Previous Article | Next Article 
Journal of Virology, March 1999, p. 1828-1834, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Requirements for Efficient Production and
Transduction of Human Immunodeficiency Virus Type 1-Based
Vectors
Mehdi
Gasmi,
Jacqueline
Glynn,
Ming-Jie
Jin,
Douglas J.
Jolly,
Jiing-Kuan
Yee, and
Shin-Tai
Chen*
Center for Gene Therapy, Chiron Technologies,
San Diego, California 92121
Received 28 August 1998/Accepted 12 November 1998
 |
ABSTRACT |
A number of human immunodeficiency type 1 (HIV-1)-based vectors
have recently been shown to transduce nondividing cells in vivo as well
as in vitro. However, if these vectors are to be considered for
eventual clinical use, a major consideration is to reduce the
probability of unintended generation of replication-competent virus.
This can be achieved by eliminating viral genetic elements involved in
the generation of replication-competent virus without impairing vector
production. We have designed a system to transiently produce
HIV-1-based vectors by using expression plasmids encoding Gag, Pol, and
Tat of HIV-1 under the control of the cytomegalovirus immediate-early
promoter. Our data show that the best vector yield is achieved in the
presence of the Rev/Rev-responsive element (RRE) system. However, the
constitutive transport element of Mason-Pfizer monkey virus can
substitute for RRE and Rev at least to some extent, whereas the
posttranscriptional regulatory element of human hepatitis B virus
appeared to be inefficient. In addition, we show that high-titer virus
preparations can be obtained in the presence of sodium butyrate, which
activates the expression of both the packaging construct and the vector
genome. Finally, our results suggest that efficient infectivity of
vectors defective in the accessory proteins Vif, Vpr, Vpu, and Nef
depends on the nature of the target cells.
 |
INTRODUCTION |
Vectors derived from Moloney murine
leukemia virus (MLV) are widely used in gene delivery and human gene
therapy studies. Most mammalian cells express the MLV amphotropic
receptor on the cell surface, allowing vector entry (8).
However, the nuclear entry of the vector preintegration complex depends
on cell mitosis, probably due to nuclear membrane breakdown
(25). Thus, MLV-based vectors efficiently infect only
proliferating cells and not quiescent cells. This property severely
limits the general use of retroviral vectors for direct gene delivery
in vivo, since a majority of the cells either are terminally
differentiated or remain in the quiescent state without stimulation. In
contrast to MLV, lentiviruses can infect and integrate their genomes
into the chromosomes of nondividing cells. In the case of human
immunodeficiency virus type 1 (HIV-1), the capability of infecting
quiescent cells maps to three viral proteins present in the HIV-1
preintegration complex, namely, the matrix (MA) portion of the Gag
protein, the integrase, and the Vpr protein (7, 11-13, 18).
To date, the relative importance of these apparently redundant
functions is unknown. Recently, HIV-1-based vectors pseudotyped
with heterologous envelopes, notably the G protein of vesicular
stomatitis virus (VSV), have been shown to infect a wide array of
quiescent cell types, including fibroblasts and primary
monocyte-derived macrophages in culture as well as hepatocytes,
myocytes, photoreceptor cells in retina, and neuronal cells in brain in
vivo (5, 22, 29, 30, 46). MLV vectors, under similar
conditions, fail to infect these cell types efficiently. These
observations demonstrate the potential advantages of using lentivirus
vectors for direct in vivo gene delivery.
Most of the HIV-1-based vector production systems reported to date
consist of the cotransfection into 293T cells of three plasmid
constructs: (i) a packaging construct containing all HIV genes except
the env gene, (ii) an expression plasmid for the VSV G
protein to confer a broad host tropism to the vector, and (iii) an HIV
vector containing the gene of interest. When considering using
HIV-1-based vectors for gene therapy, one needs to address the
possibility of generating replication-competent HIV-1 during vector
production. The major route for generating replication-competent retrovirus with such a system would be through homologous recombination events occurring among these plasmid constructs during transfection. Safety would be greatly improved by deleting regions of the viral genome that are not absolutely required for vector production or for
efficient infection of the target cells. In addition, elimination of
genes nonessential for HIV vector production and infectivity will
facilitate the establishment of stable packaging cell lines for HIV vectors.
Apart from the env gene, which is inactivated since the
particles are pseudotyped with the VSV G protein, the obvious target sequences to be eliminated are the HIV-1 genes encoding the accessory proteins. The HIV-1 genome encodes two regulatory proteins, Tat and
Rev, as well as four accessory proteins, namely, Vif, Vpr, Vpu, and
Nef. Although transcription initiation from the HIV long terminal
repeat (LTR) depends on Tat, insertion of an enhancer from the
cytomegalovirus (CMV) immediate-early gene bypasses the Tat
requirement for HIV gene expression (23). However,
recent data demonstrates that Tat is essential for the HIV life cycle at a postentry step in the target cell, suggesting that Tat expression in the packaging cell lines not only can increase vector titers but
also may enhance infection of the target cells (17, 20). Rev
binds the Rev-responsive element (RRE) within the env gene in the viral mRNAs and thereby increases transportation of unspliced or
singly spliced HIV-specific mRNA from the nucleus into the cytoplasm
(9, 26). Although this is an essential function for HIV-1
replication, other RNA transport elements have been shown to substitute
for the RRE function (6, 19). Most importantly, the function
of these elements relies on endogenous factors rather than on Rev.
Bypassing the RRE and Rev requirement may thus eliminate the need for
the stable expression of HIV Rev in the packaging cell lines. The Vif,
Vpr, Vpu, and Nef proteins have been shown to be dispensable for HIV
replication in immortalized cell lines (28). In addition, it
has recently been shown that none of the accessory proteins is required
for efficient HIV-based vector production from transfected 293T cells
(22, 23, 46).
In the present study, we evaluated more precisely the requirement for
Rev and the accessory proteins, Vif, Vpr, Vpu, and Nef, for the
production of high-titer HIV-1-based vectors and efficient transduction
of target cells. We have also tested heterologous mRNA transport
elements derived from Mason-Pfizer monkey virus (MPMV) and hepatitis B
virus (HBV) for their ability to substitute for the function of Rev and
RRE. Our results show that while the absence of the accessory proteins
has little effect on vector production, the presence of sodium
butyrate, which activates the CMV enhancer and the HIV LTR promoter
function (24, 39), can significantly increase vector titers
from the transfected 293T cells. While the MPMV constitutive transport
element (CTE) can substitute for the function of RRE and Rev, the
vector can be generated most efficiently only from a packaging plasmid
containing the RRE sequence. Finally, while the absence of accessory
proteins in the vector shows little effect on infectivity in most cell types, these proteins enhance significantly the infectivity of HIV
vector in quiescent primary human skin fibroblasts. Our studies should
facilitate the establishment of stable packaging cell lines for the
production of high-titer, helper-free HIV vectors for human gene therapy.
 |
MATERIALS AND METHODS |
Plasmid construction.
To construct pCMV-HIV-1, the 0.7-kb
BamHI-SphI fragment with a 19-bp deletion in the
putative packaging signal of pCMV
P1
envpA (31) was
fused with the 8-kb SphI-HindIII (from
position 1447 to 9606) fragment of pNL4-3 (1) and the 4-kb
SalI-EcoRI fragment from pCMV-G (45).
In addition, a deletion of the 580-bp BglII (position 7031 in pNL4-3)-BglII (position 7611 in pNL4-3) fragment was
created in the HIV-1 Env-coding region to eliminate the expression of
this protein and reduce the potential of generating helper virus during
vector production. To generate pCMV-HIVnef(
), the sequence between
the HpaI site at position 8650 in pNL4-3 and the
HindIII site at position 9606 in pNL4-3 of pCMV-HIV-1
was deleted. To generate pCMV-HIVvif(
), pCMV-HIV-1 was digested with NdeI (position 5123 in pNL4-3) and repaired with the Klenow
fragment to create a 2-bp insertion in the coding region of the
vif gene. To generate pCMV-HIVvpu(
), the initiation codon
of Vpu was mutated by site-directed mutagenesis (Mutagene kit; Bio-Rad,
Hercules, Calif.) with the oligonucleotide
5'TGCTACTATTATAGGTTGTACATGTACTACTTACTG3'. To generate
pCMV-HIVvpr(
), pCMV-HIV-1 was digested with EcoRI (position 5747 in pNL4-3) and repaired with the Klenow fragment to
generate a 4-bp insertion in the coding region of the vpr
gene. The pCMV-HIVvpr(
)nef(
) double mutant was generated by
digesting pCMV-HIVnef(
) with EcoRI and repaired with the
Klenow fragment as described above.
To generate pCH-GP-1, the 0.66-kb fragment between position 766 and the
SphI site at position 1447 in pNL4-3 was amplified by PCR
with the oligonucleotides Gag5' (5'GAGGATCCTAGAAGGAGAGAGATGGGT3') and Gag3' (5'GAGGATCCAATAGGCCCTGCATGCACTG3'). The
resulting fragment was ligated with the 3.7-kb
SphI-NdeI fragment from pNL4-3 and the 4-kb
SalI-EcoRI fragment from pCMV-G. To generate
pCHGP-2, the RRE (between positions 7754 and 8013 in HXB-2
[33]) was amplified by PCR from pv653RSN
(31) by using the oligonucleotides RRE5
(5'GCAAGCTTCTGCAGAGCAGTGGGAATAGG3') and RRE3
(5'GCAAGCTTACCCCAAATCCCCAGGAGCTG3') and cloned immediately
after the gag-pol gene in pCHGP-1. To generate pCHGP-3, the
0.65-kb StuI-HindIII fragment from pCCAT-1
(44) was cloned after the gag-pol gene in
pCHGP-1. To generate pCHGP-4, the MPMV CTE (between positions 8020 and
8240 in MPMV [40]) was amplified by PCR from pGem7
fz(
) MPMV(8001-8240) (6) and cloned behind the
gag-pol gene in pCHGP-1.
To generate pv653CMV

-gal, a CMV

-galactosidase (

-gal) cassette
was first constructed by ligating the 0.75-kb
XbaI-
SalI
fragment containing the CMV promoter
from pCMV-G to the 3.1-kb
XbaI-
SmaI fragment
containing the

-gal gene from pSP6-

-gal (
32)
with
pBluescript SK(

) (Stratagene, La Jolla, Calif.) to generate
pCMV

-gal. The 3.8-kb
NotI-
SmaI fragment
containing the CMV

-gal
cassette from pCMV

-gal was ligated with
the 8-kb fragment from
BamHI-digested pv653RSN. To generate
pCMV-Tat, pCMV-G was digested
with
XhoI, and the 4.7-kb
fragment containing the CMV promoter
was ligated with the 0.36-kb
SalI-
BamHI fragment containing the
Tat-coding
region from pCV1 (
4). To generate pCMV-env, the
2.7-kb
XbaI fragment from pCMVEnv-amDra containing the amphotropic
envelope coding region was ligated with the 4.7-kb
BamHI
fragment
from pCMV-G. The construction of pCMV-G has been described
previously
(
45). pCMV-rev was obtained from the National
Institutes of
Health AIDS Research and Reference Reagent
Program.
Cells.
HeLa, HT1080, and 293T cells were maintained in
Dulbecco modified Eagle medium supplemented with 10% fetal calf serum
(FCS). SupT1 cells were maintained in RPMI 1640 medium supplemented
with 10% FCS. Primary human fibroblast CCD 1059sk cells (obtained from the American Type Culture Collection; no. CRL2072) were grown in
Eagle's minimum essential medium supplemented with 10% FCS. Quiescent
CCD 1059sk cells were obtained by growing confluent cells for 5 to 10 days in minimum essential medium with 10% FCS, resulting in a
population of cells in growth arrest at the
G0/G1 phase as determined by flow cytometry
analysis. Quiescent HeLa cells were obtained by plating 2 × 105 cells in each well of a 12-well plate 24 h prior
to gamma irradiation. The cells were subjected to gamma irradiation at
a dose of 4,000 rads, and approximately 90% of the cells were arrested
at G2 phase 3 days after irradiation as determined by flow
cytometry analysis.
Vector production and infection of target cells.
To generate
infectious HIV vectors, 293T cells were seeded at a density of 4 × 106 cells per 10-cm-diameter culture dish. The
infectious vector with all of the accessory proteins was generated by
cotransfecting 10 µg of pCMV-HIV-1, 10 µg of pCMV-G, and 20 µg of
pv653CMV
-gal by the calcium phosphate coprecipitation method
(16). The culture medium was replaced 6 to 8 h later,
and the culture supernatant was collected 18 h after transfection,
filtered through 0.45-µm-pore-size filters, and stored at
80°C.
To generate the vector without any accessory protein, 293T cells were
cotransfected with 8 µg of pCHGP plasmid series, 8 µg of pCMV-G, 16 µg of pv653CMV
-gal, 4 µg of pCMV-Tat, and 4 µg of pCMV-Rev.
293GP/LCZL cells containing an MLV-based provirus with the CMV
-gal
cassette were used in this study. The VSV G protein-pseudotyped MLV
vector was generated as described before (45).
To determine the vector titer, 5 × 10
4 HT1080 cells
were plated in a 12-well plate in the presence of 8 µg of Polybrene
per
ml 24 h prior to infection. The cells were infected overnight
with various dilutions of the vector and assayed for

-gal activity
48 h after
infection.
To assay for

-gal activity, cells were washed once with
phosphate-buffered saline, fixed in 1.25% glutaraldehyde for 15 min,
and stained for 4 h at 37°C in a solution containing 5 mM
potassium
ferriferrocyanide, 400 µg of X-Gal
(5-bromo-4-chloro-3-indolyl-

-
D-galactopyranoside)
(GBT,
St. Louis, Mo.) per ml, and 1 mM MgCl
2.
Helper virus assays.
To detect helper virus, SupT1 cells
were infected with 6 × 106 infectious vector
particles containing all accessory proteins or 6 × 105 vector particles containing no accessory proteins in
the presence of 8 µg of Polybrene per ml in T75 flasks. Passage of
the infected cells was allowed to continue for 10 weeks. During each
passage, the culture supernatant was harvested and stored at
80°C.
The p24 level in the supernatant was determined by an enzyme-linked immunosorbent assay (Coulter Corporation, Miami, Fla.). No
replication-competent virus was detected after 10 weeks of culture.
 |
RESULTS |
Effect of accessory proteins on vector production.
To generate
an infectious HIV-1-based vector containing all accessory proteins,
293T cells were cotransfected with the three constructs shown in Fig.
1A. As shown in Table
1, the three-plasmid cotransfection
resulted in the production of a vector titer of 3.9 × 106 infectious units (IU)/ml. To determine whether the
accessory proteins have any effect on vector production, the gene
encoding each of the four accessory proteins in pCMV-HIV-1 was mutated. In addition, a combination of both Vpr and Nef mutations was introduced into pCMV-HIV-1. As shown in Table 1, mutations in the accessory proteins had very little effect on vector production from transiently transfected 293T cells. After 10 weeks of culture of cells transduced with high-titer vector, no helper virus could be detected in any experiment by screening for p24 expression.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Structures of expression plasmids of the HIV-1-based
vector production system. (A) Packaging system; (B) minimal
gag-pol constructs. Expression of packaging and VSV G
protein (VSV-G) envelope constructs is driven by the CMV
immediate-early promoter (CMV). The polyadenylation signal (PA) is
derived from the rabbit -globin gene. pCMV-HIV-1 contains all the
HIV-1 genes except a 19-bp deletion in the packaging signal ( )
and a 600-bp deletion in the env open reading frame
( env). Accessory-protein open reading frames are shown as solid
boxes. The RNA transport elements are presented as shaded boxes. The
vector genome pv653CMV- -gal consists of the HIV-1 LTRs flanking the
RRE and the reporter gene ( -gal) driven by the CMV promoter.
|
|
Effect of RNA transport elements on vector production.
To
address the question of whether other RNA transport elements can
substitute for the RRE and Rev function, a series of pCHGP plasmids
were constructed (Fig. 1B). pCHGP-1 contains the HIV-1 gag
and pol genes under the control of the CMV promoter. The HIV RRE was inserted immediately downstream of the gag-pol gene
to generate pCHGP-2 to facilitate the gag-pol RNA exit from
the nucleus. In pCHGP-3 and pCHGP-4, the posttranscriptional regulatory
element (PRE) from HBV and the CTE from MPMV, respectively, were
inserted immediately downstream of the gag-pol gene.
To test whether these constructs produce HIV
gag-pol
particles, they were cotransfected into 293T cells with or without
pCMV-Rev,
and the p24 level in the culture supernatant was determined
48
h after transfection. As shown in Table
2, pCHGP-1 generates
a low level of p24
with or without Rev, consistent with the observation
that the RRE is
required for efficient transportation of the HIV
gag-pol
transcript from the nucleus into the cytoplasm. The presence
of the RRE
in pCHGP-2 results in 30-fold stimulation of p24 production
when Rev is
coexpressed. The HBV PRE transport element did not
have any stimulating
effect on p24 expression; however, in the
presence of Rev, a 3.5-fold
increase in the p24 level relative
to that for pCHGP-1 was observed.
Finally, the presence of the
CTE from MPMV increases the p24 level
seven- to ninefold relative
to that of pCHGP-1-transfected cells. As
expected, the stimulation
of p24 production by the CTE is not Rev
dependent. Therefore,
the CTE is able, to some extent, to substitute
for the Rev and
RRE requirement in our system.
To test whether these packaging plasmids generate infectious vectors in
the absence of accessory protein, each of the constructs
from the pCHGP
series was cotransfected with pCMV-G, pv653CMV

-gal,
and pCMV-Tat,
which is required for the efficient expression of
the genomic RNA
derived from pv653CMV

-gal. In addition, pCMV-Rev
was either included
or not included in each cotransfection experiment
to determine the
effect of Rev on the vector titer. Vector particles
generated 24 to
48 h after transfection were harvested, and titers
were determined
in HT1080 cells by X-Gal staining and counting
of positive blue
cells.
As shown in Table
3, pCMV-HIV-1 generated
a titer of about 10
7 IU/ml, and the titer was not affected
by cotransfection of pCMV-Rev.
Cells transfected with pCHGP-1 generated
low titers with or without
Rev. In contrast, cells cotransfected with
pCHGP-2 and pCMV-Rev
generated a titer which was at least 3 orders of
magnitude higher
than that without pCMV-Rev. For pCHGP-3, a very low
vector titer
was obtained from the transfected cells, consistent with
the low
p24 level derived from pCHGP-3-transfected cells (Table
2).
Despite
the small effect of Rev on the p24 level generated from
pCHGP-4-transfected
cells (Table
2), the vector titer derived from this
construct
increased more than 50-fold with cotransfection of pCMV-Rev.
This
increase in titer with Rev probably reflects the fact that Rev
stimulates the transportation of the vector genomic RNA derived
from
pv653CMV

-gal into the cytoplasm, thereby allowing more viral
RNA to
be packaged into virions. Overall, the vector titer in
Table
3
corresponds to the p24 level generated by each packaging
construct
shown in Table
2. These results demonstrate that the
CTE from MPMV can
substitute for the function of RRE and Rev to
facilitate HIV gene
expression, whereas the PRE from HBV fails
to perform this function.
However, a combination of the RRE and
Rev is able to generate a vector
titer which is at least 10-fold
higher than that generated by the CTE
(compare vector titers of
pCHGP-2 and pCHGP-4 in Table
3).
Sodium butyrate stimulates vector production from 293T cells.
Sodium butyrate has been shown to stimulate the activity of the HIV-1
LTR and the CMV immediate-early promoter (24, 39). To
determine whether sodium butyrate had any effect on vector production,
vector particles were generated from v653CMV
-gal in the presence of
various concentrations of sodium butyrate. As shown in Fig.
2, addition of sodium butyrate had little
effect on the vector titer generated from pCMV-HIV-1-transfected cells, whereas the titer generated from pCHGP-2-transfected cells increased approximately 15-fold in the presence of 4 mM sodium butyrate. To
determine the possible reason for the titer increase, the p24 level in
the culture supernatant of transfected 293T cells was determined. The
p24 level of the pCMV-HIV-1-transfected cells increased slightly, from
6.6 µg/ml, with a titer of 6.0 × 106 IU/ml, in the
absence of sodium butyrate to 9.9 µg/ml, with a titer of 1.1 × 107 IU/ml, in the presence of 4 mM sodium butyrate.
However, the p24 level of the pCHGP-2 transfected cells increased from
0.1 µg/ml, with a titer of 4.4 × 105 IU/ml, in the
absence of sodium butyrate to 1.1 µg/ml, with a titer of 6.4 × 106 IU/ml, in the presence of 4 mM sodium butyrate. Thus,
the 10-fold increase in p24 production in pCHGP-2-transfected cells in
the presence of sodium butyrate can account for the observed 15-fold increase in the vector titer shown in Fig. 2. The lack of stimulation in pCMV-HIV-1-transfected cells may reflect the extremely high level of
p24 already generated by this construct in the absence of sodium
butyrate.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Stimulation of vector production by sodium butyrate.
Vectors derived from either pCMV-HIV-1 or pCHGP-2 were generated in
293T cells in the presence of various concentrations of sodium butyrate
as indicated. Titers were determined in HT1080 cells as described in
Materials and Methods. Values are the ratios of titers with sodium
butyrate to titers without sodium butyrate for each vector. This
experiment was repeated once, and similar results were obtained (data
not shown).
|
|
Effect of accessory proteins on vector infectivity.
To study
the ability of the HIV vector to infect quiescent cells and the effect
of the accessory proteins on infectivity, HeLa cells were exposed to
gamma irradiation to arrest cells at the G2 phase of the
cell cycle. Proliferating or growth-arrested HeLa cells were transduced
with either MLV-
-gal, a
-gal gene-containing MLV vector; the
HIV-1-based vector v653CMV
-gal(+), containing all four accessory
proteins; or v653CMV
-gal(
), containing no accessory protein.
Positive cells were scored by X-Gal staining 2 days after transduction.
Results for HeLa cells were expressed as the percentages of titers
observed with the same virus preparations in growing HT1080 cells. As
shown in Fig. 3, no significant
difference in titer was observed in proliferating or quiescent HeLa
cells transduced with either the v653CMV
-gal(+) or the
v653CMV
-gal(
) vector. In contrast, the transduction efficiency of
the MLV vector in quiescent cells was reduced more than 2,000-fold.
Similar results were obtained with irradiated HT1080 cells transduced
with the three vectors (data not shown). To demonstrate that the
observed
-gal activity is not due to pseudotransduction of the
-gal activity present in the vector preparation, proliferating HeLa
cells transduced with the vector were treated with increasing
concentrations of 3'-azido-3'-deoxythymidine. Both the number of blue
cells and the
-gal activity in cell extracts decreased with
increasing concentrations of 3'-azido-3'-deoxythymidine (data not
shown). These results demonstrate that, in contrast to the MLV vector, HIV-1-based vectors can transduce quiescent cells efficiently and the
HIV-1-encoded accessory proteins are not required to transduce these
cells.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Transduction efficiency in HeLa cells. Three hundred
microliters of MLV- -gal with a titer of 2.8 × 106
IU/ml ( ), v653CMV -gal( ) with a titer of 1.4 × 106 IU/ml ( ), or v653CMV -gal(+)
with a titer of 3.7 × 106 IU/ml ( )
was used to transduce actively dividing or growth-arrested HeLa cells
in 12-well plates. The cells were harvested 2 days after transduction,
and the total -gal activity was determined by blue-cell count after
X-Gal staining. The results are presented as the percentage of the
vector titer observed in HT1080 cells for each viral preparation
([titer in dividing or quiescent HeLa cells/titer in HT1080 cells] × 100). The experiment was repeated with 100 and 30 µl of the same
vector stocks, and similar results were observed. Transduction of the
HeLa cells with different vector stocks was repeated at least twice,
and similar results were obtained (data not shown).
|
|
To test the infectivity of HIV-1-based vectors in other cell types,
primary human skin fibroblasts were allowed either to
proliferate or to
grow to confluency and then were infected with
the three retroviral
vectors described above. Fibroblasts grown
to confluency become contact
inhibited and arrested in the G
0/G
1 phase of
the cell cycle (data not shown). As shown in Fig.
4,
the three vectors exhibit similar
transduction efficiencies in
dividing fibroblasts. However, in
quiescent cells, MLV-

-gal vector
transduction dropped to barely
detectable levels. The capacity
of v653CMV

-gal(+) remained
unchanged. In contrast, v653CMV

-gal(

),
which is defective for the
HIV-1 accessory proteins, showed a
four- to sevenfold-decreased level
of efficiency in transducing
the contact-inhibited fibroblasts relative
to the v653CMV

-gal(+)
vector. These results suggest that the
requirement for accessory
proteins for efficient transduction by
HIV-1-based vectors is
cell type dependent.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
Transduction efficiency in human skin fibroblasts. Ten
microliters of MLV- -gal ( ), v653CMV -gal( )
( ), or v653CMV -gal(+) ( ) was
used to infect dividing and quiescent fibroblasts in a 12-well plate.
Two days after transduction, the titer was determined by blue-cell
counting after X-Gal staining. Data for transduction of quiescent and
dividing fibroblasts are presented as the percentage of the titer
observed in growing HT1080 cells for each viral preparation ([titer in
growing or quiescent fibroblasts/titer in HT1080 cells] × 100). The
values are averages from four experiments, with standard deviations.
|
|
 |
DISCUSSION |
The ability of HIV-based vectors to infect terminally
differentiated cells and quiescent cells makes them suitable vectors for direct in vivo gene delivery. However, large-scale production and
purification of HIV vectors require the establishment of stable packaging cell lines. Since HIV-1 encodes at least nine proteins and
stable expression of some of these proteins, such as Vpr, is known to
be extremely toxic to the cells (21, 34), selective expression of only those proteins absolutely essential for vector production and infectivity is important.
Consistent with previous studies, transient transfection into 293T
cells of all the required components for HIV production resulted in
high-titer vector production in the present study. Mutation of the
genes encoding HIV-1 accessory proteins has little effect on vector
production. Efficient HIV-1 infection requires the presence of the Nef
protein, which appears to facilitate virus capsid disassembly upon
infection (3, 38). The requirement for Nef for virus
uncoating can be bypassed if the virus is pseudotyped with VSV G
protein (2), which may explain why there was no significant
titer reduction in the present study. Vpu has been shown to facilitate
the release of budding virus particles from the surfaces of infected
cells (42). The enhancement of capsid release is cell type
dependent and is not limited to HIV; it can also facilitate the release
of visna virus and MLV from infected cells (15, 37). The
Vpu-deficient vector is generated from 293T cells by transient
transfection. Since 293T has an extremely high transfection efficiency,
this procedure presumably produces excessive amounts of the vector
genome as well as HIV-encoded proteins, which may make the Vpu effect
negligible. Alternatively, Vpu may have no effect on virus release from
293T cells, as observed for a number of other cell lines
(36). The Vpr protein, like HIV MA and integrase, contains a
nucleophilic determinant that permits nuclear localization of viral
nuclear capsid and replication in nondividing cells (18).
Mutation of Vpr, however, has no effect on the virus infectivity in
proliferating cells such as the growing HT1080 cells used to determine
the titer of the Vpr-deficient vector. Vif acts during virus assembly
to make the virus particle competent for subsequent infection
(43). However, this effect is dependent on the cell type
from which the virus is generated (10). The absence of a
titer decrease for the Vif-deficient vector may reflect the
permissiveness of 293T cells to complement the Vif defect.
When the minimal pCHGP-2 packaging construct is used, our results
showed, as predicted, that p24 expression from transfected cells is
strongly dependent on the presence of Rev. Interestingly, when the HBV
PRE transport element was used, its mRNA-transporting activity appeared
to be strongly increased when the Rev protein was coexpressed, although
it was still considerably lower than that of the RRE-Rev system. This
transactivating property was not observed when the RevM10
(27) transdominant negative mutant was used (14).
In addition, it has been suggested that HBV and RRE mRNA transport from
the nucleus to the cytoplasm could involve the same pathway
(35). Together, these data suggest that Rev could enhance
PRE transport activity directly by binding the PRE sequence or
indirectly by recruiting cellular factors involved in the nuclear
export mechanism. Insertion of the HBV PRE into the second intron of
HIV-1 has been shown to increase the accumulation of the unspliced RNA
in the cytoplasm, demonstrating that this element can facilitate RNA
exit from the nuclei (19). However, the present study
demonstrates that the PRE from HBV slightly increases p24 expression or
vector production from the transfected cells only when Rev is
expressed. Therefore, PRE, as a transport element, does not appear to
be useful for our purpose to bypass the HIV-1 Rev protein requirement.
In contrast, pCHGP-4, which contains the CTE derived from the MPMV
genome, enables Rev-independent expression of p24, as it is not
stimulated significantly by cotransfection of pCMV-Rev. However, the
p24 level derived from cells transfected with pCHGP-4 is at least
fivefold lower than that with pCHGP-2 in the presence of Rev. In these
experiments, pCHGP-2 was cotransfected with pCMV-Rev, and as a result,
large amounts of Rev may be available in the transfected cells to
efficiently transport RRE-containing transcripts from nuclei into the
cytoplasm. In contrast, the CTE in pCHGP-4 interacts with endogenous
factors which may be in limited supply compared with Rev generated from
transient transfection. One such factor interacting with the CTE of
MPMV has recently been identified as ATP-dependent RNA helicase A
(41). Thus, a difference in the endogenous levels of the
protein factors required for efficient transportation of either RRE- or
CTE-containing transcripts may account for the observed difference in
p24 expression of these two constructs. Alternatively, the RRE and Rev
may be intrinsically more efficient than the CTE to transport the
HIV-encoded messages. The efficiency of transporting HIV-encoded
messages by either the RRE or CTE can be elucidated with cell lines
stably expressing the HIV Rev protein.
Our results demonstrate that HIV-derived vectors transduce
nonproliferating cells efficiently, whereas the MLV vector fails to
give detectable transduction. This observation is consistent with the
fact that at least three nuclear localization signal-containing proteins, including MA, Vpr, and integrase, are present in the lentivirus particle, and these proteins facilitate active transport of
the nucleocapsid from the cytoplasm into the nuclei of the infected
cells. The functional redundancy of these proteins may explain why
accessory protein-deficient vector particles can still infect
growth-arrested HeLa cells at the same efficiency as vector particles
containing all of the accessory proteins. These results are consistent
with the recent observations reported by others that the accessory
proteins are not required for efficient infection of growth-arrested
293T cells (23, 46). However, the infectivity of the
accessory protein-deficient vector in contact-inhibited primary human
skin fibroblasts is reduced approximately threefold compared with that
of the vector containing all of the accessory proteins. Our results
suggest that for efficient infection of this cell type, the accessory
proteins, either alone or in combination, are beneficial. We conclude
that the effect of HIV accessory proteins on infectivity is dependent
on the cell type or cell proliferation state. This conclusion is in
agreement with the results reported by Zufferey et al. (46)
and Kafri et al. (22) that for efficient infection of human
macrophages in culture and adult mouse livers in vivo, the presence of
accessory proteins enhances infectivity, whereas they are dispensable
for efficient infection of neuronal cells in vivo.
High-titer HIV-1 vectors have so far been generated from 293T cells by
transient transfection. Although this method is convenient, it is not
suitable for mass vector production for clinical application. Establishment of stable packaging cell lines for HIV vectors not only
overcomes the mass production problem, but it will also make helper
virus generation unlikely because multiple homologous recombination events are required for such an event to occur. Such events occur more
frequently before stable transfection and integration take place. Our
results suggest that while the CTE can partially alleviate the
requirement for stable Rev expression in the packaging cell lines, a
combination of Rev and the RRE still generates significantly higher
vector titers than the CTE. The HIV-1-encoded accessory proteins are
not required for efficient vector production from 293T cells, and the
infectivity of the resulting vector is similar to that of the vector
containing all accessory proteins except in the case of primary human
skin fibroblasts. Recent results from Kim et al. (23)
suggest that the requirement for Tat can be bypassed by using an HIV
vector containing a hybrid HIV LTR with the U3 regions replaced with
the CMV promoter. Based on these studies, the indispensable components
of the packaging cell lines for HIV vectors should therefore be only
gag, pol, Rev, and VSV G protein. To efficiently
infect cell types such as quiescent skin fibroblasts and hepatocytes,
some of the accessory proteins will have to be expressed in the
packaging cell lines. The present study should help to facilitate the
successful establishment of packaging cell lines for HIV-1-derived vectors.
 |
ACKNOWLEDGMENTS |
We thank J. Sodroski for pCMV
P1
envpA and pv653RSN and Moti
Bodner for pCMVEnv-amDra.
 |
FOOTNOTES |
*
Corresponding author. Present address: Jerry L. Pettis
VAMC and Loma Linda University, Mineral Metabolism (151), 11201 Benton St., Loma Linda, CA 92357. Phone: (909) 422-3101. Fax: (909) 796-1680. E-mail: STChen{at}netscape.net.
 |
REFERENCES |
| 1.
|
Adachi, A.,
H. E. Gendelman,
S. Koenig,
T. Folks,
R. Willey,
A. Rabson, and M. A. Martin.
1986.
Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone.
J. Virol.
59:284-291[Abstract/Free Full Text].
|
| 2.
|
Aiken, C.
1997.
Pseudotyping human immunodeficiency virus type 1 (HIV-1) by the glycoprotein of vesicular stomatitis virus targets HIV-1 entry to an endocytic pathway and suppresses both the requirement for Nef and the sensitivity to cyclosporin A.
J. Virol.
71:5871-5877[Abstract].
|
| 3.
|
Aiken, C., and D. Trono.
1995.
Nef stimulates human immunodeficiency virus type 1 proviral DNA synthesis.
J. Virol.
69:5048-5056[Abstract].
|
| 4.
|
Arya, S. K.,
C. Guo,
S. F. Josephs, and F. Wong-Staal.
1985.
trans-activator gene of human T-lymphotropic virus type III (HTLV-III).
Science
229:69-73[Abstract/Free Full Text].
|
| 5.
|
Blömer, U.,
L. Naldini,
T. Kafri,
D. Trono,
I. M. Verma, and F. H. Gage.
1997.
Highly efficient and sustained gene transfer in adult neurons with a lentivirus vector.
J. Virol.
71:6641-6649[Abstract].
|
| 6.
|
Bray, M.,
S. Prasad,
J. W. Dubay,
E. Hunter,
K.-T. Jeang,
D. Rekosh, and M.-L. Hammarskjöld.
1994.
A small element from the Mason-Pfeizer monkey virus genome makes human immunodeficiency virus type 1 replication Rev-independent.
Proc. Natl. Acad. Sci. USA
91:1256-1260[Abstract/Free Full Text].
|
| 7.
|
Bukrinsky, M. I.,
S. Haggerty,
M. P. Dempsey,
N. Sharova,
A. Adzhubel,
L. Spitz,
P. Lewis,
D. Goldfarb,
M. Emerman, and M. Stevenson.
1993.
A nuclear localization signal within HIV-1 matrix protein that governs infection of non-dividing cells.
Nature
365:666-669[Medline].
|
| 8.
|
Cone, R. D., and R. C. Mulligan.
1984.
High-efficiency gene transfer into mammalian cells: generation of helper-free recombinant retrovirus with broad mammalian host range.
Proc. Natl. Acad. Sci. USA
81:6349-6353[Abstract/Free Full Text].
|
| 9.
|
Emerman, M.,
R. Vazeux, and K. Peden.
1989.
The rev gene product of the human immunodeficiency virus affects envelope-specific RNA localization.
Cell
57:1155-1165[Medline].
|
| 10.
|
Gabduza, D. H.,
K. Lawrence,
E. Langhoff,
E. F. Terwilliger,
T. Dorfmann,
W. A. Haseltine, and J. Sodroski.
1992.
Role of vif in replication of human immunodeficiency virus type 1 in CD4+ T lymphocytes.
J. Virol.
66:6489-6495[Abstract/Free Full Text].
|
| 11.
|
Gallay, P.,
T. Hope,
D. Chin, and D. Trono.
1997.
HIV-1 infection of nondividing cells through the recognition of integrase by the importin/karyopherin pathway.
Proc. Natl. Acad. Sci. USA
94:9825-9830[Abstract/Free Full Text].
|
| 12.
|
Gallay, P.,
V. Stitt,
C. Mundy,
M. Oettinger, and D. Trono.
1996.
Role of the karyopherin pathway in human immunodeficiency virus type 1 nuclear import.
J. Virol.
70:1027-1032[Abstract].
|
| 13.
|
Gallay, P.,
S. Swingler,
J. Song,
F. Bushman, and D. Trono.
1995.
HIV nuclear import is governed by the phosphotyrosine-mediated binding of matrix to the core domain of integrase.
Cell
83:569-576[Medline].
|
| 14.
| Gasmi, M., S. T. Chen, and J. K. Yee.
Unpublished data.
|
| 15.
|
Gottlinger, H. G.,
T. Dorfman,
E. A. Cohen, and W. A. Haseltine.
1993.
Vpu protein of human immunodeficiency virus type 1 enhances the release of capsids produced by gag gene constructs of widely divergent retroviruses.
Proc. Natl. Acad. Sci. USA
90:7381-7385[Abstract/Free Full Text].
|
| 16.
|
Graham, F., and A. van der Eb.
1973.
A new technique for the assay of infectivity of human adenovirus 5 DNA.
Virology
52:456-467[Medline].
|
| 17.
|
Harrich, D.,
C. Ulich,
L. F. García-Martínez, and R. B. Gaynor.
1997.
Tat is required for efficient HIV-1 reverse transcription.
EMBO J.
16:1224-1235[Medline].
|
| 18.
|
Heinzinger, N. K.,
M. I. Bukrinsky,
S. A. Haggerty,
A. M. Ragland,
V. Kewalramani,
M. A. Lee,
H. E. Gendelman,
L. Ratner,
M. Stevenson, and M. Emerman.
1994.
The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in non-dividing host cells.
Proc. Natl. Acad. Sci. USA
91:7311-7315[Abstract/Free Full Text].
|
| 19.
|
Huang, J., and T. J. Liang.
1993.
A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products.
Mol. Cell. Biol.
13:1416-1486.
|
| 20.
|
Huang, L.,
A. Joshi,
R. Willey,
J. Orenstein, and K. T. Jeang.
1994.
Human immunodeficiency viruses regulated by alternative trans-activators: genetic evidence for a novel non-transcriptional function of Tat in virion infectivity.
EMBO J.
13:2886-2896[Medline].
|
| 21.
|
Jowett, J. B. M.,
V. Planelles,
B. Poon,
N. P. Shah,
M.-L. Chen, and I. S. Y. Chen.
1995.
The human immunodeficiency virus type 1 vpr gene arrests infected T cells in the G2+M phase of the cell cycle.
J. Virol.
69:6304-6313[Abstract].
|
| 22.
|
Kafri, T.,
U. Blömer,
D. A. Peterson,
F. H. Gage, and I. M. Verma.
1997.
Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors.
Nat. Genet.
17:314-317[Medline].
|
| 23.
|
Kim, N. V.,
K. Mithrophanous,
S. M. Kingsman, and A. J. Kingsman.
1998.
Minimal requirement for a lentivirus vector based on human immunodeficiency type 1.
J. Virol.
72:811-816[Abstract/Free Full Text].
|
| 24.
|
Laughlin, M. A.,
G. Y. Chang,
J. W. Oakes,
F. Gonzales-Scarano, and R. J. Pomerantz.
1995.
Sodium butyrate stimulation of HIV-1 gene expression: a novel mechanism of induction independent of NF-kappa B.
J. Acquired Immune Defic. Syndr. Hum. Retrovirol.
9:332-339[Medline].
|
| 25.
|
Lewis, P. F., and M. Emerman.
1994.
Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus.
J. Virol.
68:510-516[Abstract/Free Full Text].
|
| 26.
|
Malim, M. H.,
J. Hauber,
S. Y. Le,
J. V. Maizel, and B. R. Cullen.
1989.
The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA.
Nature
338:254-257[Medline].
|
| 27.
|
Malim, M. H.,
S. Bohnlein,
J. Hauber, and B. R. Cullen.
1989.
Functional dissection of the HIV-1 Rev trans-activator-derivation of a trans-dominant repressor of Rev function.
Cell
58:205-214[Medline].
|
| 28.
|
Miller, R. H., and N. Sarver.
1997.
HIV accessory proteins as therapeutic targets.
Nat. Med.
3:389-394[Medline].
|
| 29.
|
Naldini, L.,
U. Blömer,
F. H. Gage,
D. Trono, and I. M. Verma.
1996.
Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector.
Proc. Natl. Acad. Sci. USA
93:11382-11388[Abstract/Free Full Text].
|
| 30.
|
Naldini, L.,
U. Blömer,
P. Gallay,
D. Ory,
R. Mulligan,
F. H. Gage,
I. Verma, and D. Trono.
1996.
In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector.
Science
272:263-267[Abstract].
|
| 31.
|
Parolin, C.,
T. Dorfman,
G. Palú,
H. Göttlinger, and J. Sodroski.
1994.
Analysis in human immunodeficiency virus type 1 vectors of cis-acting sequences that affect gene transfer into human lymphocytes.
J. Virol.
68:3888-3895[Abstract/Free Full Text].
|
| 32.
|
Price, J.,
D. Turner, and C. Cepko.
1987.
Lineage analysis in the vertebrate nervous system by retrovirus-mediated gene transfer.
Proc. Natl. Acad. Sci. USA
84:156-160[Abstract/Free Full Text].
|
| 33.
|
Ratner, L.,
W. Haseltine,
R. Patarca,
K. J. Livak,
B. Starcich,
S. F. Josephs,
E. R. Doran,
J. A. Rafalski,
E. A. Whitehorn,
K. Baumeister,
L. Ivanoff,
R. Petteway, Jr.,
M. L. Pearson,
J. A. Lauteenberger,
T. S. Papas,
J. Ghrayeb,
N. T. Chang,
R. C. Gallo, and F. Wong-Staal.
1985.
Complete nucleotide sequence of the AIDS virus, HTLV-III.
Nature
313:277-284[Medline].
|
| 34.
|
Rogel, M. E.,
L. I. Wu, and M. Emerman.
1995.
The human immunodeficiency virus type 1 vpr gene prevents cell proliferation during chronic infection.
J. Virol.
69:882-888[Abstract].
|
| 35.
|
Roth, J., and M. Dobbelstein.
1997.
Export of hepatitis B virus RNA on a Rev-like pathway: inhibition by the regenerating liver inhibitory factor I B .
J. Virol.
71:8933-8939[Abstract].
|
| 36.
|
Saikai, H.,
K. Tokunaga,
M. Kawamura, and A. Adachi.
1995.
Function of human immunodeficiency virus type 1 Vpu protein in various cell types.
J. Gen. Virol.
76:2717-2722[Abstract/Free Full Text].
|
| 37.
|
Schubert, U.,
K. A. Clouse, and K. Strebel.
1995.
Augmentation of virus secretion by the human immunodeficiency virus Vpu protein is cell type independent and occurs in cultured primary macrophages and lymphocytes.
J. Virol.
69:7699-7711[Abstract].
|
| 38.
|
Schwartz, O.,
V. Marechal,
O. Danos, and J.-M. Heard.
1995.
Human immunodeficiency virus type 1 Nef increases the efficiency of reverse transcription in the infected cell.
J. Virol.
69:4053-4059[Abstract].
|
| 39.
|
Seneoka, Y.,
P. M. Cannon,
E. E. Ramsdale,
J. C. Griffiths,
G. Romano,
S. M. Kingsman, and A. J. Kingsman.
1995.
A transient three-plasmid expression system for the production of high titer retroviral vector.
Nucleic Acids Res.
23:628-633[Abstract/Free Full Text].
|
| 40.
|
Sonigo, P.,
C. Barker,
E. Hunter, and S. Wain-Hobson.
1986.
Nucleotide sequence of Mason-Pfizer monkey virus: an immunosuppressive type D retrovirus.
Cell
45:375-385[Medline].
|
| 41.
|
Tang, H.,
G. M. Gaietta,
W. H. Fischer,
M. H. Ellisman, and F. Wong-Staal.
1997.
A cellular cofactor for the constitutive transport element of type D retrovirus.
Science
276:1412-1415[Abstract/Free Full Text].
|
| 42.
|
Terwilliger, E. F.,
E. A. Cohen,
Y. Lu,
J. G. Sodroski, and W. A. Haseltine.
1989.
Functional role of human immunodeficiency virus type 1 vpu.
Proc. Natl. Acad. Sci. USA
86:5163-5167[Abstract/Free Full Text].
|
| 43.
|
von Schwedler, U.,
J. Song,
C. Aiken, and D. Trono.
1993.
vif is crucial for human immunodeficiency virus type 1 proviral DNA synthesis in infected cells.
J. Virol.
67:4945-4955[Abstract/Free Full Text].
|
| 44.
|
Yee, J. K.
1989.
A liver-specific enhancer in the core promoter region of human hepatitis B virus.
Science
246:658-661[Abstract/Free Full Text].
|
| 45.
|
Yee, J. K.,
A. Miyanohara,
P. LaPorte,
K. Bouic,
J. C. Burns, and T. Friedmann.
1994.
A general method for the generation of high-titer, pantropic retroviral vectors: highly efficient infection of primary hepatocytes.
Proc. Natl. Acad. Sci. USA
91:9564-9568[Abstract/Free Full Text].
|
| 46.
|
Zufferey, R.,
D. Nagy,
R. Mandel,
L. Naldini, and D. Trono.
1997.
Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo.
Nat. Biotechnol.
15:871-875[Medline].
|
Journal of Virology, March 1999, p. 1828-1834, Vol. 73, No. 3
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Malyukova, I., Murray, K. F., Zhu, C., Boedeker, E., Kane, A., Patterson, K., Peterson, J. R., Donowitz, M., Kovbasnjuk, O.
(2009). Macropinocytosis in Shiga toxin 1 uptake by human intestinal epithelial cells and transcellular transcytosis. Am. J. Physiol. Gastrointest. Liver Physiol.
296: G78-G92
[Abstract]
[Full Text]
-
Unwalla, H. J., Li, H.-T., Bahner, I., Li, M.-J., Kohn, D., Rossi, J. J.
(2006). Novel Pol II Fusion Promoter Directs Human Immunodeficiency Virus Type 1-Inducible Coexpression of a Short Hairpin RNA and Protein. J. Virol.
80: 1863-1873
[Abstract]
[Full Text]
-
Amaar, Y. G., Thompson, G. R., Linkhart, T. A., Chen, S.-T., Baylink, D. J., Mohan, S.
(2002). Insulin-like Growth Factor-binding Protein 5 (IGFBP-5) Interacts with a Four and a Half LIM Protein 2 (FHL2). J. Biol. Chem.
277: 12053-12060
[Abstract]
[Full Text]
-
Kowolik, C. M., Hu, J., Yee, J.-K.
(2001). Locus Control Region of the Human CD2 Gene in a Lentivirus Vector Confers Position-Independent Transgene Expression. J. Virol.
75: 4641-4648
[Abstract]
[Full Text]
-
Mautino, M. R., Keiser, N., Morgan, R. A.
(2001). Inhibition of Human Immunodeficiency Virus Type 1 (HIV-1) Replication by HIV-1-Based Lentivirus Vectors Expressing Transdominant Rev. J. Virol.
75: 3590-3599
[Abstract]
[Full Text]
-
Gruber, A., Kan-Mitchell, J., Kuhen, K. L., Mukai, T., Wong-Staal, F.
(2000). Dendritic cells transduced by multiply deleted HIV-1 vectors exhibit normal phenotypes and functions and elicit an HIV-specific cytotoxic T-lymphocyte response in vitro. Blood
96: 1327-1333
[Abstract]
[Full Text]
-
Srinivasakumar, N., Schuening, F.
(2000). Novel Tat-Encoding Bicistronic Human Immunodeficiency Virus Type 1-Based Gene Transfer Vectors for High-Level Transgene Expression. J. Virol.
74: 6659-6668
[Abstract]
[Full Text]
-
Nishizawa, M., Kamata, M., Katsumata, R., Aida, Y.
(2000). A Carboxy-Terminally Truncated Form of the Human Immunodeficiency Virus Type 1 Vpr Protein Induces Apoptosis via G1 Cell Cycle Arrest. J. Virol.
74: 6058-6067
[Abstract]
[Full Text]
-
Kotsopoulou, E., Kim, V. N., Kingsman, A. J., Kingsman, S. M., Mitrophanous, K. A.
(2000). A Rev-Independent Human Immunodeficiency Virus Type 1 (HIV-1)-Based Vector That Exploits a Codon-Optimized HIV-1 gag-pol Gene. J. Virol.
74: 4839-4852
[Abstract]
[Full Text]
-
Wodrich, H., Schambach, A., Krausslich, H.-G.
(2000). Multiple copies of the Mason-Pfizer monkey virus constitutive RNA transport element lead to enhanced HIV-1 Gag expression in a context-dependent manner. Nucleic Acids Res
28: 901-910
[Abstract]
[Full Text]
-
Srinivasakumar, N., Schuening, F. G.
(1999). A Lentivirus Packaging System Based on Alternative RNA Transport Mechanisms To Express Helper and Gene Transfer Vector RNAs and Its Use To Study the Requirement of Accessory Proteins for Particle Formation and Gene Delivery. J. Virol.
73: 9589-9598
[Abstract]
[Full Text]
-
DePolo, N. J., Harkleroad, C. E., Bodner, M., Watt, A. T., Anderson, C. G., Greengard, J. S., Murthy, K. K., Dubensky, T. W. Jr., Jolly, D. J.
(1999). The Resistance of Retroviral Vectors Produced from Human Cells to Serum Inactivation In Vivo and In Vitro Is Primate Species Dependent. J. Virol.
73: 6708-6714
[Abstract]
[Full Text]