from M1 cells (lanes 1 to 3) or
45-16 cells (lanes 4 to 6) were reverse transcribed and amplified with
an oligonucleotide primer overlapping the EcoRI site in exon
6 of c-myb in conjunction with an antisense F-MuLV LTR
oligonucleotide (lanes 1 and 4), a sense LTR oligonucleotide (lanes 2 and 5), or an oligonucleotide with sequences from exons 11 and 12 (lanes 3 and 6). (C) Sequences at the c-myb exon 13-F-MuLV
proviral junction in the mRNA from 45-16.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
Southern analysis demonstrates a rearranged
c-myb allele in the leukemia cell line 45-16. (A) Genomic
DNA from the leukemia cell line 45-16 or normal DBA liver cells was
digested with EcoRV and XbaI and hybridized with
either a c-myb probe (B) or an F-MuLV LTR probe, as
described in Materials and Methods. (B) Map of part of the
c-myb locus showing the location of the probe used in panel
A.
|
|
The predicted structure of the protein expressed in 45-16 cells is
depicted in Fig.
3, where it is compared
to the normal
c-Myb and a previously described c-Myb protein from
RI-4-11 leukemia
cells, which is more severely truncated. The smaller
protein from
RI-4-11 (with 248 aa deleted) has all of the C terminus
removed
up to and including some of the leucine zipper-related region.
Therefore, all of the negative regulatory domain, defined previously
by
investigators who showed that its removal resulted in increased
transactivation (
10), is missing. In contrast, the protein
from
45-16 (with 96 aa deleted) had only a short C-terminal region
of
unknown function missing.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Structure of carboxy-terminally truncated c-Myb proteins
expressed in two leukemia cell lines, RI-4-11 and 45-16. The top of the
figure depicts the structure of the normal wild-type c-Myb protein,
showing the DNA binding domain consisting of three imperfect direct
repeats (R1, R2, and R3), the transactivation domain (TA), the negative
regulatory domain (NRD), and the region with similarity to leucine
zippers (LZ). PEST1, PEST2, and PEST3 were identified with PESTfind
(21). Below are the structures of two leukemia-specific
proteins that are truncated at the C terminus.
|
|
Turnover of c-Myb protein in leukemic cell line 45-16.
We
previously showed by immunoprecipitation that the steady-state level of
a truncated c-Myb with 248 aa deleted, which is expressed in an
established leukemia cell line, is increased compared to that of
endogenous full length c-Myb expressed in the M1 myeloblastic cell line
(5). This increase in the protein level was shown to be a
consequence of a longer half-life compared to the full-length protein.
We therefore decided to examine the half-life of the c-Myb protein
expressed in 45-16 cells. To compare the stability of the 45-16 c-Myb
protein with that of wild-type c-Myb, we performed a pulse-chase
experiment. Cells were labeled with radioactive methionine and cysteine
for 45 min and chased for up to 120 min. The results are depicted in
Fig. 4, which shows the proteins
truncated by 96 aa in 45-16 cells and by 248 aa in RI-4-11 cells are
more stable than the full-length protein in M1 cells or the
amino-terminally truncated protein in another leukemic cell line,
30A2-1-2 (28). Quantitative analysis of results from several
experiments showed that the t1/2 of the protein
expressed in 45-16 cells was about twofold longer than that of the
normal protein and that the t1/2 of the shorter
RI-4-11 protein was at least fourfold longer. This data, therefore,
suggests that more than one protein determinant is responsible for
degradation of full-length c-Myb in these cells and led us to analyze
the protein in more detail and to localize potential determinants.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Pulse-chase experiment demonstrating altered stabilities
of C-terminally truncated proteins. The M1 myeloblast cell line, a
promonocytic leukemia cell line with an amino-terminally truncated
c-Myb, 30A2-1-2, and two cell lines with C-terminally truncated c-Myb,
RI-4-11 and 45-16, were metabolically labeled with radioactive
methionine and cysteine and chased in complete medium for the
designated times. Proteins were immunoprecipitated with polyclonal
rabbit anti-c-Myb serum (3) and analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis. The mobilities of molecular
mass standards in kilodaltons are on the left.
|
|
Localization of sequences responsible for targeting c-Myb for
degradation.
Since the c-Myb protein is recognized and degraded in
M1 cells by the 26S proteasome (5) and the leukemia-specific
truncated forms are stabilized to different extents depending upon the
size of the C-terminal truncation, we became interested in localizing determinants, particularly in the C terminus, that might be responsible for recognition and targeting of the protein to the 26S proteasome. To
analyze different c-myb deletion mutants, we decided to
transfect COS-7 cells with plasmids containing the sequence
modifications. First, however, we confirmed that degradation of the
full-length protein occurred similarly in COS-7 cells to that in M1
cells and that the protein was degraded by the 26S proteasome. As shown in Fig. 5, the kinetics of proteolysis of
full-length c-Myb were the same as those previously observed in M1
cells, and proteolysis could be blocked by a potent inhibit of the
proteasome,
N-acetyl-L-leucinyl-L-leucinyl-norleucinal (ALLN).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Turnover of c-Myb in COS-7 cells in the absence or
presence of the 26S proteasome inhibitor, ALLN. COS-7 cells were
transiently transfected with pcDNA3.1 expressing full-length c-Myb, and
after 36 h the cells were pulse-labeled with
[35S]methionine-[35S]cysteinine and chased
for the indicated times. ALLN
(N-acetyl-L-leucinyl-L-leucinyl-norleucinal)
dissolved in dimethyl sulfoxide (DMSO) was added for the last 15 min of
the pulse and kept at the same concentration during the chase. Cells
treated with 0.5% dimethyl sulfoxide were used as a negative control
for this experiment.
|
|
The first deletions prepared were those that removed the putative PEST
sequences identified in the c-Myb protein by using
PESTfind (Fig.
3)
(
5). PEST sequences are rich in proline (P),
glutamine (E)
and/or aspartic acid, serine (S), and threonine
(T) and have been shown
for some proteins, such as c-Fos and I

B,
to be conditional
proteolytic signals (
21) involved in targeting
of the
protein to the ubiquitin-26S proteasome pathway. Although
PEST1
represented a poor PEST sequence, PEST2 and PEST3 had high
scores of
9.3 and 8.0, respectively. Both of these sites were
interesting
candidates for playing a role in degradation. PEST2
is upstream of the
leucine zipper-like sequences and at the amino-terminal
edge of the
negative regulatory domain, and it has the highest
score. On the other
hand, PEST3 is highly conserved among c-Myb
proteins of higher
vertebrates and is removed in the c-Myb protein
expressed in RI-4-11.
Deletion mutants were prepared that removed
PEST sequences, and these
were inserted into the pcDNA3.1 vector.
They were then transiently
transfected into COS-7 cells. However,
a pulse-chase analysis of the
mutant proteins demonstrated that
removal of PEST1, PEST2, or PEST3 had
no detectable effect on
the stability of the mutated proteins compared
to full-length
c-Myb (Fig.
6).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 6.
Turnover of proteins with mutations in the PEST regions.
c-Myb with mutations in the PEST sequences was transiently expressed in
COS-7 cells as described in the legend to Fig. 4. The decay of
full-length c-Myb (FL-c-Myb) and proteins with mutations in PEST1,
PEST2, or PEST3 is depicted in the graphs at the bottom.
|
|
Since the PEST sequence mutants did not affect proteolysis, we began to
search for other regions in the C terminus that might
be involved in
the proteolytic processing. For this purpose, a
series of progressively
greater C-terminal deletions were prepared
from full length c-Myb, as
demonstrated in Fig.
7A. These altered
c-Myb proteins were than expressed from the pcDNA3.1 vector in
COS-7
cells. After 36 h, the cells were metabolically labeled
with
[
35S]methionine and chased for 0 to 120 min. The results
for the
electrophoresed proteins from one experiment are depicted in
Fig.
7B. Half-life calculations were made and averaged for two
experiments,
and the relative stabilities of the truncated proteins,
compared
to that of the full-length protein, are plotted in Fig.
7C.
The
shortest deletion of 87 aa (producing the CT1 mutant) resulted
in
partial stabilization with an increase in the half-life of
approximately twofold. No further stabilization was noted as additional
sequences totaling 106 aa were deleted (CT4). Removal of 151 to
223 aa
(CT5), however, resulted in a further stabilization, so
that the
protein was almost four times more stable than the wild
type.
Interestingly, this deletion was up to but not including
the leucine
zipper-like sequences. The leucine zipper domain has
been proposed to
function in protein-protein interactions, and
although the sequence was
intact in CT5, this alteration may have
still interfered with its
putative interaction with another protein
that could shorten the
half-life of c-Myb. Loss of the next 43
aa resulted in only a slight
increase in stability (CT6), and
removal of the entire C terminus,
including the entire leucine
zipper region, resulted in the same
half-life as for CT6 (data
not shown).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 7.
Stability of proteins with various C-terminal
truncations. pcDNA3.1 plasmids expressing full-length or premature
termination mutations were transiently expressed in COS-7 cells, and a
pulse chase experiment was performed as in Fig. 4. (A) The structures
of the mutants with the premature termination mutations are shown below
the full-length c-Myb. E (EcoRI) and X (XbaI) are
restriction endonuclease sites used in the preparation of the
recombinants, as described in Materials and Methods. The number of
amino acids removed in each mutant is shown to the right. (B) Bar graph
showing the relative stabilities of the truncated proteins compared to
the full-size protein. (C) Half-life calculations were performed as
described in Materials and Methods and averaged for two experiments. A
representative experiment is shown.
|
|
To confirm our interpretation of the results with the C-terminal
deletions, internal deletions were prepared as depicted in
Fig.
8A. The mutant proteins were tested for
their resistance
to degradation, as in the above experiment, after
transfection
of COS-7 cells. Three regions were deleted, one
overlapping the
leucine zipper and two others downstream from the
leucine zipper
region. As shown in Fig.
8B and C, the leucine zipper
mutant with
aa 371 to 417 deleted was the only protein that
demonstrated a
significant increase in stability. We therefore
concluded from
the analysis of both sets of mutants that two regions
may be important
for recognition and targeting of c-Myb to the
proteasome, the
last C-terminal 87 aa and a region in the vicinity of
the leucine
zipper-like sequence.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 8.
Stability of proteins with various internal C-terminal
deletions. pcDNA3.1 plasmids expressing full-length or C-terminally
deleted mutants were expressed in COS-7 cells, and a pulse-chase
experiment was performed as described in the legend to Fig. 4. (A) The
structures of the C-terminally deleted mutants are shown below that of
the full-length c-Myb. B (BamHI), E (EcoRI), and
X (XbaI) are restriction endonuclease sites used in the
preparation of the recombinants, as described in Materials and Methods.
(B) Bar graph showing the relative stabilities of the deleted proteins
compared to the full-size protein. (C) Half-life calculations were
performed as described in Materials and Methods and averaged for two
experiments. A representative experiment is shown.
|
|
 |
DISCUSSION |
In the present study we have provided evidence for a function of
the C terminus of c-Myb. An analysis of aberrant leukemia-specific proteins and proteins expressed from constructed mutants demonstrates the existence of separate determinants involved in the proteolysis of
the normal c-Myb protein. One is in a region adjacent to or perhaps
including the putative leucine zipper domain, and the other is in a
region at the extreme C terminus, a region to which no function has
previously been assigned. The exact locations of the determinants
cannot be determined precisely at this time, because we may have
produced conformational changes in portions of the molecule outside the
deletions. In any case, more than one determinant was found that can
function independently of each other. For example, the loss of the one
determinant at the extreme C terminus in the leukemia cell line 45-16 can result in partial slowing of c-Myb protein turnover, whereas the
combined loss of these, as in the leukemia cell line RI-4-11, has a
maximum effect on stability. These truncations of c-Myb, caused by the
integrated provirus, represent a basic mechanism which can contribute
to inappropriate expression of c-Myb in monocytic leukemia. We cannot determine presently if this is the only mechanism involved in oncogenic
activation. Other contributing factors may include increased mRNA
stability (our own unpublished observations) and altered transcription
at the locus due to the introduction of viral enhancers to the central
portion of the gene.
PEST sequences, rich in proline, glutamate, serine, and threonine and
interrupted by positively charged residues, are commonly found in
proteins that are rapidly degraded and in many cases have been
demonstrated to be required for proteolysis. Examples include cyclins,
c-Fos, I
B
, and ornithine decarboxylase (6, 21).
Previously, we used the algorithm called PESTfind to identify such
sequences in c-Myb, and three regions depicted in Fig. 3, especially
PEST2 and PEST3, had significant scores. For this reason, our first
attempt to find sites that could be important in targeting c-Myb to the
proteasome involved preparing mutants that would disrupt these sites
and determining the half-life of these mutants in a common cell
background, that of the COS-7 cells. However, none of these deletions
had any effect on c-Myb stability. One conclusion from these results is
that other sequences such as those described above play a role in the
rapid destruction of c-Myb. This is not surprising, because other
proteins contain alternative degradation motifs. For example c-Jun has
a delta domain at its amino terminus that is required for its rapid
degradation and some proteins such as cyclin B have short regions of
sequence known as cyclin destruction boxes (9, 21).
The regions of c-Myb that we identified as important to its rapid
degradation could potentially perform one or more functions relevant to
the proteasome proteolytic pathway. Since our previous data suggest
that polyubiquitination may be a required step in the processing of
c-Myb for degradation (5), sequences at these sites may be
involved in aspects of this modification. It is intriguing that one of
the regions in c-Myb, determined from analysis of premature termination
and deletion mutants to be important in the degradation process,
overlaps the region with sequence similarity to leucine zippers (Fig. 7
and 8). Although this region has not been demonstrated to form an
amphipathic
-helical structure, there is evidence that it can bind
proteins. For example, p160 was identified and cloned from cells based
on its ability to bind to the leucine zipper (1). Also,
others have observed the binding of two cellular proteins, p26 and p28,
to the avian v-Myb (24). The leucine zipper region is part
of a large domain of c-Myb called the negative regulatory domain (Fig.
3). Removal of this region has been demonstrated to cause an increase
in transactivation by c-Myb. In addition, mutation of the leucine
zipper can cause a similar increase in its transactivating function and
transforming capacities (13). The increased capacity of
leucine zipper mutants to transform cells compared to wild-type c-Myb
has been demonstrated by using retroviral vectors that expressed the
proteins in murine fetal liver cells and then assaying these cells for
colony formation in semisolid medium. Although we have never found
deletions that specifically removed the leucine zipper in monocytic
leukemia cells, a spontaneous internal deletion of this region has been observed in a bovine T-cell lymphoma (11). Based on our
analysis here of an analogous mutant, it is interesting to speculate
that these alterations in the protein may have affected the
transactivation capacity of c-Myb and its ability to transform because
of increased levels of protein following escape from degradation. The
involvement of interacting proteins in recognition and targeting to the
proteasome has been demonstrated for other transcription factors. For
example, the stability of c-Fos is decreased upon interaction with
phosphorylated c-Jun (20). Also, p53 can be induced to
degrade rapidly by interaction with MDM2 (16). Further
studies are required to determine if overexpression of leucine zipper
binding proteins can affect the stability of c-Myb.
 |
ACKNOWLEDGMENTS |
We thank Douglas Lowy for critical reading of the manuscript and
Richard Koller for excellent technical assistance.
This work was supported in part by grant 2/5052/98 from the Slovak
Academy of Sciences.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Cellular Oncology, National Cancer Institute, NIH, Building 37, Room 2B04, 37 Convent Dr., Bethesda, MD 20892-4255. Phone: (301) 496-6763. Fax: (301) 402-1031. E-mail: LWOLFF{at}helix.nih.gov.
Present address: Institute of Molecular Biology, Slovak Academy of
Sciences, Bratislava, Slovakia.
 |
REFERENCES |
| 1.
|
Bartunek, P.,
V. Karafiat,
M. Dvorakova,
V. Zahorova,
S. Mandikova,
M. Zenke, and M. Dvorak.
1997.
The Myb leucine zipper is essential for leukemogenicity of the v-Myb protein.
Oncogene
15:2939-2949[Medline].
|
| 2.
|
Bender, T. P., and W. M. Kuehl.
1986.
Murine myb protooncogene mRNA: cDNA sequence and evidence for 5' heterogeneity.
Proc. Natl. Acad. Sci. USA
83:3204-3208[Abstract/Free Full Text].
|
| 3.
|
Bies, J.,
B. Hoffman,
A. Amanullah,
T. Giese, and L. Wolff.
1996.
B-Myb prevents growth arrest associated with terminal differentiation of monocytic cells.
Oncogene
12:355-363[Medline].
|
| 4.
|
Bies, J.,
R. Mukhopadhyaya,
J. Pierce, and L. Wolff.
1995.
Only late, nonmitotic stages of granulocyte differentiation in 32Dcl3 cells are blocked by ectopic expression of murine c-myb and its truncated forms.
Cell Growth Differ.
6:59-68[Abstract].
|
| 5.
|
Bies, J., and L. Wolff.
1997.
Oncogenic activation of c-Myb by carboxyl-terminal truncation leads to decreased proteolysis by the ubiquitin-26S proteasome pathway.
Oncogene
14:203-212[Medline].
|
| 6.
|
Chevaillier, P.
1993.
PEST sequences in nuclear proteins.
Int. J. Biochem.
25:479-482[Medline].
|
| 7.
|
Ferrao, P.,
E. M. MacMillan,
L. K. Ashman, and T. J. Gonda.
1995.
Enforced expression of full length c-Myb leads to density-dependent transformation of murine haemopoietic cells.
Oncogene
11:1631-1638[Medline].
|
| 8.
|
Golay, J.,
L. Basilico,
L. Loffarelli,
S. Songia,
V. Broccoli, and M. Introna.
1996.
Regulation of hematopoietic cell proliferation and differentiation by the myb oncogene family of transcription factors.
Int. J. Clin. Lab. Res.
26:24-32[Medline].
|
| 9.
|
Hilt, W., and D. H. Wolf.
1996.
Proteasomes: destruction as a programme.
Trends Biochem. Sci.
21:96-102[Medline].
|
| 10.
|
Hu, Y. L.,
R. G. Ramsay,
C. Kanei-Ishii,
S. Ishii, and T. J. Gonda.
1991.
Transformation by carboxyl-deleted Myb reflects increased transactivating capacity and disruption of a negative regulatory domain.
Oncogene
6:1549-1553[Medline].
|
| 11.
|
Ishiguro, N.,
T. Ohzono,
T. Shinagawa,
M. Horiuchi, and M. Shinagawa.
1994.
A spontaneous internal deletion of the c-myb protooncogene enhances transcriptional activation in bovine T lymphoma cells.
J. Biol. Chem.
269:26822-26829[Abstract/Free Full Text].
|
| 12.
|
Jiang, W.,
M. R. Kanter,
I. Dunkel,
R. G. Ramsay,
K. L. Beemon, and W. S. Hayward.
1997.
Minimal truncation of the c-myb gene product in rapid-onset B-cell lymphoma.
J. Virol.
71:6526-6533[Abstract].
|
| 13.
|
Kanei-Ishii, C.,
E. M. MacMillan,
T. Nomura,
A. Sarai,
R. G. Ramsay,
S. Aimoto,
S. Ishii, and T. J. Gonda.
1992.
Transactivation and transformation by Myb are negatively regulated by a leucine-zipper structure.
Proc. Natl. Acad. Sci. USA
89:3088-3092[Abstract/Free Full Text].
|
| 14.
|
Koch, W.,
G. Hunsmann, and R. Friedrich.
1983.
Nucleotide sequence of the envelope gene of Friend murine leukemia virus.
J. Virol.
45:1-9[Abstract/Free Full Text].
|
| 15.
|
Koller, R.,
M. Krall,
B. Mock,
J. Bies,
V. Nazarov, and L. Wolff.
1996.
Mml1, a new common integration site in murine leukemia virus-induced promonocytic leukemias, maps to mouse chromosome 10.
Virology
224:224-234[Medline].
|
| 16.
|
Kubbutat, M. H.,
S. N. Jones, and K. H. Vousden.
1997.
Regulation of p53 stability by Mdm2.
Nature
387:299-303[Medline].
|
| 17.
|
Luscher, B., and R. N. Eisenman.
1988.
c-myc and c-myb protein degradation: effect of metabolic inhibitors and heat shock.
Mol. Cell. Biol.
8:2504-2512[Abstract/Free Full Text].
|
| 18.
|
Mukhopadhyaya, R., and L. Wolff.
1992.
New sites of proviral integration associated with murine promonocytic leukemias and evidence for alternate modes of c-myb activation.
J. Virol.
66:6035-6044[Abstract/Free Full Text].
|
| 19.
|
Nazarov, V., and L. Wolff.
1995.
Novel integration sites at the distal 3' end of the c-myb locus in retrovirus-induced promonocytic leukemias.
J. Virol.
69:3885-3888[Abstract].
|
| 20.
|
Papavassiliou, A. G.,
M. Treier,
C. Chavrier, and D. Bohmann.
1992.
Targeted degradation of c-Fos, but not v-Fos, by a phosphorylation-dependent signal on c-Jun.
Science
258:1941-1944[Abstract/Free Full Text].
|
| 21.
|
Rechsteiner, M., and S. W. Rogers.
1996.
PEST sequences and regulation by proteolysis.
Trends Biochem. Sci.
21:267-271[Medline].
|
| 22.
|
Selvakumaran, M.,
D. A. Liebermann, and B. Hoffman-Liebermann.
1992.
Deregulated c-myb disrupts interleukin-6 or leukemia inhibitory factor-induced myeloid differentiation prior to c-myc: role in leukemogenesis.
Mol. Cell. Biol.
12:2493-2500[Abstract/Free Full Text].
|
| 23.
|
Shen-Ong, G. L., and L. Wolff.
1987.
Moloney murine leukemia virus-induced myeloid tumors in adult BALB/c mice: requirement of c-myb activation but lack of v-abl involvement.
J. Virol.
61:3721-3725[Abstract/Free Full Text].
|
| 24.
|
Tavner, F. J.,
R. Simpson,
S. Tashiro,
D. Favier,
N. A. Jenkins,
D. J. Gilbert,
N. G. Copeland,
E. M. MacMillan,
J. Lutwyche,
R. A. Keough,
S. Ishii, and T. J. Gonda.
1998.
Molecular cloning reveals that the p160 Myb-binding protein is a novel, predominantly nucleolar protein which may play a role in transactivation by Myb.
Mol. Cell. Biol.
18:989-1002[Abstract/Free Full Text].
|
| 25.
|
Treier, M.,
L. M. Staszewski, and D. Bohmann.
1994.
Ubiquitin-dependent c-Jun degradation in vivo is mediated by the delta domain.
Cell
78:787-798[Medline].
|
| 26.
|
Wolff, L.
1996.
Myb-induced transformation.
Crit. Rev. Oncog.
7:245-260[Medline].
|
| 27.
|
Wolff, L.,
R. Koller,
J. Bies,
V. Nazarov,
B. Hoffman,
A. Amanullah,
M. Krall, and B. Mock.
1996.
Retroviral insertional mutagenesis in murine promonocytic leukemias: c-myb and Mml1.
Curr. Top. Microbiol. Immunol.
211:191-199[Medline].
|
| 28.
|
Wolff, L.,
R. Koller, and W. Davidson.
1991.
Acute myeloid leukemia induction by amphotropic murine retrovirus (4070A): clonal integrations involve c-myb in some but not all leukemias.
J. Virol.
65:3607-3616[Abstract/Free Full Text].
|
Journal of Virology, March 1999, p. 2038-2044, Vol. 73, No. 3
0022-538X/99/$00.00+0
This article has been cited by other articles:
-
Fang, F., Rycyzyn, M. A., Clevenger, C. V.
(2009). Role of c-Myb during Prolactin-Induced Signal Transducer and Activator of Transcription 5a Signaling in Breast Cancer Cells. Endocrinology
150: 1597-1606
[Abstract]
[Full Text]
-
Corradini, F., Cesi, V., Bartella, V., Pani, E., Bussolari, R., Candini, O., Calabretta, B.
(2005). Enhanced Proliferative Potential of Hematopoietic Cells Expressing Degradation-resistant c-Myb Mutants. J. Biol. Chem.
280: 30254-30262
[Abstract]
[Full Text]
-
Bies, J., Markus, J., Wolff, L.
(2002). Covalent Attachment of the SUMO-1 Protein to the Negative Regulatory Domain of the c-Myb Transcription Factor Modifies Its Stability and Transactivation Capacity. J. Biol. Chem.
277: 8999-9009
[Abstract]
[Full Text]
-
Luger, S. M., O'Brien, S. G., Ratajczak, J., Ratajczak, M. Z., Mick, R., Stadtmauer, E. A., Nowell, P. C., Goldman, J. M., Gewirtz, A. M.
(2002). Oligodeoxynucleotide-mediated inhibition of c-myb gene expression in autografted bone marrow: a pilot study. Blood
99: 1150-1158
[Abstract]
[Full Text]
-
Nicot, C., Mahieux, R., Pise-Masison, C., Brady, J., Gessain, A., Yamaoka, S., Franchini, G.
(2001). Human T-Cell Lymphotropic Virus Type 1 Tax Represses c-Myb-Dependent Transcription through Activation of the NF-{kappa}B Pathway and Modulation of Coactivator Usage. Mol. Cell. Biol.
21: 7391-7402
[Abstract]
[Full Text]
-
Lutz, P. G., Houzel-Charavel, A., Moog-Lutz, C., Cayre, Y. E.
(2001). Myeloblastin is an Myb target gene: mechanisms of regulation in myeloid leukemia cells growth-arrested by retinoic acid. Blood
97: 2449-2456
[Abstract]
[Full Text]
-
Wang, D.-M., Dubendorff, J. W., Woo, C. H., Lipsick, J. S.
(1999). Functional Analysis of Carboxy-Terminal Deletion Mutants of c-Myb. J. Virol.
73: 5875-5886
[Abstract]
[Full Text]
-
Salghetti, S. E., Muratani, M., Wijnen, H., Futcher, B., Tansey, W. P.
(2000). Functional overlap of sequences that activate transcription and signal ubiquitin-mediated proteolysis. Proc. Natl. Acad. Sci. USA
97: 3118-3123
[Abstract]
[Full Text]