Previous Article | Next Article 
Journal of Virology, March 1999, p. 1846-1852, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
vig-1, a New Fish Gene Induced by the
Rhabdovirus Glycoprotein, Has a Virus-Induced Homologue in Humans
and Shares Conserved Motifs with the MoaA Family
Pierre
Boudinot,
Pascale
Massin,
Mar
Blanco,
Sabine
Riffault, and
Abdenour
Benmansour*
Institut National de la Recherche
Agronomique, Unité de Virologie et Immunologie
Moléculaires, 78352 Jouy-en-Josas cedex, France
Received 2 November 1998/Accepted 7 December 1998
 |
ABSTRACT |
We used mRNA differential display methodology to analyze the shift
of transcription profile induced by the fish rhabdovirus, viral
hemorrhagic septicemia virus (VHSV), in rainbow trout leukocytes. We
identified and characterized a new gene which is directly induced by
VHSV. This VHSV-induced gene (vig-1) encodes a
348-amino-acid protein. vig-1 is highly expressed during
the experimental disease in lymphoid organs of the infected fish.
Intramuscular injection of a plasmid vector expressing the viral
glycoprotein results in vig-1 expression, showing that the
external virus protein is sufficient for the induction.
vig-1 expression is also obtained by a rainbow trout
interferon-like factor, indicating that vig-1 can be
induced through different pathways. Moreover, vig-1 is homologous to a recently described human cytomegalovirus-induced gene.
Accordingly, vig-1 activation may represent a new
virus-induced activation pathway highly conserved in vertebrates. The
deduced amino acid sequence of vig-1 is significantly
related to sequences required for the biosynthesis of metal cofactors.
This suggests that the function of vig-1 may be involved in
the nonspecific virus-induced synthesis of enzymatic cofactors of the
nitric oxide pathway.
 |
INTRODUCTION |
The viral hemorrhagic septicemia
virus (VHSV) is a rhabdovirus responsible for an important viral
disease causing significant losses in European trout farms
(9). Viral hemorrhagic septicemia, first described in 1938, is a systemic disease characterized by marked hemorrhagic lesions and
exophtalmia. The rate of mortality in a juvenile stock can reach 90%.
The nonsegmented RNA genome of the virus encodes six proteins (2,
4, 5, 40). The transmembrane glycoprotein (G) is the only
external protein and is sufficient to induce a protective specific
immune response (6, 26). The protection can be passively
transferred with the serum and is ensured by neutralizing antibodies.
However, nonspecific mediators are involved during the immunization
(6).
The earliest antiviral response of the host is nonspecific. Upon viral
infection, host cells are stimulated to change their transcription
profile (16) and begin to secrete mediators as interferon
and tumor necrosis factor alpha. The best-studied pathway of such cell
activity modulation is the interferon system. Viruses induce interferon
gene expression and then the up-regulation of various downstream
interferon-responsive genes (reviewed in references 32 and 44). Some of these genes,
such as 2-5 A synthetase, RNA-dependent protein kinase, RNase I, and
MxA, have antiviral activity. Nitric oxide (NO) is another important
compound of the nonspecific immune response to viruses. The NO synthase
2 gene is induced by gamma interferon in macrophages (11),
and the antiviral effects of NO have been described in several models (19, 20, 35, 45). Although these mechanisms have been well
studied in mammalian models, the cellular response to viruses is far
from understood.
In the rainbow trout, Oncorhynchus mykiss (Walbaum), the
induction of an interferon-like activity by viruses was first described in the early 1970s (10, 31). However, neither fish
interferon nor cytokines involved in the regulation of the fish immune
response have been unequivocally characterized so far. Among primitive vertebrates, the immune system of the rainbow trout is one of the best
studied. B- and T-cell receptors have been described, and their loci
have been partially characterized (3, 8, 27, 33, 37). Class
I and class II major histocompatibility complex genes (12, 15,
38) and recombinating activation genes and terminal
deoxytransferase have also been isolated (14). Few genes
involved in the nonspecific response have been cloned in fish. Trout Mx
genes (41, 42) and genes of the acute-phase proteins of the
same species (18) constitute the main examples. The rainbow
trout therefore constitutes a good model for the identification and
characterization of new genes of immunological interest. Fundamental signaling pathways involved in innate immune mechanisms are conserved in organisms as distant from each other as Drosophila
melanogaster and mammals (28), and several molecules of
the immune system have been discovered in nonmammalian models. The
Toll/cactus pathway was first described in Drosophila
(29), several new molecules of the immunoglobulin
superfamily were found in insects and mollusks (17, 25, 39),
and the marker for cortical thymocyte of Xenopus was
discovered in Xenopus and then retrieved in the mouse
(7).
Despite increasing knowledge about the trout immune system and detailed
studies about VHSV, the nonspecific host response to this pathogen is
poorly described. The characterization of new key factors and pathways
induced early in rainbow trout in response to viruses or by viral
components is important for a better understanding of virus-host cell
interactions. We used the mRNA differential display methodology (mRNA
DD-PCR) (23) to isolate transcripts induced by VHSV in cells
of the head kidney or pronephros, which is the most important lymphoid
and hematopoietic organ in the rainbow trout. This approach led to the
identification and characterization of a new rainbow trout
virus-induced gene, which seems to belong to a new virus-induced
pathway conserved in vertebrates.
 |
MATERIALS AND METHODS |
Viruses and reagents.
The fish experiments were conducted in
the Jouy-en-Josas fish experimental facilities. Pathogenic isolate
07-71 of VHSV (22) was used. When necessary, VHSV was
inactivated with beta-propiolactone (BPL) at 1/4,000 for 1 h at
room temperature and then overnight at 4°C. Cycloheximide (CHX)
(Sigma) was used at 100 µg/ml. For fish DNA immunizations, we used
the VHSV glycoprotein gene cloned in pcDNA1 (Invitrogen) or the plasmid
alone as a control as described in reference 6. The
fish genetic immunizations were performed as described in reference
6.
In vitro transcription-translation assay.
VIG-1 polypeptide
was produced by in vitro transcription-translation by using the TNT T7
reticulocyte system from Promega; microsomes and endoglycosidase H were
purchased from Boehringer. In vitro transcription-translation assays in
the presence of 35S-labelled methionine and endoglycosidase
digestion (2 µU per reaction) were performed according to the
manufacturer's protocols.
mRNA DD-PCR.
For mRNA DD-PCR analysis, 5.107 to
108 head kidney cells from a single trout were incubated
with VHSV (1 PFU per cell) or BPL-inactivated VHSV or without virus and
cultured for 40 h at 14°C in RPMI medium containing 2% fetal
calf serum. Total RNA was extracted with Trizol reagent (Life
Technologies) and treated with RNase-free DNase I (Boehringer).
First-strand cDNAs were synthesized by using an anchored
deoxyribosylthymine, (dT) primer, and then PCR amplified with the same
oligo(dT) primer combined with 10-mer random oligonucleotides (23). After separation on sequencing gel, differentially
displayed bands were excised and reamplified under the same conditions, and the products were cloned into the pCR-Script plasmid (Stratagene).
Semiquantitative reverse transcriptase (RT)-PCR.
Semiquantitative RT-PCR assays were performed as described in reference
13. Briefly, PCR conditions were 94°C for 8 min and then 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min, for 25 to 30 cycles. PCRs for quantitation purposes were stopped in the
exponential phase of amplification, and tests were performed on serial
dilutions of templates. The total amount of cDNA was calibrated on the
basis of the amplification of actin cDNA. Actin and Mx primers are
defined in reference 6. vig-1 primers
were CAGTTCAGTGGCTTTGACGA and ACAAACGCCTCAAGGTATGG
(amplified product, 232 bp).
Northern blot analysis.
Total RNAs (20 µg) were
fractionated in 1.2% agarose gel, 10% morpholinepropanesulfonic acid
(MOPS) and 10% formaldehyde and blotted onto Hybond N-plus membranes
(Amersham). The blots were probed with a random hexanucleotide-primed
32P-labelled cDNA made from a vig-1 clone (1.5 kb). The blots were rehybridized with a beta-actin probe to control the
amounts of mRNAs loaded on the gels.
Nucleotide sequence accession number.
The sequence of
vig-1 has been deposited in the GenBank database under
accession no. AF076620.
 |
RESULTS |
Identification of vig-1, a cDNA differentially
expressed following VHSV induction.
In order to characterize new
fish genes expressed in response to viral infection or induction, we
used mRNA DD-PCR methodology because it allows comparative analysis of
the whole set of transcribed genes in cells subjected to different
treatments (24). We used cells from the head kidney, as the
pronephros is the main lymphoid organ in fish. To avoid the effects of
different genetic backgrounds, we performed differential display
analysis on leukocytes from a single trout. Head kidney cells were
separated on a Ficoll gradient, divided into three aliquots, and then
incubated for 40 h at 14°C with live or BPL-inactivated VHSV
(BPL-VHSV) or with medium alone as a control. A cDNA was synthesized
with an anchored dT primer and then PCR amplified with a set of 12 arbitrary primers in the presence of [32P]dCTP. Among the
12 primer combinations used for the differential display, a pair of
primers (5'-CTTGATTGCC-3' and 5'-TTTTTTTTTTCG-3') led to the amplification of one discrete band of 650 bp from
samples treated with live or inactivated VHSV but not from the control. The DNA product within this band was reamplified, cloned, and sequenced. To confirm the viral induction of the transcript, we performed a semiquantitative RT-PCR assay (13) with RNA
extracted from virus-treated and untreated rainbow trout head kidney
cells, using a set of primers derived from the sequence of the insert. Figure 1A shows that a specific
amplification was obtained only with samples derived from VHSV-treated
cells. Northern blot analysis was finally performed to authenticate the
viral induction. A signal was observed only with RNA samples from
VHSV-treated cells (Fig. 1B). In both tests, rainbow trout actin was
used as a control of the amount of RNA. The size of the VHSV-induced
transcript was estimated at 1.5 kb by comparison with RNA size markers.
These results clearly establish that this transcript was induced by live or inactivated VHSV. The corresponding gene was therefore named
vig-1 for VHSV-induced gene no. 1.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
VHSV-induced expression of vig-1. (A)
Semiquantitative PCR assay on cDNA from rainbow trout head kidney cells
cultured as described with VHSV (VHSV), with BPL-inactivated virus
(BPL-VHSV) or without virus (Control). The samples were normalized on
the basis of actin expression. (B) Northern blot analysis of
vig-1 expression in rainbow trout head kidney cells treated
as described in panel A. The same blots were hybridized with an actin
probe as a control for the total amounts of RNA loaded in the gels.
|
|
Characterization of vig-1.
In order to clone the
full-length cDNA of vig-1, we first looked for the presence
of the transcript in different tissues. We analyzed vig-1
expression by a sensitive RT-PCR assay, using internal specific primers
in the fibroblast-like cell line rainbow trout gonad-2 (RTG-2) and in
different trout tissues. vig-1 was not expressed in RTG-2
cells and was not amplified from a cDNA library made from this cell
line. It was weakly expressed in unstimulated spleen and head kidney
but not in the muscle, suggesting lymphoid or myeloid expression (data
not shown). Subsequently, vig-1 was detected in a cDNA
library made from the spleen of a naive rainbow trout. This library was
therefore screened to retrieve the vig-1 cDNA. All analyzed
clones had an insert of 1.5 kb in accordance with the size of the mRNA
assessed by Northern blot analysis and suggesting that they correspond
to full-length cDNAs. Three clones were fully sequenced,
leading to a 1,535-bp cDNA sequence. The sequence starts 60 nucleotides
(nt) upstream from the first ATG codon, and contains a 1,044-bp open
reading frame (ORF) encoding 348-amino-acid residues (Fig.
2). An AATAAA poly(A)
consensus signal is present 445 nt downstream of the termination codon
and 32 nt upstream of the poly(A) stretch. Sequence analysis of the polypeptide deduced from the vig-1 sequence shows the
presence of a short hydrophobic N-terminal region at positions 6 to 11 which could constitute a signal peptide (Fig.
3A). However, VIG-1 is probably not a
type I transmembrane protein, since no other hydrophobic region was
observed. The presence of four putative N-glycosylation sites (at
positions 108, 144, 175, and 223) may suggest that VIG-1 is a secreted
glycoprotein. To determine if the protein can enter the rough
endoplasmic reticulum-Golgi pathway, we performed in vitro-coupled
transcription-translation of vig-1 in the presence of
microsomes. The in vitro translation assay produced a 39-kDa protein
product, consistent with the predicted amino acid sequence from the
cDNA (Fig. 3B, lane 2). When the microsomes were added to the extracts,
we could not detect any shift of the VIG-1 protein, while two bands
were detected for the glycoprotein of VHSV under the same conditions
(Fig. 3B, lane 7). Endoglycosidase H treatment showed that a part of
VHSV glycoprotein was indeed glycosylated in the presence of
microsomes. Thus, these results suggest that the short hydrophobic
stretch at the N-terminal end of VIG-1 does not allow the protein to
enter the rough endoplasmic reticulum-Golgi pathway. Thus, VIG-1 is
probably a cytoplasmic protein.

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 2.
Sequence of vig-1 cDNA. Rainbow trout
vig-1 cDNA nucleotidic and deduced amino acid sequences. The
initiation codon, the termination codon, and the polyadenylation signal
are in bold. Potential glycosylation sites are indicated by a
bold-faced N*.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
VIG-1 has no signal peptide. (A) The VIG-1
Kyte-Doolittle hydropathic profile shows a hydrophobic stretch at the N
terminus of the protein (amino acids 6 to 23, arrow). (B) In vitro
transcription-translation and microsome assays were performed with a
plasmid containing vig-1 cDNA. The same experiments were
performed with a plasmid containing gVHSV cDNA in order to control the
efficiency of microsome assay. When the extract was supplemented with
dog pancreatic microsomes, a mobility shift was detected for gVHSV but
not for VIG-1 (lanes 3 and 7). This shift can be abolished by
endoglycosidase H treatment (lane 8), which has no effect on the VIG-1
product (lane 4).
|
|
vig-1 is induced during VHSV infection.
To
determine if vig-1 is induced in vivo during the VHSV
infection, we experimentally infected juvenile rainbow trouts with laboratory strain 07-71 of VHSV. vig-1 induction was then
searched for in infected trout tissues by a RT-PCR assay.
vig-1 mRNA was strongly expressed in the head kidney on day
6 after infection, before the onset of clinical signs of the disease
but after the virus had fully replicated and accumulated in this
lymphoid organ (Fig. 4). On the contrary,
vig-1 was not detected at day 1 postinoculation, indicating
that vig-1 induction was most probably dependent on direct
viral induction of head kidney cells. Weak vig-1 expression was observed in the muscle tissue at the site of virus injection (data
not shown) and could have resulted from direct induction of a few
infiltrating cells.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 4.
vig-1 induction during the experimental
disease. vig-1 mRNA expression was assessed by RT-PCR in the
head kidney during the course of VHSV infection. vig-1
transcripts were searched for 24 h (lanes 3 and 4) or 6 days
(lanes 7 and 8) after trout were infected with VHSV. Trout injected
with phosphate-buffered saline were used as controls at 24 h
(lanes 1 and 2) or at 6 days (lanes 5 and 6). Total amounts of cDNA
were controlled by the amplification of actin mRNA from the same
samples.
|
|
The VHSV glycoprotein is sufficient to induce vig-1 in
vivo.
The accumulation of vig-1 mRNA was observed after
incubation of head kidney cells with BPL-inactivated VHSV, indicating
that neither virus replication nor viral protein synthesis is necessary for vig-1 induction. VHSV has a unique transmembrane
glycoprotein (G protein), which is the protein most likely to interact
with host cells. In order to determine whether the G protein alone is
able to induce vig-1, we used DNA immunization of fish with a plasmid encoding for the VHSV glycoprotein (pcDNA1_GVHSV). We have previously shown that intramuscular immunization of trout with
pcDNA1_GVHSV led to the expression of the protein at the site of
injection and to the elicitation of a strong protective immunity (6). By using a RT-PCR assay, we analyzed
vig-1 expression after pcDNA1_GVHSV or pcDNA1 injection.
vig-1 was induced both in muscle tissue at the site of
plasmid injection and in the head kidney on day 7 after immunization
with pcDNA1_GVHSV (Fig. 5, lanes 3 and 4 and 7 and 8). Conversely, fish injected with the control pcDNA1
plasmid did not express vig-1 (Fig. 5, lanes 1 and 2 and 5 and 6). The expression of actin mRNA was assessed in all samples in
order to check for the presence of similar amounts of RNA. The VHSV
glycoprotein expressed by transfected cells in the muscle tissue is
probably sufficient to induce the in vivo expression of
vig-1.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
vig-1 induction after genetic immunization
against the glycoprotein of the VHSV. vig-1 mRNAs were
detected in the muscle at the site of injection (lanes 3 and 4) and in
the head kidney (lanes 7 and 8) by RT-PCR, 7 days after genetic
immunization with pCDNA1_GVHSV. Trout injected with pCDNA1 were used as
controls (lanes 1 and 2 for muscle and 5 and 6 for head kidney). Total
amounts of mRNA were controlled by the amplification of actin mRNA from
the same samples.
|
|
vig-1 is induced through different pathways.
vig-1 induction could be directly mediated by VHSV or
through a secondary cellular mediator. An indication that the
expression of vig-1 may be independent of the interferon
pathway was obtained from experiments with the fibroblast-like cell
line RTG-2. vig-1 was not inducible in these cells, although
they produced an interferon-like activity and expressed Mx
mRNAs following treatment with live or inactivated VHSV (Fig. 7A).
Thus, the activation of the interferon-like pathway alone is not
sufficient to induce the expression of vig-1 in RTG-2 cells.
To test the hypothesis of direct induction, we analyzed the kinetics of
vig-1 expression in virus-stimulated rainbow trout
head
kidney cells. As a time scale for secondary induction, we
used the
Mx gene, which is interferon responsive in mammals. Figure
6A shows that
vig-1 was
expressed as early as 6 h after in vitro
infection of head kidney
cells with VHSV at 20°C, while Mx transcripts
were not detected
before 10 h. To further ascertain that
vig-1 is
directly induced by VHSV, we infected head kidney cells in
the presence
of CHX, a potent inhibitor of protein synthesis.
CHX did not prevent
the accumulation of
vig-1 transcripts (Fig.
6B). Thus, no
new protein synthesis is necessary for
vig-1 induction
by
VHSV. These observations are consistent with the direct induction
of
vig-1.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
The induction of vig-1 is directly mediated
by viral particles. (A) Kinetics of vig-1 induction in
rainbow trout head kidney cells cultured in the presence of VHSV (V) or
without virus (C) at 20°C. vig-1 and Mx mRNAs
were searched for by a RT-PCR assay at 6, 8, 10, and 24 h. Samples
were normalized on the basis of the actin expression. (B) Effect of CHX
on vig-1 mRNA induction. vig-1 mRNAs were
detected by RT-PCR assay from cells cultured 7 h with VHSV, with
or without CHX. Cells cultured without virus in the presence or absence
of CHX were used as controls, and samples were normalized on the basis
of actin expression.
|
|
The fact that
vig-1 is directly induced by the viral G
protein does not exclude a role for soluble factors in the control
of
vig-1 expression. To clarify the possible role of soluble
factors,
we treated head kidney cells with the supernatant from fish
cells
conditioned to produce an interferon-like activity. The
supernatant
from RTG-2 cells treated with vesicular stomatitis virus
was extensively
centrifuged to eliminate viral particles, subjected to
acid treatment
at a pH of 2.2, and titrated for its antiviral activity.
This
conditioned supernatant was used to stimulate rainbow trout head
kidney cells. Figure
7B shows that both
vig-1 and
Mx mRNAs were
strongly induced in the
leukocytes that were treated with it.
Under semiquantitative RT-PCR
conditions, a dose effect was observed
at high dilutions (lanes 3 to
5), while neither
vig-1 nor
Mx transcripts
were
detected in RNAs from the cells incubated with the nonconditioned
medium (lane 6).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
Induction of vig-1 in response to interferon.
Actin, Mx, and vig-1 mRNAs were
assessed by a RT-PCR assay in different experiments. (A) RTG-2 cells
incubated with live VHSV (V) or BPL-inactivated virus (iV) or without
virus (C). (B) Head kidney cells were stimulated by serial dilutions of
conditioned medium displaying a trout interferon-like activity (lanes:
1, 1/2; 2, 1/10; 3, 1/100; 4, 1/1,000; 5, 1/10,000). Cells cultured
with unconditioned medium were processed similarly as a control (lane
6). (C) Head kidney cells cultured with live IPNV (IPNV) or inactivated
IPNV (In-IPNV) or without virus (Control).
|
|
Together, these observations suggest that two pathways are available
for
vig-1 induction. The first pathway is directly mediated
by the viral particles and most probably by the G protein, and
the
second is correlated with the presence of an interferon-like
activity
and probably requires virus replication. To confirm the
latter
possibility, we tested the effects of a virus devoid of
a transmembrane
glycoprotein, using a nonenveloped fish birnavirus,
infectious
pancreatic necrosis virus (IPNV). Figure
7C shows that
vig-1
is induced in head kidney cells by live IPNV but not by
the inactivated
virus, confirming that viral replication results
in
vig-1 expression.
vig-1 is a member of a group of virus-induced genes
conserved in vertebrates and related to sequences involved in the
biosynthesis of enzymatic cofactors.
Sequence homology searches
with the entire vig-1 sequence through dbEST database
indicated that vig-1 is homologous to four human EST
sequences and one mouse EST sequence, showing that genes similar to
vig-1 are expressed in mammals. EST sequences AA054298 and
AA036920 are from human pregnant uterus, AA360817 is from a human
T-cell lymphoma, AA542387 is from a mouse T-cell clone, and AA263079 is
from the acute human myelogenous leukemia KG1-a. The 3' end of the ORF
in the mouse EST sequence AA542387 has 72% similarity with the
vig-1 ORF over 236 bp. Moreover, a cytomegalovirus-induced
human gene (cig-5) described in a recent study is similar to
vig-1 (46). Although the reported partial sequence of the human transcript is longer than vig-1 mRNA
(3.1 versus 1.5 kb), the C termini of the deduced amino acid sequences of vig-1 and cig-5 are highly homologous (80%
identity over 291 amino acids) as shown in Fig.
8A. These similarities suggest that vig-1 is probably a member of a group of virus-induced
genes.

View larger version (82K):
[in this window]
[in a new window]
|
FIG. 8.
Multiple alignments of the predicted amino acid sequence
of VIG-1 with related proteins. (A) VIG-1 is aligned with the sequence
deduced from human cig-5 gene (accession no. AF026941). (B)
The following proteins are aligned with VIG-1 and CIG-5: MoaA proteins
from human (MOCS1a, accession no. AF034374), Arabidopsis
thaliana (cnx2, accession no. Z48047), Aspergillus
nidulans (cnxABC, accession no. AF027213), and Escherichia
coli (MoaA, accession no. AE000181), NIRJ proteins from
Pseudomonas aeruginosa (NIRJps, accession no. D84475) and
Archaeoglobus fulgidus (NIRJ1ar, accession no. AE001026),
and coenzyme pyrrolo-quinoline-quinone biosynthesis protein III from
Acinetobacter calcoaceticus (PQQIII, accession no. X06452).
Grey shaded boxes represent conserved motifs, and conserved residues
are indicated by an asterisk. The three cysteines in the first box (I)
constitute a potential iron-sulfur metal binding site.
|
|
Given the remarkable conservation of
vig-1 during vertebrate
evolution, we searched for related sequences in other organisms.
We
found proteins showing highly significant homology with VIG-1
belonging
to three families, MoaA, NIRJ, and PQQIII. MoaA proteins,
described in
bacteria, plants, fungi, and vertebrates, are involved
in the synthesis
of molybdopterin cofactors. NIRJ is necessary
for the synthesis of heme
d1, a cofactor of bacterial nitrite
reductase, and PQQIII is required
for the synthesis of the bacterial
cofactor pyrrolo-quinoline-quinone.
Four motifs are conserved
in VIG-1, CIG-5, MoaA, NIRJ, and PQQIII (Fig.
8B), and the pattern
CNXXCXXC (motif I, at positions 69 to 76 in VIG-1)
corresponds
to the so-called MoaA/PQQIII signature (prosite entry,
PDO01009).
The cysteines were shown to be important to the biological
function
of the MoaA protein, most probably for the coordination of an
Fe-S cluster (
30).
 |
DISCUSSION |
In this work we describe the identification and characterization
of a rainbow trout gene which is induced in vitro and in vivo during
infection with the fish rhabdovirus VHSV. The gene was named
vig-1 for VHSV-induced gene number 1.
vig-1 was identified in VHSV-induced rainbow trout
leukocytes fractionated from the head kidney. It is expressed at a low level in the spleen and the head kidney, the main hematopoietic organs
in trout. vig-1 is not expressed in the muscle or in the fibroblast-like trout cell line RTG-2. Moreover, vig-1 cDNA
was retrieved from a spleen cDNA library, but it was absent in a cDNA library made from RTG-2 cells. vig-1 therefore seems to be
specifically expressed in lymphomyeloid cells. Further characterization
of the tissular distribution awaits specific markers of fish immune cells and appropriate fish cell lines.
Since we observed the induction of vig-1 with inactivated
VHSV, the question of which viral component is involved was raised. Our
conviction that the G protein can induce vig-1 is based on several arguments. First, the G protein is the only external protein of
the virus, and second, DNA immunization by a plasmid bearing the gene
of G protein induces vig-1. We cannot exclude the
possibility that specific DNA sequences in the G gene induce local
inflammation and vig-1 expression. However, this possibility
is unlikely, since the plasmid DNA alone had no effect. Moreover,
inactivated IPNV, a nonenveloped birnavirus devoid of external
glycoprotein, does not induce vig-1.
Induction of vig-1 appears to occur through two different
pathways; it can be obtained directly through a viral component or
indirectly through a soluble factor, probably the fish interferon. The
direct pathway probably involves the G protein, since we have shown
that it is the most likely viral vig-1 inducer. The indirect vig-1 induction pathway may also involve the G protein,
since viral glycoproteins are well known to induce the expression of cellular factors, including alpha interferon (1, 21). Since we have shown that a fish interferon-like product induces
vig-1, all known interferon inducers, nucleic acids, viral
glycoproteins, and cytokines should normally induce vig-1,
as observed following infection with live IPNV. The use of several
pathways for the induction of vig-1 supports an important
role for the host response to viral infections.
vig-1 is highly homologous to murine and human EST
sequences, indicating that it corresponds to a sequence conserved
during the evolution of fish and mammals. Furthermore, using a similar approach with human cells, Zhu et al. (46) identified a
cytomegalovirus-induced gene (cig-5) which has important
characteristics in common with vig-1 (46),
showing the potential importance of these genes. Besides the high
similarity of the deduced amino acid sequences, cig-5 is
induced directly by the inactivated virus and indirectly through
interferon alpha (46). The conservation of the gene and its
activation pathway suggests that vig-1 and cig-5
may correspond to important components of the nonspecific antiviral response.
In addition, we found that the VIG-1 amino acid sequence is
significantly homologous to proteins required for the synthesis of
molybdopterin (MoaA family), heme d1 (NIRJ), PQQ (PQQIII), and
enzymatic cofactors. The iron-sulfur motif CNXXCXXC was strictly conserved in all these sequences during the evolution of prokaryotes and eukaryotes. MoaA proteins are required for the synthesis of an
early precursor of the pterin compounds involved in the biosynthesis of
molybdopterin cofactors (34, 36). Interestingly, the
inducible NO synthase, which is involved in antiviral defense, binds a
tetrahydrobiopterin cofactor. Furthermore, this cofactor regulates the
balance of NO versus superoxide production by NO synthase
(43). Conservation of the MoaA signature in VIG-1 could
therefore indicate that this virus-induced protein may be required for
the synthesis of an enzymatic cofactor modulating the efficiency of NO
synthesis in vertebrates. Obviously, further studies are necessary to
assess the precise significance of these homologies and to resolve the question of the VIG-1 protein function. However, the connection between
nitrogen metabolism and resistance to pathogens is the most evident
link between the intrinsic characteristics of VIG-1 and its
virus-induced expression.
 |
ACKNOWLEDGMENTS |
This work was financially supported by the Institut National de
la Recherche Agronomique, France. M. Blanco received a postdoctoral fellowship from the Ministerio de Educacion y Cultura, Spain.
The excellent technical assistance of Anne-Françoise Monnier,
Lucina Abinne-Molza, and Alexandra Leroux is gratefully acknowledged. We thank J. Charlemagne for providing the trout spleen cDNA
library, C. Tuffereau for the pCDNA1-RV plasmid construct, and R. L'Haridon for the conditioned medium with trout interferon-like
activity. We gratefully acknowledge C. Secombes, J. F. Gibrat, A. Six, and S. Salhi for discussions and helpful comments.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
National de la Recherche Agronomique, Unité de Virologie et
Immunologie Moléculaires, 78352 Jouy-en-Josas cedex, France.
Phone: 33 1 34 65 25 85. Fax: 33 1 34 65 25 91. E-mail:
abdenour{at}biotec.jouy.inra.fr.
 |
REFERENCES |
| 1.
|
Ankel, H.,
M. R. Capobianchi,
C. Castilletti, and F. Dianzani.
1994.
Interferon induction by HIV glycoprotein 120: role of the V3 loop.
Virology
205:34-43[Medline].
|
| 2.
|
Basurco, B., and A. Benmansour.
1995.
Distant strains of the fish rhabdovirus VHSV maintain a sixth functional cistron which codes for a nonstructural protein of unknown function.
Virology
212:741-745[Medline].
|
| 3.
|
Bengten, E.,
S. Stromberg, and L. Pilstrom.
1994.
Immunoglobulin VH regions in Atlantic cod (Gadus morhua L.): their diversity and relationship to VH families from other species.
Dev. Comp. Immunol.
18:109-122[Medline].
|
| 4.
|
Benmansour, A.,
G. Paubert,
J. Bernard, and P. de Kinkelin.
1994.
The polymerase-associated protein (M1) and the matrix protein (M2) from a virulent and an avirulent strain of viral hemorrhagic septicemia virus (VHSV), a fish rhabdovirus.
Virology
198:602-612[Medline].
|
| 5.
|
Bernard, J.,
X. F. Lecocq,
M. Rossius,
M. E. Thiry, and P. de Kinkelin.
1990.
Cloning and sequencing the messenger RNA of the N gene of viral haemorrhagic septicaemia virus.
J. Gen. Virol.
71:1669-1674[Abstract/Free Full Text].
|
| 6.
|
Boudinot, P.,
M. Blanco,
P. de Kinkelin, and A. Benmansour.
1998.
Combined DNA immunization with the glycoprotein gene of the Viral Hemorrhagic Septicemia Virus and Infectious Hematopoietic Necrosis Virus induces a double-specific protective immunity and a nonspecific response in rainbow trout.
Virology
249:297-306[Medline].
|
| 7.
|
Chretien, I.,
J. Robert,
A. Marcuz,
S. J. Garcia,
M. Courtet, and P. L. Du.
1996.
CTX, a novel molecule specifically expressed on the surface of cortical thymocytes in Xenopus.
Eur. J. Immunol.
26:780-791[Medline].
|
| 8.
|
de Guerra, A., and J. Charlemagne.
1997.
Genomic organization of the TcR beta-chain diversity (Dbeta) and joining (Jbeta) segments in the rainbow trout: presence of many repeated sequences.
Mol. Immunol.
34:653-662[Medline].
|
| 9.
|
de Kinkelin, P.,
S. Chilmonczyk,
M. Dorson,
M. Le Berre, and A. M. Baudouy.
1979.
Some pathogenic facets of rhabdoviral infection of salmonid fish. Munich symposia of microbiologia: mechanisms of pathogenesis and virulence, p. 357-375.
WHO Center, Munich, Germany.
|
| 10.
|
de Kinkelin, P., and M. Dorson.
1973.
Interferon production in rainbow trout (Salmo gairdneri) experimentally infected with Egtved virus.
J. Gen. Virol.
19:125-127[Abstract/Free Full Text].
|
| 11.
|
Ding, A. H.,
C. F. Nathan, and D. J. Stuehr.
1988.
Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidence for independent production.
J. Immunol.
141:2407-2412[Abstract].
|
| 12.
|
Glamann, J.
1995.
Complete coding sequence of rainbow trout MHC II beta chain.
Scand. J. Immunol.
41:365-372[Medline].
|
| 13.
|
Graf, L., and B. Torok-Storb.
1995.
Identification of a novel DNA sequence differentially expressed between normal human CD34+CD38hi and CD34+CD38lo marrow cells.
Blood
86:548-556[Abstract/Free Full Text].
|
| 14.
|
Hansen, J. D., and S. L. Kaattari.
1996.
The recombination activating gene 2 (RAG2) of the rainbow trout Oncorhynchus mykiss.
Immunogenetics
44:203-211[Medline].
|
| 15.
|
Hansen, J. D.,
P. Strassburger, and L. du Pasquier.
1996.
Conservation of an alpha 2 domain within the teleostean world, MHC class I from the rainbow trout Oncorhynchus mykiss.
Dev. Comp. Immunol.
20:417-425[Medline].
|
| 16.
|
Hardwick, J. M., and D. E. Griffin.
1996.
Viral effects on cellular functions, p. 55-83.
In
N. Nathanson (ed.), Viral pathogenesis. Lippincott-Raven, Philadelphia, Pa.
|
| 17.
|
Hoek, R. M.,
A. B. Smit,
H. Frigs,
J. M. Vink,
M. de Jonk-Brink, and W. P. Geraerts.
1996.
A new Ig-superfamily member, molluscan defence molecule (MDM) from Lymnaea stagnalis, is down regulated during parasitosis.
Eur. J. Immunol.
26:939-944[Medline].
|
| 18.
|
Jensen, L. E.,
M. P. Hiney,
D. C. Shields,
C. M. Uhlar,
A. J. Lindsay, and A. S. Whitehead.
1997.
Acute phase proteins in salmonids: evolutionary analyses and acute phase response.
J. Immunol.
158:384-392[Abstract].
|
| 19.
|
Karupiah, G.,
Q. W. Xie,
R. M. Buller,
C. Nathan,
C. Duarte, and J. D. MacMicking.
1993.
Inhibition of viral replication by interferon-gamma-induced nitric oxide synthase.
Science
261:1445-1448[Abstract/Free Full Text].
|
| 20.
|
Komatsu, T.,
Z. Bi, and C. S. Reiss.
1996.
Interferon- induced type 1 nitric oxid synthase activity inhibits viral replication in neurons.
J. Neuroimmunol.
68:101-108[Medline].
|
| 21.
|
Laude, H.,
J. Gelfi,
L. Lavenant, and B. Charley.
1992.
Single amino acid changes in the viral glycoprotein M affect induction of alpha interferon by the coronavirus transmissible gastroenteritis virus.
J. Virol.
66:743-749[Abstract/Free Full Text].
|
| 22.
|
Le Berre, M.,
P. de Kinkelin, and A. Metzger.
1977.
Identification serologique des Rhabdovirus des salmonides.
Bull. Off. Int. Epizoot.
87:391-393.
|
| 23.
|
Liang, P., and A. B. Pardee.
1992.
Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction.
Science
257:967-971[Abstract/Free Full Text].
|
| 24.
|
Liang, P., and A. B. Pardee.
1995.
Recent advances in differential display.
Curr. Biol.
7:274-280.
|
| 25.
|
Lindstrom-Dinnetz, I.,
S. C. Sun, and I. Faye.
1995.
Structure and function of hemolin, an insect member of the immunoglobulin gene superfamily.
Eur. J. Biochem.
26:939-944.
|
| 26.
|
Lorenzen, N.,
N. J. Olesen,
P. E. Jorgensen,
M. Etzerodt,
T. L. Holtet, and H. C. Thogersen.
1993.
Molecular cloning and expression in Escherichia coli of the glycoprotein gene of VHS virus, and immunization of rainbow trout with the recombinant protein.
J. Gen. Virol.
74:623-630[Abstract/Free Full Text].
|
| 27.
|
Matsunaga, T., and E. Andersson.
1997.
Analysis of VH gene diversity in rainbow trout (Oncorhynchus mykiss): both nonsynonymous and synonymous nucleotide changes are more frequent in CDRs than in FRs.
Immunogenetics
45:201-208[Medline].
|
| 28.
|
Medzhitov, R., and C. Janeway.
1998.
An ancient system of host defense.
Curr. Opin. Immunol.
10:12-15[Medline].
|
| 29.
|
Medzhitov, R., and C. Janeway.
1997.
A human homologue of the drosophila Toll protein signal activation of adaptative immunity.
Nature
388:394-397[Medline].
|
| 30.
|
Menendez, C.,
D. Siebert, and R. Brandsch.
1996.
MoaA of Arthrobacter nicotinivorans pAO1 involved in Mo-pterin cofactor synthesis is an Fe-S protein.
FEBS Lett.
391:101-103[Medline].
|
| 31.
|
Oie, H. K., and P. C. Loh.
1971.
Reovirus type 2: induction of viral resistance and interferon production in Fathead Minnow cells.
Proc. Soc. Exp. Biol. Med.
136:369-373[Medline].
|
| 32.
|
O'Shea, J. J.
1997.
Jaks, STATs, cytokine signals and immunoregulation: are we there yet?
Immunity
7:1-11[Medline].
|
| 33.
|
Partula, S.,
A. de Guerra,
J. S. Fellah, and J. Charlemagne.
1995.
Structure and diversity of the T cell antigen receptor beta-chain in a teleost fish.
J. Immunol.
155:699-706[Abstract].
|
| 34.
|
Rajagopalan, K. V., and J. L. Johnson.
1992.
The pterin molybdenum cofactors.
J. Biol. Chem.
267:10199-10202[Free Full Text].
|
| 35.
|
Reiss, C. S., and T. Komatsu.
1998.
Does nitric oxid play a critical role in viral infections?
J. Virol.
72:4547-4551[Free Full Text].
|
| 36.
|
Rivers, S. L.,
E. McNairn,
F. Blasco,
G. Giordano, and D. H. Boxer.
1993.
Molecular genetic analysis of the moa operon of Escherichia coli K12 required for the molybdenum cofactor biosynthesis.
Mol. Microbiol.
8:1071-1081[Medline].
|
| 37.
|
Roman, T., and J. Charlemagne.
1994.
The immunoglobulin repertoire of the rainbow trout (Oncorhynchus mykiss): definition of nine Igh-V families.
Immunogenetics
40:210-216[Medline].
|
| 38.
|
Shum, B. P.,
K. Azumi,
S. Zhang,
S. R. Kehrer,
R. L. Raison,
H. W. Detrich, and P. Parham.
1996.
Unexpected beta2-microglobulin sequence diversity in individual rainbow trout.
Proc. Natl. Acad. Sci. USA
93:2779-2784[Abstract/Free Full Text].
|
| 39.
|
Takahashi, T.,
T. Iwase,
N. Takenouchi,
M. Saito,
K. Kobayashi,
Z. Moldoveanu,
J. Mestecky, and I. Moro.
1996.
The joining J chain is present in invertebrates that do not express immunoglobulins.
Proc. Natl. Acad. Sci. USA
93:1886-1891[Abstract/Free Full Text].
|
| 40.
|
Thiry, M.,
X. F. Lecoq,
I. Dheur,
A. Renard, and P. De Kinkelin.
1991.
Sequence of a cDNA carrying the glycoprotein gene and part of the matrix protein M2 gene of viral haemorrhagic scepticaemia virus, a fish rhabdovirus.
Biochim. Biophys. Acta
1090:345-347[Medline].
|
| 41.
|
Trobridge, G. D.,
P. P. Chiou, and J. A. Leong.
1997.
Cloning of the rainbow trout (Oncorhynchus mykiss) Mx2 and Mx3 cDNAs and characterization of trout Mx protein expression in salmon cells.
J. Virol.
71:5304-5311[Abstract].
|
| 42.
|
Trobridge, G. D., and J. A. Leong.
1995.
Characterization of a rainbow trout Mx gene.
J. Interferon Cytokine Res.
15:691-702[Medline].
|
| 43.
|
Vasquez-Vivar, J.,
B. Kalyanaraman,
P. Martazek,
N. Hogg,
B. S. S. Masters,
H. Karoui,
P. Tordo, and K. P. Pritchard.
1998.
Superoxide generation by endothelial nitric oxid synthase: the influence of cofactors.
Proc. Natl. Acad. Sci. USA
95:9220-9225[Abstract/Free Full Text].
|
| 44.
|
Welsh, R. M., and G. C. Sen.
1997.
Nonspecific host responses to viral infections, p. 109-141.
In
N. Nathanson (ed.), Viral pathogenesis. Lippincott-Raven, Philadelphia, Pa.
|
| 45.
|
Zaragoza, C.,
C. J. Ocampo,
M. Saura,
M. Leppo,
X. Q. Wei,
R. Quick,
S. Moncada,
F. Y. Liew, and C. J. Lowenstein.
1998.
The role of nitric oxide synthase in the host response to coxsackievirus myocarditis.
Proc. Natl. Acad. Sci. USA
95:2469-2474[Abstract/Free Full Text].
|
| 46.
|
Zhu, H.,
J. P. Cong, and T. Shenk.
1997.
Use of differential display analysis to assess the effect of human cytomegalovirus infection on the accumulation of cellular RNAs: induction of interferon-responsive RNAs.
Proc. Natl. Acad. Sci. USA
94:13985-13990[Abstract/Free Full Text].
|
Journal of Virology, March 1999, p. 1846-1852, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Biacchesi, S., LeBerre, M., Lamoureux, A., Louise, Y., Lauret, E., Boudinot, P., Bremont, M.
(2009). Mitochondrial Antiviral Signaling Protein Plays a Major Role in Induction of the Fish Innate Immune Response against RNA and DNA Viruses. J. Virol.
83: 7815-7827
[Abstract]
[Full Text]
-
Chan, Y.-L., Chang, T.-H., Liao, C.-L., Lin, Y.-L.
(2008). The Cellular Antiviral Protein Viperin Is Attenuated by Proteasome-Mediated Protein Degradation in Japanese Encephalitis Virus-Infected Cells. J. Virol.
82: 10455-10464
[Abstract]
[Full Text]
-
Jiang, D., Guo, H., Xu, C., Chang, J., Gu, B., Wang, L., Block, T. M., Guo, J.-T.
(2008). Identification of Three Interferon-Inducible Cellular Enzymes That Inhibit the Replication of Hepatitis C Virus. J. Virol.
82: 1665-1678
[Abstract]
[Full Text]
-
Levraud, J.-P., Boudinot, P., Colin, I., Benmansour, A., Peyrieras, N., Herbomel, P., Lutfalla, G.
(2007). Identification of the Zebrafish IFN Receptor: Implications for the Origin of the Vertebrate IFN System. J. Immunol.
178: 4385-4394
[Abstract]
[Full Text]
-
Olofsson, P.S., Jatta, K., Wagsater, D., Gredmark, S., Hedin, U., Paulsson-Berne, G., Soderberg-Naucler, C., Hansson, G.K., Sirsjo, A.
(2005). The Antiviral Cytomegalovirus Inducible Gene 5/Viperin Is Expressed in Atherosclerosis and Regulated by Proinflammatory Agents. Arterioscler. Thromb. Vasc. Bio.
25: e113-e116
[Abstract]
[Full Text]
-
Jorgensen, J. B., Johansen, L.-H., Steiro, K., Johansen, A.
(2003). CpG DNA Induces Protective Antiviral Immune Responses in Atlantic Salmon (Salmo salar L.). J. Virol.
77: 11471-11479
[Abstract]
[Full Text]
-
O'Farrell, C., Vaghefi, N., Cantonnet, M., Buteau, B., Boudinot, P., Benmansour, A.
(2002). Survey of Transcript Expression in Rainbow Trout Leukocytes Reveals a Major Contribution of Interferon-Responsive Genes in the Early Response to a Rhabdovirus Infection. J. Virol.
76: 8040-8049
[Abstract]
[Full Text]
-
Chin, K.-C., Cresswell, P.
(2001). Inaugural Article: Viperin (cig5), an IFN-inducible antiviral protein directly induced by human cytomegalovirus. Proc. Natl. Acad. Sci. USA
98: 15125-15130
[Abstract]
[Full Text]
-
Sofia, H. J., Chen, G., Hetzler, B. G., Reyes-Spindola, J. F., Miller, N. E.
(2001). Radical SAM, a novel protein superfamily linking unresolved steps in familiar biosynthetic pathways with radical mechanisms: functional characterization using new analysis and information visualization methods. Nucleic Acids Res
29: 1097-1106
[Abstract]
[Full Text]
-
Boudinot, P., Riffault, S., Salhi, S., Carrat, C., Sedlik, C., Mahmoudi, N., Charley, B., Benmansour, A.
(2000). Vesicular stomatitis virus and pseudorabies virus induce a vig1/cig5 homologue in mouse dendritic cells via different pathways. J. Gen. Virol.
81: 2675-2682
[Abstract]
[Full Text]