Previous Article | Next Article 
Journal of Virology, March 1999, p. 1956-1963, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Human Immunodeficiency Virus Type 1 Tat Induces
Apoptosis and Increases Sensitivity to Apoptotic Signals by
Up-Regulating FLICE/Caspase-8
Steven R.
Bartz and
Michael
Emerman*
Divisions of Molecular Medicine and Basic
Science, Fred Hutchinson Cancer Research Center, Seattle,
Washington
Received 22 September 1998/Accepted 20 November 1998
 |
ABSTRACT |
Apoptosis contributes to the loss of CD4 cells during human
immunodeficiency virus type 1 (HIV-1) infection. Although the product of the env gene, gp160/gp120, is known to play a
role in cell death mediated by HIV-1, the role of other HIV-1 genes in
the process is unclear. We found that HIV-1 lacking the env gene (HIV
env) still induced apoptosis in T-cell lines
and primary CD4 T cells. The ability to induce apoptosis was
attributable to Tat, a viral regulatory protein. Tat induction of
apoptosis was separate from the transactivation function of Tat,
required expression of the second exon of Tat, and was associated with the increased expression and activity of caspase-8 (casp-8), a signaling molecule in apoptotic pathways. Moreover, induction of
apoptosis could be prevented by treating cells with an inhibitor of
casp-8. In addition, we show that HIV-1
env infection and
Tat expression increased the sensitivity of cells to Fas-mediated apoptosis, an apoptotic pathway that signals via casp-8. The
up-regulation of casp-8 by HIV-1 Tat expression may contribute to the
increased apoptosis and sensitivity to apoptotic signals observed in
the cells of HIV-1-infected persons.
 |
INTRODUCTION |
Human immunodeficiency virus type 1 (HIV-1) disease is characterized by the progressive loss of
CD4+ T cells, and apoptosis has been proposed to be the
primary mechanism (1, 2). Results from in vivo and in vitro
studies indicate that the loss of CD4 cells occurs by direct killing of
the infected cell by HIV-1 as well as by indirect killing of uninfected
bystander cells (13, 14). In addition, the peripheral blood
mononuclear cells (PBMC) of infected persons are significantly more
sensitive to apoptotic signals than the cells of uninfected
individuals (reviewed in reference 2). Although the
mechanisms responsible for the increased sensitivity to
apoptotic stimuli, the induction of apoptosis in infected
cells, and the indirect induction of apoptosis in uninfected cells are
likely to be multifactorial, HIV-1 gene products themselves may
contribute in part to the increased apoptosis associated with HIV-1 disease.
Among the HIV-1 proteins that have been implicated in regulating
apoptosis are gp120 (reviewed by Siliciano [36]), Vpr
(3, 8, 38, 44), Nef (30), and Tat (11, 17,
22, 25, 31, 33, 35, 41, 45-47). Tat is essential for viral
replication because of its function in transactivating the viral long
terminal repeat (LTR) (reviewed in reference 10).
Mechanisms by which Tat has been reported to induce apoptosis include
up-regulation of the apoptosis effector molecule Fas ligand
(FasL) (41), inhibition of expression of
manganese-dependent superoxide dismutase (42), and
activation of cyclin-dependent kinases (22). However, the ability of Tat to regulate apoptosis in the context of the infected cell has not been investigated.
The proteins responsible for transmitting the apoptotic signal
within the cell have recently been identified. External apoptotic stimuli, as well as signals generated from within the cell, result in
the activation of signal transduction pathways that converge on a
protease (termed caspase) cascade (reviewed in reference 34) resulting in the execution of apoptotic
cell death. Signaling through the death receptor, Fas, results in
recruitment of an adaptor protein, FADD (7). The binding of
FADD to Fas recruits the protease FLICE/caspase-8 (casp-8), which
results in autoproteolytic activation of casp-8 (6, 20, 27, 28,
43). Casp-8 cleaves downstream caspases, such as casp-3,
initiating the caspase cascade (9, 37, 39). Viruses have
evolved a number of strategies to both inhibit and activate
apoptosis at various steps in apoptotic pathways
(reviewed in reference 40).
In this study, we used a genetic approach to identify HIV-1 gene
products that regulate apoptosis during a single round of infection. The HIV-1 Tat protein was found to induce apoptosis both when expressed from the HIV-1 provirus and when expressed alone.
Moreover, HIV-1
env-infected and Tat-expressing cells were more sensitive to an apoptotic stimulus. The ability of Tat to induce apoptosis and increase sensitivity to apoptotic
signals was observed in both primary CD4 T cells and T-cell lines. In addition, using Tat mutants, we were able to genetically separate induction of apoptosis from other Tat functions, i.e.,
transactivation and FasL induction. Tat expression was found to
up-regulate casp-8, a protease involved in apoptotic pathways.
The up-regulation of casp-8 by Tat may result in the induction of
apoptosis and the increased sensitivity of cells to
apoptotic stimuli.
 |
MATERIALS AND METHODS |
Cells.
Jurkat and MT4 cells were maintained in RPMI with
10% fetal calf serum. 293T cells were grown in Dulbecco modified Eagle
medium containing 10% fetal calf serum. All cells lines were
propagated at 37°C-5% CO2 in a humidified chamber. All
cells lines were obtained from the American Type Culture Collection or
the NIH AIDS Repository Reagent Program.
To establish primary CD4 cell cultures, PBMC (107),
isolated by banding on Ficoll, were stained with a monoclonal antibody (MAb) to CD4 (Leu3A) and sorted by flow cytometry; 105 CD4
cells were used to establish primary CD4 cell lines. CD4 cells were
cultured in T-25 flasks with 25 × 106 irradiated
(3,000 rads) PBMC as feeders and stimulated with anti-CD3 (OKT3) at 30 ng/ml in RPMI supplemented with streptomycin (50 µg/ml), penicillin
(50 U/ml), 5 µM
-mercaptoethanol, and 10% human serum.
Interleukin-2 (IL-2) was added the next day to 20 U/ml and then added
every 2 to 3 days. The cells were reexpanded every 2 to 3 weeks by
restimulation with anti-CD3, followed by IL-2 every 2 to 3 days as
described for the initial expansion. The CD4 cells were used for
infection at days 10 to 14 after stimulation with anti-CD3.
Plasmids.
Proviral plasmids derived from pLai
(32) and mutations of the regulatory and accessory genes
(21) have been previously described.
Proviruses with a stop codon after the first exon of Tat (Tatex1) were
constructed by using overlapping oligonucleotides and
PCR. The 5'
primer was 5'CTCTATCAAAGTAGTAAGTAGTAC3', and the 3'
primer
was 5'GTACTACTTACTGCTTTGATAGAG3'. Insertion of the stop
codon was confirmed by
sequencing.
The HIV-1
tat gene (HXB2 strain) and the Tat C22G and Tat
K41A constructs were directly cloned into the LXSN retroviral vector
(
26). Tat C22G and Tat K41A were obtained from Andrew Rice
(Baylor
College of Medicine, Houston, Tex.) (
16). The first
exon of
Tat (Tat72) was amplified by PCR using primers to Tat that
inserted
a stop codon after the codon for amino acid 72. The 5' primer
was 5'CCGGAATTCCGGATGGAACCAGTA3', and the 3' primer was
5'CGCGGATCCGCGCTATTGCTTTGATAGAGA3'.
The 5' primer contains
an
EcoRI site, and the 3' primer contains
a
BamHI
site, which allowed direct cloning into
LXSN.
Virus stocks and infections.
Preparation of the HIV (by
transient cotransfection of proviral plasmid and vesicular stomatitis
virus G glycoprotein [VSV G] expression plasmid) and murine leukemia
virus (MLV) (by transient cotransfection of the vector, MLV packaging
plasmid, and VSV G expression plasmid) stocks has previously been
described (4, 5). HIV-1
env
rev stocks were
made by cotransfection of the proviral plasmid, the VSV G expression
plasmid, and a rev expression plasmid. The concentrated
virus stocks were aliquoted and stored at
70°C; titers were
determined by the MAGI assay (18).
Jurkat and MT4 cells were infected at a multiplicity of infection of 10 as described previously (
4,
5).
Jurkat cells infected with Tat-expressing retroviral vectors (LXSN
backbone) were selected in G418 at 0.8 mg/ml. Tat-expressing
cells were
analyzed when all cells in mock-infected cultures treated
with G418
were no longer
viable.
Flow cytometry and detection of apoptosis.
Induction
of apoptosis through the Fas receptor was initiated by using
MAb CH-11 (PanVera Corp., Madison, Wis.) at 50 ng/ml for 2 h.
Apoptosis was detected using a Boehringer Mannheim (Indianapolis, Ind.)
in situ cell death detection kit, which is based on
the TUNEL (terminal
deoxynucleotidyltransferase-mediated dUTP-biotin
nick end labeling)
method. The cells were prepared for labeling
by fixing with 1%
paraformaldehyde in phosphate-buffered saline
(PBS) at 4°C for 1 h or overnight. The cells were permeabilized
with 0.5% Tween 20 in PBS
and then labeled with fluorescein isothiocyanate
(FITC)-conjugated dUTP
according to the manufacturer's instructions.
After labeling, the
cells were analyzed by flow
cytometry.
The staining for intracellular p24 antigen has been previously
described (
5).
PCR.
RNA was isolated from cells by using Tri-reagent
(Molecular Research Center, Inc., Cincinnati, Ohio). The reverse
transcription (RT) reaction for the synthesis of cDNA was performed as
described previously (12). Sequences of the primers used for
detection of actin and FasL have been published elsewhere
(29). The primers span introns to ensure mRNA-specific amplification.
Western blot analysis.
Total cellular lysates were prepared
from uninfected and infected cells at 2 days postinfection. The lysates
were resolved on a 10% polyacrylamide gel and then transferred to an
Immobilon P membrane (Millipore, Bedford, Mass.), using a semidry
transfer apparatus. The membranes were blocked with 5% dried milk in
PBS and then probed with a MAb to casp-8 (Pharmingen, San Diego,
Calif.) at 1:1,000 and a MAb to tubulin (Sigma, St. Louis, Mo.) at
1:1,000 in 5% milk in PBS. The membranes were washed three times with PBS before the addition of the anti-mouse horseradish
peroxidase-conjugated secondary antibody (Sigma) at 1:10,000 in 5%
milk in PBS. Bound antibody was detected by enhanced chemiluminescence
(Amersham, Arlington Heights, Ill.) and exposure to X-ray film. Bands
densities were quantified with NIH Image software.
RPA.
Two days postinfection, total RNA was isolated from
uninfected and HIV-infected cells by using Tri-reagent (Molecular
Research Center). Two micrograms of total RNA was hybridized to the in vitro-transcribed hAPO-3 probe set as instructed by the manufacturer (Pharmingen). The RNA-probe hybrids were digested by using an RNase
protection assay (RPA) kit according to manufacturer's instructions for the RiboQuant assay system (Pharmingen). After samples were resolved on a 40-cm 5% polyacrylamide gel, the gel was dried and analyzed with a PhosphorImager (Molecular Dynamics).
Casp-8 assay and inhibition of casp-8 activity.
Casp-8
protease activity was detected by using the tetrapeptide substrate
IETD-AFC (7-amino-4-trifluormethyl coumarin) (ApoAlert FLICE/Casp-8
fluorescent assay; Clontech, Palo Alto, Calif.). Upon cleavage of the
substrate by casp-8, free AFC was detected by using a fluorometer with
a 400-nm excitation filter and a 505-nm emission filter. At 2 days
postinfection, 1 × 106 to 2 × 106
cells were lysed in 50 µl of the supplied lysis buffer and then analyzed according to the manufacturer's instructions. To verify that
the detected activity was due to casp-8, duplicate lysates were
incubated with the casp-8 inhibitor IETD-fmk (Clontech) prior to
incubation with the AFC substrate.
Casp-8 activity was inhibited by treating cells with the specific
casp-8 inhibitor IETD-fmk (Clontech) at 50 µM for 16 h.
After
the incubation, the cells were fixed in 1% paraformaldehyde
and
analyzed for apoptosis as described
above.
 |
RESULTS |
HIV-1
env induces apoptosis.
We wished
to evaluate the contribution of HIV-1 gene products other than
gp160/120 in apoptosis after HIV-1 infection. To do this, cells
were infected with high-titer VSV G pseudotypes of HIV-1 with a
deletion of the env gene (HIV-1
env) (Fig.
1A). We have previously demonstrated
(4) that this protocol establishes infection in essentially
100% of the culture during a single round of infection (Fig. 1B).
Jurkat cells infected with pseudotyped HIV-1
env or mock
infected were then analyzed by the TUNEL assay for the percentage of
cells undergoing apoptosis. Substantially higher numbers of
HIV-1
env-infected cells (11%) than mock-infected cells (1%) were apoptotic (Fig. 1C). The observed
apoptosis was not due to VSV G because not all VSV
G-pseudotyped mutant virions induce apoptosis (Fig.
2C, 1 exon
env). In
addition, high-titered MLV vector stocks pseudotyped with VSV G did not
induce apoptosis (data not shown). Thus, HIV-1 gene products
other than env are able to induce apoptosis of the
infected cell.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Method used to analyze HIV-1-induced apoptosis.
HIV-1 env was pseudotyped with VSV G (A) and used to
infect cells at multiplicity of infection that establishes 100%
infection (B). (C) Two days postinfection, the cells were analyzed for
apoptosis by the TUNEL method using FITC-UTP labeling.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
Genetic analysis of HIV-1- and HIV-1 Tat-induced
apoptosis. (A) Mutation of vif, vpr,
vpu, rev, and nef does not affect
HIV-1-induced apoptosis. Cells were infected with
HIV-1 env/VSV G pseudotypes, which were neither wild type
(wt) or mutated in one of the regulatory or accessary genes, and
analyzed for apoptosis by TUNEL 2 days postinfection. (B)
Full-length HIV-1 Tat but not Tatex1 expressed in the absence of other
HIV-1 proteins is able to induce apoptosis. Cells were infected
with retroviral vectors that express wild-type or mutant tat
genes. Cells expressing Tat were subsequently analyzed for
apoptosis by the TUNEL method and for the ability to
transactivate the viral LTR. The ability to transactivate the LTR was
measured by transfection of an LTR-luciferase construct and is
expressed at the bottom as fold activation relative to the value for
the empty vector. (C) Full-length Tat but not Tatex1 is able to induce
apoptosis when expressed from the HIV-1 provirus. Jurkat cells
were infected with an HIV-1 env/VSV G pseudotype that was
either wild type or rev and expressed one- or two-exon
Tat. Two days postinfection, the cells were analyzed for
apoptosis. The ability of the rev one- and
two-exon Tat viruses to transactivate the LTR was assessed by infecting
Jurkat cells containing an LTR-luciferase construct. Transactivation
ability is expressed at the bottom as fold activation relative to the
value for uninfected cells. N.d., not determined. Data in all panels
are means of at least three independent experiments.
|
|
A genetic approach was used to determine which HIV-1 gene(s) was
responsible for inducing apoptosis in the absence of
env.
The regulatory and accessory genes of HIV-1 were
mutated in the
provirus containing the deletion of
env, and
the viruses were
pseudotyped with VSV G. Infected cells were analyzed
at 2 days
postinfection for the number of apoptotic cells.
Mutation of
vpr,
nef,
vif,
vpu, or
rev alone did not impair the ability of
the
infecting virus to induce apoptosis (Fig.
2A). The
rev mutant
is deficient in transport of unspliced and singly
spliced viral
mRNA from the nucleus and therefore expresses only
tat and
nef (
24). The results indicate
that either multiple viral proteins
are capable of inducing
apoptosis or that
tat alone could be responsible
for
the induction of
apoptosis.
Therefore, we investigated directly the ability of Tat to induce
apoptosis, using a murine retroviral vector to express Tat
alone in the absence of other HIV-1 proteins. Jurkat cells infected
with retroviral vectors containing
tat constructs were
selected
in G418 and analyzed for apoptosis between days 7 and
10 postinfection.
All mock-infected cultures selected in G418 were no
longer viable
at these time points, as determined by trypan blue
exclusion (data
not shown). Indeed, Tat expression alone was found to
induced
significant numbers of apoptotic cells (Fig.
2B). In
addition,
Tat's ability to induce apoptosis was associated
with slower growth
of Tat-expressing cells than of vector-infected
cells (data not
shown).
Next, we used Tat mutants to determine if the induction of
apoptosis could be segregated from the essential function of
Tat
in transactivation of the viral LTR. Two Tat transactivation
mutants
(Tat C22G and Tat K41A) and a Tat construct that was truncated
at the end of the first exon (Tat72) were assayed for the ability
to
induce apoptosis. The C22G and K41A mutations disrupt binding
with a kinase complex essential for Tat transactivation activity
(
15,
16). Deletion of the second exon of Tat has been
reported
to have little effect on transactivation (
19).
The ability of the Tat mutants to transactivate the viral LTR was
confirmed by transfecting the Tat-expressing cells with
an
LTR-luciferase reporter plasmid (Fig.
2B). As anticipated,
the C22G and
K41A mutations did not transactivate the viral LTR,
whereas Tat72
performed nearly as well as wild-type Tat. When
the cells were
analyzed for apoptosis, both Tat C22G and Tat K41A
induced
apoptosis but Tat72 did not. Therefore, the induction
of
apoptosis is separate from the function of Tat in
transactivation
and requires expression of the second
exon.
To confirm that the second exon of
tat was required to
induce apoptosis in the context of a viral infection, we
constructed
a provirus that expressed only the first exon of
tat in the
env
rev backbone. Jurkat cells
were infected with equal numbers of infectious
units of
HIV-1
env, HIV-1
env
rev, or
HIV-1
env
rev tatex1 and
then analyzed for
apoptosis as described above. Only viruses that
expressed
two-exon Tat proteins were able to induce apoptosis
(Fig.
2C).
The amount of apoptosis induced by the Tatex1 provirus
was
comparable to that for mock-infected cells. To ascertain that
the
difference in the amount of apoptosis between
rev
viruses
with one-exon versus two-exon
tat genes was not due
to different
levels of infection, Jurkat cells containing an
LTR-luciferase
construct were infected with each virus. Nearly
equivalent levels
of activation of luciferase activity were observed
from equal
numbers of cells for each virus (Fig.
2C, bottom), which
indicates
equal levels of infection because luciferase activity is
dependent
on transactivation of the LTR by Tat following infection.
Therefore,
these results suggest that the second exon of Tat is
required
for Tat to induce
apoptosis.
Tat up-regulates FLICE/casp-8.
To determine how Tat induced
apoptosis, we examined the expression of a number of proteins
involved in apoptotic pathways. To determine the relative
amounts of RNA of proteins associated with apoptotic pathways,
we used a multiprobe RPA that allows the simultaneous analysis of
several RNA species. The RPA was performed on RNA isolated from
mock-infected cells and cells infected with viruses that express one-
or two-exon Tat proteins. Tat was found to up-regulate the level of
casp-8 RNA 2.5- to 4-fold relative to L32 and GAPDH control RNAs. The
increase in casp-8 was observed in cells infected with
HIV-1
env that expressed two-exon Tat but not one-exon Tat
(Fig. 3A). The increase in casp-8 levels
was apparently specific to casp-8 because the amounts of other RNAs such as FADD and Fas-associated factor (FAF) were equivalent (1- -1.5-fold) in uninfected and HIV-1
env-infected cells. In
some experiments a slight (1.5- to 2-fold) increase in the 55-kDa tumor necrosis factor receptor was observed. However, it is unlikely that
this increase in TNFRp55 contributed to the apoptosis observed in our system, as we observed no induction of apoptosis in
Jurkat cells treated with high concentrations of TNF for up to 48 h.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 3.
HIV-1 Tat up-regulates casp-8 mRNA and protein activity.
(A) The amount of casp-8 RNA is increased in HIV-1-infected cells which
express full-length Tat proteins. Jurkat cells were infected with an
HIV-1 env/VSV G pseudotype that was were wild type,
rev, or rev/Tatex1. Two days postinfection,
the RNA was isolated and subjected to RPA analysis. Two micrograms of
total RNA was analyzed for each sample. Positions of protected RNA
fragments for casp-8, FADD, FAF, TNFRp55, L32, and GAPDH are indicated.
The gel was analyzed with a PhosphorImager, and the fold increase in
specific RNA relative to value for L32 and GAPDH was determined. The
L32 and GAPDH blots are shorter exposures of the same gel. The probe
lane is undigested probe used for hybridization. Results representative
of the analysis of three individual infections are shown. (B)
HIV-1-infected cells expressing full-length Tat but not Tatex1 have
elevated casp-8 protein levels. Lysates of uninfected and infected
Jurkat cells were prepared 2 days postinfection and analyzed for casp-8
protein levels by Western blotting. Each lane was loaded with 1.5 × 105 cells. The fold increase in casp-8 levels was set
relative to the tubulin level. The lysates are from the same cells
analyzed by RPA in panel A. (C) Cells infected with HIV-1 which express
two-exon Tat proteins have elevated levels of casp-8 activity. At 2 days postinfection, 106 infected and uninfected Jurkat
cells were lysed and assayed for casp-8 activity by using a substrate
that releases a fluorophore upon cleavage. The activity is expressed as
the amount of AFC released from the AFC-substrate conjugate. The
experiment was repeated on at least three separate infections. The
results shown are from cells analyzed by RPA and Western blotting. (D)
Treatment of HIV-1-infected cells with a casp-8 inhibitor inhibits
induction of apoptosis. At 1 day postinfection, mock- or
HIV-1 env-infected cells were treated with IETD-fmk for
16 h and then analyzed for apoptosis.
|
|
We next assessed casp-8 protein levels in infected cells to determine
if the increase in casp-8 RNA resulted in increased
casp-8 protein.
Cell lysates from mock-infected cells and cells
infected with viruses
that express one- or two-exon Tat proteins
were analyzed by Western
blotting using a MAb directed to casp-8.
Levels of casp-8 protein were
approximately threefold higher in
cells infected with viruses which
express two-exon Tat proteins
than in mock-infected cells or cells
infected with a virus expressing
Tatex1 (Fig.
3B). Thus, there is also
an increase in casp-8
protein.
To determine if an increase in the cellular content of casp-8 resulted
in higher casp-8 enzymatic activity, we used using
the casp-8 substrate
IETD-AFC to assay mock- or HIV-1
env-infected
Jurkat cells
for the amount of casp-8 protease activity. Cleavage
of IETD-AFC by
casp-8 releases AFC, which is detected by fluorometry.
Casp-8 activity
was found to be elevated in HIV-1
env-infected
cells (Fig.
3C). To confirm that this increased activity was attributable
to Tat
and specifically to the second exon of Tat, Jurkat cells
were infected
with the
rev, and one- and two-exon
tat
viruses
described above. Cells infected with viruses expressing
full-length
two-exon Tat had increased casp-8 activity (Fig.
3C).
To demonstrate that casp-8 activity was required for
HIV-1
env to induce apoptosis, we treated
HIV-1
env-infected cells with
a specific inhibitor of
casp-8 (IETD-fmk). Treatment of cells
with the casp-8 inhibitor almost
completely reduced apoptosis
in HIV-1-infected cells to the
levels observed in mock-infected
cells (Fig.
3D). Thus, Tat induced
apoptosis is likely due to
the increase in casp-8
activity.
HIV-1
env-infected and Tat-expressing cells are more
susceptible to an apoptotic stimulus.
Casp-8 is coupled to
the Fas apoptotic pathway via the adaptor protein FADD.
Signaling through Fas recruits FADD to the receptor, and then FADD
recruits casp-8. Activation of casp-8 results in cleavage of downstream
caspases and apoptosis (6, 7, 27). We next tested
the sensitivity of HIV-1
env-infected cells to Fas-mediated apoptosis to examine whether increased casp-8
levels would increase sensitivity to apoptotic signals that
progress through casp-8. At 2 days postinfection, mock-infected and
HIV-infected cells were treated with a MAb to Fas that is able to
induce apoptosis. HIV-infected cells were more susceptible than
uninfected cells to Fas-mediated apoptosis (Fig.
4A). In addition, the increased sensitivity to anti-Fas was associated with Tat proteins that induce
casp-8 expression. HIV-1
env that expressed two-exon Tat proteins sensitized cells to Fas-mediated apoptosis, whereas
HIV-1
env that expressed only the one-exon Tat did not
(Fig. 4B). Analysis of casp-8 activity in lysates of anti-Fas-treated
cells mirrored the results obtained for cells analyzed for
apoptosis by TUNEL. Infected and uninfected Jurkat cells were
treated with anti-Fas (50 ng/ml) and then lysed and assayed for casp-8
activity by using a casp-8 substrate that releases a fluorophore upon
cleavage. Following treatment with equal amounts of anti-Fas, more
casp-8 activity was detected in cells infected with viruses expressing full-length Tat than in cells expressing one-exon Tat or in
mock-infected cells (Fig. 4C).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
HIV-1 Tat increases sensitivity to Fas-mediated
apoptosis. (A) Jurkat cells were infected with
HIV-1 env/VSV G pseudotypes and treated with anti-Fas
antibody 2 days postinfection. The amount of apoptosis was
detected by TUNEL with FITC-dUTP labeling. (B) HIV-1 expressing
full-length but not Tatex1 induces increased sensitivity to
Fas-mediated apoptosis. Jurkat cells infected with an
HIV-1 env/VSV G pseudotype that was either wild type,
rev, or rev/Tatex1 were exposed to anti-Fas
and analyzed as described above. The data are expressed as percent
specific apoptosis, calculated as (amount of apoptosis
due to anti-Fas amount of apoptosis due to no
treatment/100 amount of apoptosis due to no treatment) × 100. (C) Cells infected with HIV-1 which express two-exon Tat
proteins have increased casp-8 activity following anti-Fas stimulation.
At 2 days postinfection, 106 infected and uninfected Jurkat
cells treated with anti-Fas were lysed and assayed for casp-8 activity
by using a substrate that releases a fluorophore upon cleavage. The
activity is expressed as the amount of AFC released from the
AFC-substrate conjugate. The analysis of casp-8 activity was performed
on lysates of cells analyzed in panel B. Results of a representative
experiment of three independent trials are shown. (D) HIV-1 induces
apoptosis and increased sensitivity to Fas-mediated
apoptosis in primary CD4 T cells. Two days after infection with
HIV-1 env/VSV G, primary CD4 cells were analyzed for
expression of HIV-1 p24 antigen and apoptosis. Twenty percent
of the cells were infected. Events were acquired until the acquisition
of 5,000 p24-positive events. The histograms are from p24-positive and
p24-negative cells in the same culture.
|
|
We also analyzed cells that expressed Tat in the absence of other viral
proteins and confirmed the results obtained for HIV-1
env infection. The expression of Tat, Tat C22G, or K41A alone increased
sensitivity to Fas-mediated cell death, while the expression of
Tat72
had no effect on Fas sensitivity (data not
shown).
Increased apoptosis in HIV-1
env-infected
primary CD4 cells in the absence of env.
We also examined
whether HIV
env caused apoptosis and increased
sensitivity to anti-Fas in primary T cells. Primary CD4 T cells, which
were expanded by treatment with anti-CD3 and maintained with IL-2, were
infected with the VSV G-pseudotyped HIV
env and analyzed
for apoptosis at 2 days postinfection. Because infection of
primary cells with the pseudotyped HIV-1 does not result in 100%
infection, the cells were analyzed both for p24 antigen expression with
an anti-p24 MAb and for apoptosis by TUNEL. The data shown for
the uninfected cells are from cells in the infected culture that were
negative for p24 antigen expression. The amount of apoptosis observed in the p24-negative cells in the infected culture was equivalent to the amount of apoptosis observed in cells from a culture not exposed to virus (data not shown). Similar to the results
obtained with a T-cell line, HIV
env induced
apoptosis and increased sensitivity to Fas-mediated
apoptosis in primary CD4 T cells (Fig. 4D). Moreover, increased
apoptosis was observed only in p24-positive cells and not
uninfected cells in the same culture, suggesting that soluble products
were not initiating apoptosis.
Induction of apoptosis and induction of FasL expression are
genetically separable functions of Tat.
Tat has previously been
reported to induce the expression of FasL (41). Therefore,
it remained possible that the increased casp-8 activity was due to FasL
interactions with Fas in HIV-1
env-infected cell cultures.
To determine whether Tat required FasL-Fas interactions to induce
apoptosis, we assessed the ability of Tat and
HIV-1
env to induce apoptosis in a Fas-resistant
cell line. MT4 cells are not sensitive to Fas-mediated
apoptosis (Fig. 5A), and
treatment of MT4 cells with anti-Fas does not induce casp-8 activity
(Fig. 5C). Nonetheless, HIV-1
env infection (Fig. 5A) and
Tat expression (Fig. 5B) were able to induce apoptosis in MT4
cells. HIV-1
env-infected MT4 cells were also analyzed for
increased casp-8 activity, and as observed for Jurkat cells,
HIV-1
env infection up-regulated casp-8 activity (Fig. 5C)
in the absence of an external stimulus. Because MT4 cells are resistant
to Fas-mediated signaling, there was no increase in casp-8 activity
following anti-Fas treatment. Thus, Tat does not require FasL-Fas
interaction to induce apoptosis, and the increase in casp-8
activity in HIV-1
env-infected cells does not require
FasL-Fas interaction.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Tat-induced apoptosis is independent of
Tat-mediated FasL induction. HIV-1 env infection (A) or
Tat expression (B) induces apoptosis in Fas-resistant MT4
cells. MT4 cells that were infected with HIV-1 env/VSV G
were analyzed for apoptosis by TUNEL 2 days postinfection.
Treatment with anti-Fas had no effect on the level of apoptosis
in uninfected or infected cells. Tat- or Tat72-expressing cells were
analyzed for apoptosis by TUNEL. Results of a representative
experiment of three individual repetitions are shown. (C) HIV-1 induces
increased casp-8 activity in Fas-resistant MT4 cells. Two days
postinfection, 106 infected or uninfected MT4 cells were
assayed for casp-8 activity by using a substrate that releases a
fluorophore upon cleavage. The results shown are from the analysis of
lysates for cells analyzed for apoptosis in panel A. Activity
is expressed as the amount of AFC released. (D) Induction of FasL by
Tat is separate from the functions of transactivation and induction of
apoptosis. RNA from Jurkat cells expressing Tat, Tat72, Tat
C22G, or Tat K41A was analyzed for the expression of FasL and actin
mRNA by RT-PCR. One microgram of total RNA was used in the RT reaction.
WT, wild type.
|
|
That Tat did not require FasL-Fas interactions to induce
apoptosis suggested that the induction of apoptosis and
the induction
of FasL expression were genetically separable.
Therefore, the
Tat mutants described above were examined for
the ability to induce
expression of FasL. Cells expressing Tat and each
of the mutants
C22G, K41A, and Tat72 were analyzed for FasL expression
by RT-PCR.
All
tat alleles examined were able to induce FasL
(Fig.
5D). Tat72
can induce FasL but is deficient in inducing
apoptosis. Thus,
FasL induction and induction of
apoptosis map to different regions
of the Tat protein. The data
obtained with MT4 cells and Tat mutants
indicate that Tat does not
require FasL-Fas interactions to induce
apoptosis. Rather, the
ability of Tat to induce apoptosis correlates
with the
up-regulation of casp-8
expression.
 |
DISCUSSION |
Here we demonstrate that HIV Tat sensitizes infected cells to
apoptotic signals. It is likely that the increased levels of casp-8 protein in HIV-1
env-infected and Tat-expressing
cells directly contributes to apoptosis and increased
sensitivity to apoptotic signals in both T-cell lines and
primary CD4 cells. The up-regulation of casp-8 requires the second exon
of Tat, and this function is genetically separable from both
transactivation of the viral LTR and induction of FasL expression.
Increases in casp-8 mediated by Tat may contribute to the increased
apoptosis associated with HIV-1 disease.
Casp-8, the most proximal caspase to the death receptors, is believed
to be responsible for initiating the stepwise activation of
multiple caspases, resulting in the signaling cascade that leads
to the apoptotic death of the cell (9, 37, 39). We propose the following model for Tat-mediated apoptosis and
increased sensitivity to apoptotic signals (Fig.
6). Tat increases the levels of casp-8
RNA, with a resulting increase in casp-8 protein. The increased
cellular content of casp-8 leads to an increase in casp-8 activity,
resulting in the induction of apoptosis. In addition, the
increased casp-8 levels may allow for an increase in the recruitment of
casp-8 to the occupied death receptor with a concomitant increased sensitivity to the apoptotic stimulus. This would explain the elevated sensitivity to anti-Fas, as Fas is a death receptor that signals through casp-8. This model is consistent with the observation that increased expression of casp-8 can result in apoptosis
(27). Furthermore, increased expression of some caspases has
been demonstrated to increase sensitivity to apoptotic signals
(23). Because a number of apoptotic stimuli proceed
through casp-8, Tat may increase sensitivity to a variety of
apoptotic signals. This may in part explain the observation
that the PBMC of HIV-infected persons are more susceptible to
apoptosis by a number of stimuli.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 6.
Model of Tat-mediated induction of apoptosis and
increased sensitivity to Fas-mediated apoptosis. Tat increases
the expression of pro-casp-8 RNA by an undefined mechanism, resulting
in increased pro-casp-8 protein, which can result in apoptosis.
Sensitivity to Fas-mediated apoptosis is elevated because
increased amounts of pro-casp-8 allows for increased recruitment to the
occupied receptor.
|
|
Tat has been reported to both inhibit (11, 25, 45, 47) and
induce (17, 22, 25, 31, 33, 35, 41) apoptosis. The
observed ability of Tat to inhibit apoptosis may result from selecting stable cell lines expressing Tat, which would coselect cells
with increased resistance to the apoptosis mediated by Tat. An
earlier study attributed Tat-induced apoptosis to the
up-regulation of the apoptosis effector molecule FasL, which
resulted in FasL-Fas interactions in the culture and apoptosis
(41). Although we confirmed that Tat induces FasL mRNA
expression (Fig. 5D), we found that Tat does not require FasL-Fas
interactions to induce apoptosis, and Tat induction of
apoptosis is genetically separable from the induction of FasL.
Nonetheless, the induction of FasL by Tat could contribute to the
apoptosis attributable to Tat in cell culture. Indeed, Tat
would heighten the sensitivity of cells to FasL because of increased
casp-8 expression.
How Tat up-regulates casp-8 expression remains to be defined. Moreover,
it has not been determined if the induction of casp-8 and the resulting
apoptosis is a bona fide function of Tat or a consequence of an
unidentified function. However, we were able to genetically separate
the induction of apoptosis from the function of Tat in inducing
FasL expression and the essential function of Tat in transactivating
the viral promoter. We have also found that the HIV-2 Tat protein
induces apoptosis (data not shown). Therefore, because the
function of inducing apoptosis is conserved in the
evolutionarily distinct but related HIV-2, this finding suggests that
it may fulfill an important role in viral replication.
HIV infection is characterized by the loss of CD4 T cells, and
apoptosis may be the major mechanism of CD4 cell elimination. The mechanisms that contribute to the apoptotic death of CD4
cells are likely multifactorial. HIV-1 Tat is able to induce
apoptosis and increase sensitivity to an apoptotic
stimulus in a time frame equivalent to the half-life of infected cells
in vivo. Other HIV-1 proteins (gp120, Vpr, and Nef) have also been
reported to regulate apoptosis. Understanding the relative
contribution of each viral component to the apoptosis
associated with HIV-1 infection will be important in determining the
role of HIV-induced cell death in AIDS pathogenesis.
 |
ACKNOWLEDGMENTS |
We thank W. C. Goh, M. Linial, P. Nieman, and M. A. Vodicka for comments on the manuscript and the FHCRC Flow Cytometry,
Image Analysis, and Biotechnology Laboratories.
This work was supported by Elizabeth Glaser Pediatric AIDS Foundation
grant PF-77330 to S.R.B. and NIH grant AI 30927 to M.E.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Divisions of
Molecular Medicine and Basic Science, Fred Hutchinson Cancer Research Center, 1100 Fairview Ave. N., C2-023, P.O. Box 19024, Seattle, WA 98109-1024. Phone: (206) 667-5058. Fax: (206) 667-6523. E-mail: memerman{at}fhcrc.org.
 |
REFERENCES |
| 1.
|
Ameisen, J. C.
1992.
Programmed cell death and AIDS: from hypothesis to experiment.
Immunol. Today
13:388-391[Medline].
|
| 2.
|
Ameisen, J. C.,
J. Estaquier,
T. Idziorek, and F. De Bels.
1995.
Programmed cell death and AIDS pathogenesis: significance and potential mechanisms.
Curr. Top. Microbiol. Immunol.
200:195-211[Medline].
|
| 3.
|
Ayyavoo, V.,
A. Mahboubi,
S. Mahalingam,
R. Ramalingam,
S. Kudchodkar,
W. V. Williams,
D. R. Green, and D. B. Weiner.
1997.
HIV-1 Vpr suppresses immune activation and apoptosis through regulation of nuclear factor kappa B.
Nat. Med.
3:1117-1123[Medline].
|
| 4.
|
Bartz, S. R.,
M. E. Rogel, and M. Emerman.
1996.
Human immunodeficiency virus type 1 cell cycle control: Vpr is cytostatic and mediates G2 accumulation by a mechanism which differs from DNA damage checkpoint control.
J. Virol.
70:2324-2331[Abstract].
|
| 5.
|
Bartz, S. R., and M. A. Vodicka.
1997.
Production of high-titer human immunodeficiency virus type 1 pseudotyped with vesicular stomatitis virus glycoprotein.
Methods
12:337-342[Medline].
|
| 6.
|
Boldin, M. P.,
T. M. Goncharov,
Y. V. Goltsev, and D. Wallach.
1996.
Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death.
Cell
85:803-815[Medline].
|
| 7.
|
Chinnaiyan, A. M.,
K. O'Rourke,
M. Tewari, and V. M. Dixit.
1995.
FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis.
Cell
81:505-512[Medline].
|
| 8.
|
Conti, L.,
G. Rainaldi,
P. Matarrese,
B. Varano,
R. Rivabene,
S. Columba,
A. Sato,
F. Belardelli,
W. Malorni, and S. Gessani.
1998.
The HIV-1 vpr protein acts as a negative regulator of apoptosis in a human lymphoblastoid T cell line: possible implications for the pathogenesis of AIDS.
J. Exp. Med.
187:403-413[Abstract/Free Full Text].
|
| 9.
|
Fernandes-Alnemri, T.,
R. C. Armstrong,
J. Krebs,
S. M. Srinivasula,
L. Wang,
F. Bullrich,
L. C. Fritz,
J. A. Trapani,
K. J. Tomaselli,
G. Litwack, and E. S. Alnemri.
1996.
In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains.
Proc. Natl. Acad. Sci. USA
93:7464-7469[Abstract/Free Full Text].
|
| 10.
|
Gaynor, R. B.
1995.
Regulation of HIV-1 gene expression by the transactivator protein tat.
Curr. Top. Microbiol. Immunol.
193:51-77[Medline].
|
| 11.
|
Gibellini, D.,
A. Caputo,
C. Celeghini,
A. Bassini,
M. La Placa,
S. Capitani, and G. Zauli.
1995.
Tat-expressing Jurkat cells show an increased resistance to different apoptotic stimuli, including acute human immunodeficiency virus-type 1 (HIV-1) infection.
Br. J. Haematol.
89:24-33[Medline].
|
| 12.
|
Goh, W. C.,
M. E. Rogel,
C. M. Kinsey,
S. F. Michael,
P. N. Fultz,
M. A. Nowak,
B. H. Hahn, and M. Emerman.
1998.
HIV-1 Vpr increases viral expression by manipulation of the cell cycle: a mechanism for selection of Vpr in vivo.
Nat. Med.
4:65-71[Medline].
|
| 13.
|
Gougeon, M.-L.,
A. G. Laurent-Crawford,
A. G. Hovanessian, and L. Montagnier.
1993.
Direct and indirect mechanisms mediating apoptosis during HIV infection: contribution to in vivo CD4 T cell depletion.
Semin. Immunol.
5:187-194[Medline].
|
| 14.
|
Herbein, G.,
C. Van Lint,
J. L. Lovett, and E. Verdin.
1998.
Distinct mechanisms trigger apoptosis in human immunodeficiency virus type 1-infected and in uninfected bystander T lymphocytes.
J. Virol.
72:660-670[Abstract/Free Full Text].
|
| 15.
|
Herrmann, C. H., and A. P. Rice.
1995.
Lentivirus Tat proteins specifically associate with a cellular protein kinase, TAK, that hyperphosphorylates the carboxyl-terminal domain of the large subunit of RNA polymerase II: candidate for a Tat cofactor.
J. Virol.
69:1612-1620[Abstract].
|
| 16.
|
Herrmann, C. H., and A. P. Rice.
1993.
Specific interaction of the human immunodeficiency virus Tat proteins with a cellular protein kinase.
Virology
197:601-608[Medline].
|
| 17.
|
Katsikis, P. D.,
M. E. Garcia-Ojeda,
J. F. Torres-Roca,
D. R. Greenwald, and L. A. Herzenberg.
1997.
HIV type 1 Tat protein enhances activation but not Fas (CD95)-induced peripheral blood T cell apoptosis in healthy individuals.
Int. Immunol.
9:835-841[Abstract/Free Full Text].
|
| 18.
|
Kimpton, J., and M. Emerman.
1992.
Detection of replication-competent and pseudotyped human immunodeficiency virus with a sensitive cell line on the basis of activation of an integrated -galactosidase gene.
J. Virol.
66:2232-2239[Abstract/Free Full Text].
|
| 19.
|
Kuppuswamy, M.,
T. Subramanian,
A. Srinivasan, and G. Chinnadurai.
1989.
Multiple functional domains of Tat, the trans-activator of HIV-1, defined by mutational analysis.
Nucleic Acids Res.
17:3551-3561[Abstract/Free Full Text].
|
| 20.
|
Kuwana, T.,
J. J. Smith,
M. Muzio,
V. Dixit,
D. D. Newmeyer, and S. Kornbluth.
1998.
Apoptosis induction by caspase-8 is amplified through the mitochondrial release of cytochrome c.
J. Biol. Chem.
273:16589-16594[Abstract/Free Full Text].
|
| 21.
|
Lewis, P.,
M. Hensel, and M. Emerman.
1992.
Human immunodeficiency virus infection of cells arrested in the cell cycle.
EMBO J.
11:3053-3058[Medline]. (Erratum, 11:4249.)
|
| 22.
|
Li, C. J.,
D. J. Friedman,
C. Wang,
V. Metelev, and A. B. Pardee.
1995.
Induction of apoptosis in uninfected lymphocytes by HIV-1 Tat protein.
Science
268:429-431[Abstract/Free Full Text].
|
| 23.
|
Los, M.,
M. Van de Craen,
L. C. Penning,
H. Schenk,
M. Westendorp,
P. A. Baeuerle,
W. Droge,
P. H. Krammer,
W. Fiers, and K. Schulze-Osthoff.
1995.
Requirement of an ICE/CED-3 protease for Fas/APO-1-mediated apoptosis.
Nature
375:81-83[Medline].
|
| 24.
|
Malim, M. H., and B. R. Cullen.
1993.
Rev and the fate of pre-mRNA in the nucleus: implications for the regulation of RNA processing in eukaryotes.
Mol. Cell. Biol.
13:6180-6189[Abstract/Free Full Text].
|
| 25.
|
McCloskey, T. W.,
M. Ott,
E. Tribble,
S. A. Khan,
S. Teichberg,
M. O. Paul,
S. Pahwa,
E. Verdin, and N. Chirmule.
1997.
Dual role of HIV Tat in regulation of apoptosis in T cells.
J. Immunol.
158:1014-1019[Abstract].
|
| 26.
|
Miller, A. D., and G. J. Rosman.
1989.
Improved retroviral vectors for gene transfer and expression.
BioTechniques
7:980-982[Medline].
|
| 27.
|
Muzio, M.,
A. M. Chinnaiyan,
F. C. Kischkel,
K. O'Rourke,
A. Shevchenko,
J. Ni,
C. Scaffidi,
J. D. Bretz,
M. Zhang,
R. Gentz,
M. Mann,
P. H. Krammer,
M. E. Peter, and V. M. Dixit.
1996.
FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex.
Cell
85:817-827[Medline].
|
| 28.
|
Muzio, M.,
B. R. Stockwell,
H. R. Stennicke,
G. S. Salvesen, and V. M. Dixit.
1998.
An induced proximity model for caspase-8 activation.
J. Biol. Chem.
273:2926-2930[Abstract/Free Full Text].
|
| 29.
|
O'Connell, J.,
G. C. O'Sullivan,
J. K. Collins, and F. Shanahan.
1996.
The Fas counterattack: Fas-mediated T cell killing by colon cancer cells expressing Fas ligand.
J. Exp. Med.
184:1075-1082[Abstract/Free Full Text].
|
| 30.
|
Okada, H.,
R. Takei, and M. Tashiro.
1997.
HIV-1 Nef protein-induced apoptotic cytolysis of a broad spectrum of uninfected human blood cells independently of CD95(Fas).
FEBS Lett.
414:603-606[Medline].
|
| 31.
|
Patki, A. H., and M. M. Lederman.
1996.
HIV-1 Tat protein and its inhibitor Ro 24-7429 inhibit lymphocyte proliferation and induce apoptosis in peripheral blood mononuclear cells from healthy donors.
Cell. Immunol.
169:40-46[Medline].
|
| 32.
|
Peden, K.,
M. Emerman, and L. Montagnier.
1991.
Changes in growth properties on passage in tissue culture of viruses derived from infectious molecular clones of HIV-1LAI, HIV-1MAL, and HIV-1ELI.
Virology
185:661-672[Medline].
|
| 33.
|
Purvis, S. F.,
J. W. Jacobberger,
R. M. Sramkoski,
A. H. Patki, and M. M. Lederman.
1995.
HIV type 1 Tat protein induces apoptosis and death in Jurkat cells.
AIDS Res. Hum. Retroviruses
11:443-450[Medline].
|
| 34.
|
Salvesen, G. S., and V. M. Dixit.
1997.
Caspases: intracellular signaling by proteolysis.
Cell
91:443-446[Medline].
|
| 35.
|
Sastry, K. J.,
M. C. Marin,
P. N. Nehete,
K. McConnell,
A. K. el-Naggar, and T. J. McDonnell.
1996.
Expression of human immunodeficiency virus type I tat results in down-regulation of bcl-2 and induction of apoptosis in hematopoietic cells.
Oncogene
13:487-493[Medline].
|
| 36.
|
Siliciano, R. F.
1996.
The role of CD4 in HIV envelope-mediated pathogenesis.
Curr. Top. Microbiol. Immunol.
205:159-179[Medline].
|
| 37.
|
Srinivasula, S. M.,
M. Ahmad,
T. Fernandes-Alnemri,
G. Litwack, and E. S. Alnemri.
1996.
Molecular ordering of the Fas-apoptotic pathway: the Fas/APO-1 protease Mch5 is a CrmA-inhibitable protease that activates multiple Ced-3/ICE-like cysteine proteases.
Proc. Natl. Acad. Sci. USA
93:14486-14491[Abstract/Free Full Text].
|
| 38.
|
Stewart, S. A.,
B. Poon,
J. B. Jowett, and I. S. Chen.
1997.
Human immunodeficiency virus type 1 Vpr induces apoptosis following cell cycle arrest.
J. Virol.
71:5579-5592[Abstract].
|
| 39.
|
Takahashi, A.,
H. Hirata,
S. Yonehara,
Y. Imai,
K. K. Lee,
R. W. Moyer,
P. C. Turner,
P. W. Mesner,
T. Okazaki,
H. Sawai,
S. Kishi,
K. Yamamoto,
M. Okuma, and M. Sasada.
1997.
Affinity labeling displays the stepwise activation of ICE-related proteases by Fas, staurosporine, and CrmA-sensitive caspase-8.
Oncogene
14:2741-2752[Medline].
|
| 40.
|
Teodoro, J. G., and P. E. Branton.
1997.
Regulation of apoptosis by viral gene products.
J. Virol.
71:1739-1746[Medline].
|
| 41.
|
Westendorp, M. O.,
R. Frank,
C. Ochsenbauer,
K. Stricker,
J. Dhein,
H. Walczak,
K. M. Debatin, and P. H. Krammer.
1995.
Sensitization of T cells to CD95-mediated apoptosis by HIV-1 Tat and gp120.
Nature
375:497-500[Medline].
|
| 42.
|
Westendorp, M. O.,
V. A. Shatrov,
K. Schulze-Osthoff,
R. Frank,
M. Kraft,
M. Los,
P. H. Krammer,
W. Droge, and V. Lehmann.
1995.
HIV-1 Tat potentiates TNF-induced NF- B activation and cytotoxicity by altering the cellular redox state.
EMBO J.
14:546-554[Medline].
|
| 43.
|
Yang, X.,
H. Y. Chang, and D. Baltimore.
1998.
Autoproteolytic activation of pro-caspases by oligomerization.
Mol. Cell.
1:319-325[Medline].
|
| 44.
|
Yao, X. J.,
A. J. Mouland,
R. A. Subbramanian,
J. Forget,
N. Rougeau,
D. Bergeron, and E. A. Cohen.
1998.
Vpr stimulates viral expression and induces cell killing in human immunodeficiency virus type 1-infected dividing Jurkat T cells.
J. Virol.
72:4686-4693[Abstract/Free Full Text].
|
| 45.
|
Zauli, G.,
D. Gibellini,
A. Caputo,
A. Bassini,
M. Negrini,
M. Monne,
M. Mazzoni, and S. Capitani.
1995.
The human immunodeficiency virus type-1 Tat protein upregulates Bcl-2 gene expression in Jurkat T-cell lines and primary peripheral blood mononuclear cells.
Blood
86:3823-3834[Abstract/Free Full Text].
|
| 46.
|
Zauli, G.,
D. Gibellini,
C. Celeghini,
C. Mischiati,
A. Bassini,
M. La Placa, and S. Capitani.
1996.
Pleiotropic effects of immobilized versus soluble recombinant HIV-1 Tat protein on CD3-mediated activation, induction of apoptosis, and HIV-1 long terminal repeat transactivation in purified CD4+ T lymphocytes.
J. Immunol.
157:2216-2224[Abstract].
|
| 47.
|
Zauli, G.,
D. Gibellini,
D. Milani,
M. Mazzoni,
P. Borgatti,
M. La Placa, and S. Capitani.
1993.
Human immunodeficiency virus type 1 Tat protein protects lymphoid, epithelial, and neuronal cell lines from death by apoptosis.
Cancer Res.
53:4481-4485[Abstract/Free Full Text].
|
Journal of Virology, March 1999, p. 1956-1963, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chan, E. Y., Sutton, J. N., Jacobs, J. M., Bondarenko, A., Smith, R. D., Katze, M. G.
(2009). Dynamic Host Energetics and Cytoskeletal Proteomes in Human Immunodeficiency Virus Type 1-Infected Human Primary CD4 Cells: Analysis by Multiplexed Label-Free Mass Spectrometry. J. Virol.
83: 9283-9295
[Abstract]
[Full Text]
-
Gutierrez-Sanmartin, D., Varela-Ledo, E., Aguilera, A., Romero-Yuste, S., Romero-Jung, P., Gomez-Tato, A., Regueiro, B. J.
(2008). Implication of p38 mitogen-activated protein kinase isoforms ({alpha}, {beta}, {gamma} and {delta}) in CD4+ T-cell infection with human immunodeficiency virus type I. J. Gen. Virol.
89: 1661-1671
[Abstract]
[Full Text]
-
Mahlknecht, U., Dichamp, I., Varin, A., Van Lint, C., Herbein, G.
(2008). NF-{kappa}B-dependent control of HIV-1 transcription by the second coding exon of Tat in T cells. J. Leukoc. Biol.
83: 718-727
[Abstract]
[Full Text]
-
Pingle, S. C., Jajoo, S., Mukherjea, D., Sniderhan, L. F., Jhaveri, K. A., Marcuzzi, A., Rybak, L. P., Maggirwar, S. B., Ramkumar, V.
(2007). Activation of the Adenosine A1 Receptor Inhibits HIV-1 Tat-Induced Apoptosis by Reducing Nuclear Factor-{kappa}B Activation and Inducible Nitric-Oxide Synthase. Mol. Pharmacol.
72: 856-867
[Abstract]
[Full Text]
-
O'Hara, S. P., Small, A. J., Nelson, J. B., Badley, A. D., Chen, X.-M., Gores, G. J., LaRusso, N. F.
(2007). The Human Immunodeficiency Virus Type 1 Tat Protein Enhances Cryptosporidium parvum-Induced Apoptosis in Cholangiocytes via a Fas Ligand-Dependent Mechanism. Infect. Immun.
75: 684-696
[Abstract]
[Full Text]
-
Madani, N., Hubicki, A. M., Perdigoto, A. L., Springer, M., Sodroski, J.
(2007). Inhibition of Human Immunodeficiency Virus Envelope Glycoprotein- Mediated Single Cell Lysis by Low-Molecular-Weight Antagonists of Viral Entry. J. Virol.
81: 532-538
[Abstract]
[Full Text]
-
Zhang, M., Drenkow, J., Lankford, C. S. R., Frucht, D. M., Rabin, R. L., Gingeras, T. R., Venkateshan, C., Schwartzkopff, F., Clouse, K. A., Dayton, A. I.
(2006). HIV regulation of the IL-7R: a viral mechanism for enhancing HIV-1 replication in human macrophages in vitro. J. Leukoc. Biol.
79: 1328-1338
[Abstract]
[Full Text]
-
Iannello, A., Debbeche, O., Martin, E., Attalah, L. H., Samarani, S., Ahmad, A.
(2006). Viral strategies for evading antiviral cellular immune responses of the host. J. Leukoc. Biol.
79: 16-35
[Abstract]
[Full Text]
-
Montano, M., Rarick, M., Sebastiani, P., Brinkmann, P., Skefos, J., Ericksen, R.
(2006). HIV-1 burden influences host response to co-infection with Neisseria gonorrhoeae in vitro. Int Immunol
18: 125-137
[Abstract]
[Full Text]
-
Campbell, G. R., Watkins, J. D., Esquieu, D., Pasquier, E., Loret, E. P., Spector, S. A.
(2005). The C Terminus of HIV-1 Tat Modulates the Extent of CD178-mediated Apoptosis of T Cells. J. Biol. Chem.
280: 38376-38382
[Abstract]
[Full Text]
-
Arp, J., Rieder, M. J., Urquhart, B., Freeman, D., Tucker, M. J., Krizova, A., Lehmann, D., Dekaban, G. A.
(2005). Hypersensitivity of HIV-1-Infected Cells to Reactive Sulfonamide Metabolites Correlated to Expression of the HIV-1 Viral Protein Tat. J. Pharmacol. Exp. Ther.
314: 1218-1225
[Abstract]
[Full Text]
-
Wiegand, M., Bossow, S., Neubert, W. J.
(2005). Sendai virus trailer RNA simultaneously blocks two apoptosis-inducing mechanisms in a cell type-dependent manner. J. Gen. Virol.
86: 2305-2314
[Abstract]
[Full Text]
-
Billotey, C., Aspord, C., Beuf, O., Piaggio, E., Gazeau, F., Janier, M. F., Thivolet, C.
(2005). T-Cell Homing to the Pancreas in Autoimmune Mouse Models of Diabetes: In Vivo MR Imaging. Radiology
236: 579-587
[Abstract]
[Full Text]
-
Acheampong, E. A., Parveen, Z., Muthoga, L. W., Wasmuth-Peroud, V., Kalayeh, M., Bashir, A., Diecidue, R., Mukhtar, M., Pomerantz, R. J.
(2005). Molecular Interactions of Human Immunodeficiency Virus Type 1 with Primary Human Oral Keratinocytes. J. Virol.
79: 8440-8453
[Abstract]
[Full Text]
-
Walker, F., Adle-Biassette, H., Madelenat, P., Henin, D., Lehy, T.
(2005). Increased Apoptosis in Cervical Intraepithelial Neoplasia Associated with HIV Infection: Implication of Oncogenic Human Papillomavirus, Caspases, and Langerhans Cells. Clin. Cancer Res.
11: 2451-2458
[Abstract]
[Full Text]
-
Campbell, G. R., Pasquier, E., Watkins, J., Bourgarel-Rey, V., Peyrot, V., Esquieu, D., Barbier, P., de Mareuil, J., Braguer, D., Kaleebu, P., Yirrell, D. L., Loret, E. P.
(2004). The Glutamine-rich Region of the HIV-1 Tat Protein Is Involved in T-cell Apoptosis. J. Biol. Chem.
279: 48197-48204
[Abstract]
[Full Text]
-
Coberley, C. R., Kohler, J. J., Brown, J. N., Oshier, J. T., Baker, H. V., Popp, M. P., Sleasman, J. W., Goodenow, M. M.
(2004). Impact on Genetic Networks in Human Macrophages by a CCR5 Strain of Human Immunodeficiency Virus Type 1. J. Virol.
78: 11477-11486
[Abstract]
[Full Text]
-
Moreau, E., Belliard, G., Partidos, C. D., Pradezinsky, F., Le Buanec, H., Muller, S., Desgranges, C.
(2004). Important B-cell epitopes for neutralization of human immunodeficiency virus type 1 Tat in serum samples of humans and different animal species immunized with Tat protein or peptides. J. Gen. Virol.
85: 2893-2901
[Abstract]
[Full Text]
-
Yamashita, M., Emerman, M.
(2004). Capsid Is a Dominant Determinant of Retrovirus Infectivity in Nondividing Cells. J. Virol.
78: 5670-5678
[Abstract]
[Full Text]
-
Hood, C., Cunningham, A. L., Slobedman, B., Boadle, R. A., Abendroth, A.
(2003). Varicella-Zoster Virus-Infected Human Sensory Neurons Are Resistant to Apoptosis, yet Human Foreskin Fibroblasts Are Susceptible: Evidence for a Cell-Type-Specific Apoptotic Response. J. Virol.
77: 12852-12864
[Abstract]
[Full Text]
-
Komoto, S., Tsuji, S., Ibrahim, M. S., Li, Y.-G., Warachit, J., Taniguchi, K., Ikuta, K.
(2003). The Vpu Protein of Human Immunodeficiency Virus Type 1 Plays a Protective Role against Virus-Induced Apoptosis in Primary CD4+ T Lymphocytes. J. Virol.
77: 10304-10313
[Abstract]
[Full Text]
-
Alimonti, J. B., Ball, T. B., Fowke, K. R.
(2003). Mechanisms of CD4+ T lymphocyte cell death in human immunodeficiency virus infection and AIDS. J. Gen. Virol.
84: 1649-1661
[Abstract]
[Full Text]
-
LaBonte, J. A., Madani, N., Sodroski, J.
(2003). Cytolysis by CCR5-Using Human Immunodeficiency Virus Type 1 Envelope Glycoproteins Is Dependent on Membrane Fusion and Can Be Inhibited by High Levels of CD4 Expression. J. Virol.
77: 6645-6659
[Abstract]
[Full Text]
-
Yang, Y., Tikhonov, I., Ruckwardt, T. J., Djavani, M., Zapata, J. C., Pauza, C. D., Salvato, M. S.
(2003). Monocytes Treated with Human Immunodeficiency Virus Tat Kill Uninfected CD4+ Cells by a Tumor Necrosis Factor-Related Apoptosis-Induced Ligand-Mediated Mechanism. J. Virol.
77: 6700-6708
[Abstract]
[Full Text]
-
Tikhonov, I., Ruckwardt, T. J., Hatfield, G. S., Pauza, C. D.
(2003). Tat-Neutralizing Antibodies in Vaccinated Macaques. J. Virol.
77: 3157-3166
[Abstract]
[Full Text]
-
Bitzer, M., Armeanu, S., Prinz, F., Ungerechts, G., Wybranietz, W., Spiegel, M., Bernlohr, C., Cecconi, F., Gregor, M., Neubert, W. J., Schulze-Osthoff, K., Lauer, U. M.
(2002). Caspase-8 and Apaf-1-independent Caspase-9 Activation in Sendai Virus-infected Cells. J. Biol. Chem.
277: 29817-29824
[Abstract]
[Full Text]
-
Labrada, L., Bodelon, G., Vinuela, J., Benavente, J.
(2002). Avian Reoviruses Cause Apoptosis in Cultured Cells: Viral Uncoating, but Not Viral Gene Expression, Is Required for Apoptosis Induction. J. Virol.
76: 7932-7941
[Abstract]
[Full Text]
-
Li, J., Liu, Y., Kim, B. O., He, J. J.
(2002). Direct Participation of Sam68, the 68-Kilodalton Src-Associated Protein in Mitosis, in the CRM1-Mediated Rev Nuclear Export Pathway. J. Virol.
76: 8374-8382
[Abstract]
[Full Text]
-
Hay, S., Kannourakis, G.
(2002). A time to kill: viral manipulation of the cell death program. J. Gen. Virol.
83: 1547-1564
[Abstract]
[Full Text]
-
Yang, Y., Dong, B., Mittelstadt, P. R., Xiao, H., Ashwell, J. D.
(2002). HIV Tat Binds Egr Proteins and Enhances Egr-dependent Transactivation of the Fas Ligand Promoter. J. Biol. Chem.
277: 19482-19487
[Abstract]
[Full Text]
-
Garden, G. A., Budd, S. L., Tsai, E., Hanson, L., Kaul, M., D'Emilia, D. M., Friedlander, R. M., Yuan, J., Masliah, E., Lipton, S. A.
(2002). Caspase Cascades in Human Immunodeficiency Virus-Associated Neurodegeneration. J. Neurosci.
22: 4015-4024
[Abstract]
[Full Text]
-
Lenardo, M. J., Angleman, S. B., Bounkeua, V., Dimas, J., Duvall, M. G., Graubard, M. B., Hornung, F., Selkirk, M. C., Speirs, C. K., Trageser, C., Orenstein, J. O., Bolton, D. L.
(2002). Cytopathic Killing of Peripheral Blood CD4+ T Lymphocytes by Human Immunodeficiency Virus Type 1 Appears Necrotic rather than Apoptotic and Does Not Require env. J. Virol.
76: 5082-5093
[Abstract]
[Full Text]
-
Bolton, D. L., Hahn, B.-I., Park, E. A., Lehnhoff, L. L., Hornung, F., Lenardo, M. J.
(2002). Death of CD4+ T-Cell Lines Caused by Human Immunodeficiency Virus Type 1 Does Not Depend on Caspases or Apoptosis. J. Virol.
76: 5094-5107
[Abstract]
[Full Text]
-
de Oliveira Pinto, L. M., Garcia, S., Lecoeur, H., Rapp, C., Gougeon, M.-L.
(2002). Increased sensitivity of T lymphocytes to tumor necrosis factor receptor 1 (TNFR1)- and TNFR2-mediated apoptosis in HIV infection: relation to expression of Bcl-2 and active caspase-8 and caspase-3. Blood
99: 1666-1675
[Abstract]
[Full Text]
-
Gjoerup, O., Zaveri, D., Roberts, T. M.
(2001). Induction of p53-Independent Apoptosis by Simian Virus 40 Small t Antigen. J. Virol.
75: 9142-9155
[Abstract]
[Full Text]
-
Morita-Fujimura, Y., Fujimura, M., Yoshimoto, T., Chan, P. H.
(2001). Superoxide During Reperfusion Contributes to Caspase-8 Expression and Apoptosis After Transient Focal Stroke. Stroke
32: 2356-2361
[Abstract]
[Full Text]
-
Yoshimura, F. K., Wang, T., Nanua, S.
(2001). Mink Cell Focus-Forming Murine Leukemia Virus Killing of Mink Cells Involves Apoptosis and Superinfection. J. Virol.
75: 6007-6015
[Abstract]
[Full Text]
-
Etemad-Moghadam, B., Rhone, D., Steenbeke, T., Sun, Y., Manola, J., Gelman, R., Fanton, J. W., Racz, P., Tenner-Racz, K., Axthelm, M. K., Letvin, N. L., Sodroski, J.
(2001). Membrane-Fusing Capacity of the Human Immunodeficiency Virus Envelope Proteins Determines the Efficiency of CD4+ T-Cell Depletion in Macaques Infected by a Simian-Human Immunodeficiency Virus. J. Virol.
75: 5646-5655
[Abstract]
[Full Text]
-
Gonzalez, E., Punzon, C., Gonzalez, M., Fresno, M.
(2001). HIV-1 Tat Inhibits IL-2 Gene Transcription Through Qualitative and Quantitative Alterations of the Cooperative Rel/AP1 Complex Bound to the CD28RE/AP1 Composite Element of the IL-2 Promoter. J. Immunol.
166: 4560-4569
[Abstract]
[Full Text]
-
LaBonte, J. A., Patel, T., Hofmann, W., Sodroski, J.
(2000). Importance of Membrane Fusion Mediated by Human Immunodeficiency Virus Envelope Glycoproteins for Lysis of Primary CD4-Positive T Cells. J. Virol.
74: 10690-10698
[Abstract]
[Full Text]
-
Badley, A. D., Pilon, A. A., Landay, A., Lynch, D. H.
(2000). Mechanisms of HIV-associated lymphocyte apoptosis. Blood
96: 2951-2964
[Abstract]
[Full Text]
-
Nishizawa, M., Kamata, M., Katsumata, R., Aida, Y.
(2000). A Carboxy-Terminally Truncated Form of the Human Immunodeficiency Virus Type 1 Vpr Protein Induces Apoptosis via G1 Cell Cycle Arrest. J. Virol.
74: 6058-6067
[Abstract]
[Full Text]
-
Cicala, C., Arthos, J., Rubbert, A., Selig, S., Wildt, K., Cohen, O. J., Fauci, A. S.
(2000). HIV-1 envelope induces activation of caspase-3 and cleavage of focal adhesion kinase in primary human CD4+ T cells. Proc. Natl. Acad. Sci. USA
97: 1178-1183
[Abstract]
[Full Text]
-
Micoli, K. J., Pan, G., Wu, Y., Williams, J. P., Cook, W. J., McDonald, J. M.
(2000). Requirement of Calmodulin Binding by HIV-1 gp160 for Enhanced FAS-mediated Apoptosis. J. Biol. Chem.
275: 1233-1240
[Abstract]
[Full Text]
-
Pauza, C. D., Trivedi, P., Wallace, M., Ruckwardt, T. J., Le Buanec, H., Lu, W., Bizzini, B., Burny, A., Zagury, D., Gallo, R. C.
(2000). Vaccination with Tat toxoid attenuates disease in simian/HIV-challenged macaques. Proc. Natl. Acad. Sci. USA
97: 3515-3519
[Abstract]
[Full Text]