This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gromeier, M.
Right arrow Articles by Wimmer, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gromeier, M.
Right arrow Articles by Wimmer, E.

 Previous Article  |  Next Article 

Journal of Virology, February 1999, p. 958-964, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Dual Stem Loops within the Poliovirus Internal Ribosomal Entry Site Control Neurovirulence

Matthias Gromeier,1,* Birgit Bossert,1 Mineo Arita,2 Akio Nomoto,2 and Eckard Wimmer1

Department of Molecular Genetics and Microbiology, State University of New York at Stony Brook, Stony Brook, New York 11794,1 and Department of Microbiology, Institute of Medical Science, University of Tokyo, Tokyo, Japan2

Received 20 July 1998/Accepted 2 November 1998


    ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

In the human central nervous system, susceptibility to poliovirus (PV) infection is largely confined to a specific subpopulation of neuronal cells. PV tropism is likely to be determined by cell-external components such as the PV receptor CD155, as well as cell-internal constraints such as the availability of a suitable microenvironment for virus propagation. We reported previously that the exchange of the cognate internal ribosomal entry site (IRES) within the 5' nontranslated region of PV with its counterpart from human rhinovirus type 2 (HRV2) can eliminate the neuropathogenic phenotype in a transgenic mouse model for poliomyelitis without diminishing the growth properties in HeLa cells. We now show that attenuation of neurovirulence of PV/HRV2 chimeras is not confined to CD155 transgenic mice but is evident also after intraspinal inoculation into Cynomolgus monkeys. We have dissected the PV and HRV2 IRES elements to determine those structures responsible for neurovirulence (or attenuation) of these chimeric viruses. We report that two adjacent stem loop structures within the IRES cooperatively determine neuropathogenicity.


    INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Tissue tropism and pathogenic properties of a virus are determined largely by the cellular receptor(s) and an intracellular milieu suitable for viral proliferation. Poliovirus (PV), the prototype of the genus Enterovirus of the family Picornaviridae, has a markedly restricted tissue tropism that is limited to unidentified cells within the gastrointestinal tract and to motor neurons in the spinal cord and brainstem. Neurological disease, culminating in flaccid paralysis, evolves with the progressive destruction of motor neurons by PV in the spinal cord anterior horn, a condition called poliomyelitis (4, 31).

Studies of the attenuated PV vaccine strains of Sabin (32) have revealed that, remarkably, some of the attenuating mutations map to a specific region in the 5' nontranslated region (5'NTR) of the viral genome (6, 16, 26). This region was subsequently identified as domain V of the internal ribosomal entry site (IRES) of PV (reviewed in reference 41).

IRES elements are 400-nucleotide-(nt)-long segments within the 5'NTR of picornavirus genomic RNAs that allow initiation of protein synthesis independently of a 5' end (14, 27) (Fig. 1). These genetic entities, which are a signature not only of picornaviruses (40) but also of hepatitis C virus (39), have been recognized by their function, not by their structure. Indeed, IRES elements of different viruses may have only minor, if any, homology (28, 29), yet they are interchangeable from virus to virus, leading to novel chimeric infectious agents (2, 7, 22). The mechanism by which IRES elements function remains obscure.


View larger version (29K):
[in this window]
[in a new window]
  		FIG. 1.   PV1/HRV2 chimeras featuring heterologous or synthetic IRESes of various composition. The cognate IRES of PV1(M) (A) was exchanged with its counterpart from HRV2 as described previously [B; PV1(RIPO) (7)]. All viruses feature the wt PV1(M) ORF with the exception of C [PV1(RIPOS)], which was engineered to contain all mutations within the capsid encoding region (P1) specifying PV1(S). The cloverleaf (5'NTR domain I) was derived from PV1(M) in all viruses. All featured IRESes in a PV context were tested for their propensity to mediate neurological disease after intracerebral (i.c.) inoculation into CD155 tg mice (third column). A horizontal bar indicates that intracerebral inoculation of 109 PFU of the variant in question did not elicit any neurological symptoms in CD155 tg mice.

The attenuating point mutations in the IRESes of the Sabin vaccine strains (nt 480, 481, and 472 in types 1, 2, and 3, respectively; see Fig. 4A) each map to domain V of the IRES. Their presence has been correlated with reduced translational efficiencies of the corresponding viral mRNAs compared to wild-type (wt) templates (36-38). It was suggested that this may be the mechanism by which these mutations confer an attenuating (att) phenotype to the Sabin strains (40). Interestingly, infection of neuroblastoma cells could differentiate between wt and att phenotypes (1, 20). These studies led to the notion that domain V of the PV IRES is a major determinant of neurovirulence, but the mechanism remained unsolved. The contribution to att of these IRES mutations relative to mutations downstream of the IRES (the open reading frame [ORF] of the polyprotein) has been recently a matter of debate; however, the importance of the viral capsid in the expression of the att phenotype of the Sabin strains has been stressed (5, 23).

We previously studied a chimeric virus, PV1(RIPO), that possesses the genotype of PV type 1 (Mahoney) [PV1(M)] except that the cognate IRES plus spacer sequence (40) was replaced by the corresponding elements of human rhinovirus type 2 (HRV2) (Fig. 1B). PV1(RIPO) replicates in HeLa cells with PV1(M) kinetics but is unable to proliferate in human neuroblastoma SK-N-MC cells (7). We have also reported (7) that PV1(RIPO) has lost the neurovirulent phenotype, characteristic of its PV1(M) progenitor, in mice transgenic for the human PV receptor (CD155 tg mice [18]) despite the fact that the chimera grows in skeletal muscle of these transgenic animals or in mouse L cells expressing CD155 (7).

Lack of replication of PV1(RIPO) in cells of neuronal origin may offer an opportunity to construct derivatives of this or of related chimeric viruses that could be used as vectors to target motor neurons in human gene therapy. It was of great interest, therefore, to test PV1(RIPO) for its neurovirulence phenotype in nonhuman primates under conditions at which the attenuated PV Sabin vaccine strains are analyzed. Moreover, we have studied the genetic determinants responsible for the att phenotype of PV1(RIPO), aiming ultimately at elucidating the mechanism of tissue tropism restriction induced by IRES elements. The data have revealed an unexpected complexity of the structural basis of IRES-dependent pathogenicity. Previous studies of the molecular genetics of IRES elements have made extensive use of gene expression systems measuring IRES-mediated reporter gene expression either in cell-free translation or in tissue culture cells. Our studies of IRES genetics included the analysis of the influence of specific IRES sequences on the pathogenic phenotype in experimental animals.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Construction of PV/HRV2 IRES chimeras. IRES chimeras were constructed by using a cloning cassette to exchange the cognate IRES of PV1(M) with heterologous IRES elements of various compositions (7). The following primers were used to generate composite IRES elements recombining stem loops of HRV2 with those of PV1(M) (nucleotide sequence numbering is that assigned to the PV1(M) IRES sequence (17)]: 1, ccgaattcaacttagaagtttttcacaaag; 2, gggaattcagacgcacaaaaccaag; 3, ccggatcctccggcccctgaatgcg; 4, ccggatcctccggcccctgaatgtgg; 5, cc ggatccttatgtagctcaatagg; 6, ccggatccaaagcgagcacacggggc; 7, ccggtaccgcttatggtgacaatcacag; 8, gcggtaccgcttatggtgacaatatatac; 9, gcggtaccaataaaataaaaggaaacacggacacc; 10, ccggtacctaaaggaaaaagtgaaaca; 11, cctgagctcccattatgatacaattgtctg; 12, cctgagctcccatggtgccaatatatatattg; 13, ggccaatcactggtttgtgaccaccagctgcagggttaagg; 14, ggccagtgattggccagtcgtaatgagc; 15, gggagctcccatgataacaatctgtg; 16, ggttacgtgctcttgctccgaggttggg; and 17, ggcacgtaacccaatgtgtatcttgtcgtaacgcgc.

For PV1(R2-4,6), primers 1 and 6 were used to generate a PCR fragment encompassing domains II to IV of the HRV2 IRES, which was ligated to a PCR fragment obtained from PV1(M) by using primers 3 and 9 corresponding to PV1(M) domain V and to a PCR product from HRV2, yielding domain VI, with the use of primers 8 and 12. For PV1(R2-5), primers 1 and 10 were used to generate a fragment containing domains II to V of HRV2 that was ligated to domain VI of PV1(M), PCR synthesized with the use of primers 7 and 11. PV1(R5-6) was generated by ligating a PCR product from PV1(M) by using primers 2 and 5 with a PCR product encompassing domains V and VI from HRV2 generated with primers 4 and 12. A PCR product from PV1(M) generated by using primers 2 and 9 was ligated to domain VI of HRV2 obtained by PCR with primers 8 and 12. PV1(rpr) and PV1(rpp) were cloned as follows. An IRES fragment encoding nt 484 to 508 (the tip of domain V) from PV1(M) on top of the ascending stem of domain V derived from HRV2 was generated by using HRV2 cDNA as a template with primers 1 and 13. This fragment was ligated to a PCR product resulting from priming with primers 14 and 10, yielding the descending branch of stem loop V and poly(U) tract from HRV2 [with nt 484 to 508 from PV1(M)]. Domain VI was derived from PV1(M) by PCR with primers 7 and 11 or with primer 15. Use of primer 15 in the latter reaction yielded PV1(rpr), deleting the long terminal stretch of the IRES absent among rhinoviruses and putting the initiating AUG in a rhinovirus context. Primer 11 resulted in PV1(rpp), conserving the terminal IRES stretch and the cognate PV1(M) AUG (see Fig. 4). PV1(prr) was generated by PCR with primers 2 and 16 from template PV1(M) cDNA to yield IRES domains II to V (ascending loop) and primers 17 and 12 from template PV1(R6) cDNA to yield IRES domains V (descending loop) from PV1(M) and domain VI from HRV2. The resulting chimera PV1(prr) was the reverse of PV1(rpr), featuring the upper loop of domain V (nt 484 to 508) and domain VI derived from HRV2 in a PV1(M) background (see Fig. 4). Each chimeric IRES construct was subjected to MFOLD analysis to determine the predicted secondary structure. We found that overall IRES structure predicted for enteroviruses and rhinoviruses alike was not affected by the intergeneric exchange of intact stem loop domains or subfragments thereof described in this study.

All composite IRESes were inserted into a cloning cassette yielding full-length viral cDNA, which was then linearized and used as a template for in vitro transcription (7). Viral RNA thus obtained was transfected into HeLa cells to produce infectious viral particles (7).

Virus propagation, cell culture, and growth curve assays. Viral recombinants were grown and isolated as described previously (7). One-step growth curves in HeLa cells and SK-N-MC neuroblastoma cells were established as follows. Cell monolayers were washed with Dulbecco's minimal essential medium and overlaid with a solution containing the recombinant virus to be tested at an multiplicity of infection of 10. After the dishes were rocked for 30 min at room temperature, the cells were thoroughly washed to remove unbound virus and placed at 37°C. Sample dishes were removed for quantitative assessment of viral reproduction at the specified intervals. Dishes were subjected to three consecutive freeze-thaw cycles, and the lysate was analyzed with a plaque assay as described before (7).

Neurovirulence assays in experimental animals. Neurovirulence testing in CD155 tg mice has been described before (7). For monkey neurovirulence assays, virus strains to be tested were plaque assayed on primary cultured Cynomolgus monkey kidney cells. Cynomolgus monkeys were inoculated intraspinally with 106 50% cell culture infectious doses per ml. Monkeys were sacrificed 17 days after intraspinal inoculation of virus, and the extent and distribution of spinal histopathology were assessed in a series of sections in a manner described before (26). Lesion scores were determined by established procedures (16, 43).


    RESULTS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Neurovirulence of PV1(RIPO) and PV1(RIPOS) in Cynomolgus monkeys. Following the standardized protocols of testing PV Sabin strains (oral PV vaccines) for neurovirulence, we analyzed PV1(RIPO) (Fig. 1B) for its att phenotype by intraspinal inoculation of Cynomolgus monkeys (16, 26, 43). In addition, to assess the possible contribution of the Sabin capsid to attenuation in the PV1(RIPO) background, we constructed a chimeric virus related to PV1(RIPO) in which the coding region for the capsid proteins (P1) was that of PV1(Sabin) [PV1(RIPOS) (Fig. 1C)]. Both PV1(RIPO) and PV1(RIPOS) were highly attenuated, as histopathological analyses revealed lesion scores comparable to those typically associated with PV1(S) (Table 1). Apart from transient minor manifestations in the form of paresis of the foot in two animals, neurological disease did not appear in monkeys that had received intraspinal inocula of either virus (see Materials and Methods). No real differences in the level of attenuation between the two strains were apparent, an observation suggesting that a high degree of attenuation of neurovirulence is attained by the HRV2 IRES alone, without a contribution of the Sabin capsid. These results show that the attenuation of neurovirulence associated with PV carrying an HRV2 IRES, originally observed in CD155 tg mice, extends to primates.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   Neurovirulence testing in Cynomolgus monkeys

Exchanges of domains V and VI of PV and HRV2 IRES elements. Replacement of IRES domains V and VI in PV1(RIPO) with the corresponding domains of PV1(M) yielded a viable virus with a chimeric IRES element [PV1(R2-4) (Fig. 1D)] whose neurovirulence in CD155 tg mice was restored (reference 7 and Fig. 1D). PV1(R2-4) grew with wt kinetics in HeLa and SK-N-MC tissue culture cells (data not shown). The converse recombinant virus PV1(R5-6) (Fig. 1H) expressed the expected phenotype: it was attenuated in transgenic mice (Fig. 1H) and failed to replicate efficiently in neuroblastoma cells (Fig. 2A) but retained efficient growth in HeLa cells (Fig. 2B). These observations suggested that domains V and VI may function independently of domains II to IV or, alternatively, that hypothetical interactions between domains II to IV and domains V and VI have been conserved among IRES elements of enteroviruses and rhinoviruses.


View larger version (17K):
[in this window]
[in a new window]
  		FIG. 2.   One-step growth curves of intergeneric IRES domain recombinants shown in Fig. 1. Growth curves were established as described before (7) in SK-N-MC cells (A) and HeLa cells (B). IRES constructs with intergeneric combined domains V and VI, viruses PV1(R2-4) (+), PV1(R2-4,6) (), PV1(R2-5) (black-triangle), PV1(R5) (), PV1(R5-6) (triangle ), and PV1(R6) (×), failed to drive efficient PV replication in SK-N-MC cells, similar to the degree of growth restriction observed with the intact HRV2 IRES [PV1(RIPO) (open circle )]. Extensive domain swapping barely affected the ability of the recombinant IRES elements to function efficiently in HeLa cells [compare recombinant growth curves with that for PV1(M): (bullet )]. p.i., postinfection.

All of the single point mutations identified in the IRESes of the three Sabin strains that lower neurovirulence map to domain V (see Fig. 4A). It was previously concluded, therefore, that domain V alone may carry the determinants to yield neurovirulence or attenuation (41). We have tested this hypothesis in the context of our intergeneric IRES constructs by exchanging domain V of PV1(RIPO) from HRV2 to the PV1(M) sequence [PV1(R2-4,6) (Fig. 1E)]. Surprisingly, PV1(R2-4,6) did not express a neurovirulent phenotype in transgenic mice (Fig. 1E). Moreover, although growing well in HeLa cells, yielding titers >80% of wt PV1(M) titers (Fig. 2B), PV1(R2-4,6) did not replicate in SK-N-MC cells to titers >0.5% of PV1(M) titers (Fig. 2A). The converse recombinant virus, carrying a PV1(M) IRES of which domain V was changed to that of HRV2 [PV1(R5) (Fig. 1F)], showed a phenotype very similar to that of PV1(R2-4,6) (Fig. 1F and 2). These results can be interpreted to mean that domain V cannot be the sole determinant of neurovirulence or attenuation. We therefore conclude that a coordinate action between domains V and VI is likely to effect growth properties in cells of neuronal derivation and neuropathogenicity.

Analysis of chimeric IRESes suggested that heterologous structural elements of domains V and VI originating from either PV1(M) or HRV2 may be unable to cooperate in an as yet unknown manner in cells of neuronal origin, thereby severely impairing viral growth. This hypothesis was supported by the phenotypes of the converse chimeric viruses PV1(R2-5) and PV1(R6), whose IRESes differed by the nature of domains VI (Fig. 1G and I, respectively). Whereas these exchanges did not affect significantly the growth properties in HeLa cells (Fig. 2B), they greatly decreased replication in neuroblastoma cells (Fig. 2A). Fittingly, neither of these two viruses was neurovirulent in CD155 tg mice (Fig. 1).

Fine mapping of host range determinants in IRES domains V and VI. Overall, the secondary structures of the IRESes of PV1(M) and HRV2 are very similar (21, 29, 34). Closer inspection of domains V and VI of the PV1(M) and HRV2, however, revealed significant differences. First, sequence alignments of these domains, shown in Fig. 3, reveal a high degree of homology in the lower stem regions of these domains, whereas the upper parts of the domains, comprising the region of and surrounding the loops, are quite heterologous (for example, nt 482 to 510 and nt 597 to 616 [Fig. 3]). Second, stem loop VI of HRV2 is slightly longer than that of PV1(M), the former containing a peculiar AU repeat in the extended part of the upper stem (compare Fig. 4B and C). Third, in HRV2, initiation of polyprotein synthesis commences at an AUG just 33 nt downstream of the silent yet absolutely conserved AUG codon, whereas this spacer in PV is 154 nt long (discussed in reference 41).


View larger version (22K):
[in this window]
[in a new window]
  		FIG. 3.   Sequence alignment of IRES domains V and VI of PV1(M) (17) and HRV2 (33). GenBank accession numbers for the sequences used are J02281 for PV1(M) and X02316 for HRV2. The stem loop structures indicated by the superimposed lines are based on published secondary structure calculations, biochemical probing, computational methods, and comparative sequence analysis (21, 29, 34). Shaded areas delineate segments of homology between PV1(M) and HRV2. Note that extensive homology is present between the IRES domains of these virus species in areas forming the ascending and descending lower stems of both domains V (nt 448 to 482 and 510 to 562) and VI (nt 581 to 596), whereas the upper loop regions of domains V (nt 483 to 509) and VI (nt 597 to 606) are characterized by sequence disparity. Roman numerals indicate the major loop structures forming the tips of domains V and VI, respectively (see Fig. 4 for secondary structure). Despite a high degree of conservation of secondary structure in the IRES nt 100 to 580, the architecture of domain VI of HRV2 is different from that of PV1(M) (indicated by upper and lower domain sketches). The AUG codon initiating the HRV2 polyprotein is shown in white letters on black background. The 154-nt-long spacer region between the PV IRES and initiating AUG has been omitted (41). Sequence alignments were generated by using GeneBee-Net (version 1.0. (release 1.1) software.


View larger version (29K):
[in this window]
[in a new window]
  		FIG. 4.   Construction of PV1(M)/HRV2 intradomain chimeras featuring heterologous uppermost regions of domains V and VI linked to the stem structures originating from HRV2 and PV1(M), respectively. Sequences from PV1(M) are shown on a white background; structures derived from HRV2 are boxed in light gray. (A) The 5'NTR of PV1(RIPO) with heterologous distal stem loop structures V and VI derived from PV1(M) yield PV1(rpp). The nucleotide numbering of the PV1(M) IRES was applied to the corresponding HRV2 sequence. Asterisks indicate the positions of single point mutations implicated in the att phenotype of the Sabin vaccine strains (see text). A KpnI endonuclease restriction site introduced for cloning purposes is outlined by a white box. Each dark gray box delineates the position of a silent AUG triplet conserved among all enterovirus and rhinovirus strains. Recombinant IRES A [PV1(rpp)] features the authentic initiating AUG triplet of PV1(M) separated from domain VI by a 154-nt stretch. In construct B, deletion of the 154-nt spacer separating the IRES from the initiating AUG triplet in PV1(rpp) yielded PV1(rpr), creating an AUG codon within an optimal Kozak context (...AnnAUGG...) characteristic of HRV2. For construct C, a synthetic IRES converse to B [PV1(rpr)] was generated by exchanging those nucleotides within the upper stem loop regions of IRES domains V and VI of PV1(M) outlined by light gray boxes with their counterparts from HRV2, yielding PV1(prr).

Based on the results of domain exchanges, we entertained the possibility that sequences within the uppermost regions of domains V and VI may coordinately influence neuropathogenicity. To test this hypothesis, we constructed two genetic variants of PV1(RIPO) that feature PV-specific sequences in these regions [PV1(rpp) and PV1(rpr) (Fig. 4A and B, respectively)]. These viruses differ only in the length of the spacer: PV1(rpp) carries the 154-nt spacer naturally occurring downstream of PV domain VI, which in PV1(rpr) is shortened to 33 nt as in HRV2.

The growth phenotypes of these constructs are shown in Fig. 5. Both recombinant viruses replicated in HeLa cells with growth kinetics similar to those of PV1(M) and PV1(RIPO) (Fig. 5B). Interestingly, exchange of residues within the upper regions of domains V and VI from HRV2 to PV1(M) genotypes restored the tissue tropism characteristic for PV1(M), as both PV1(rpp) and PV1(rpr) replicated in SK-N-MC cells nearly as well as PV1(M) (Fig. 5A). The similarity of growth phenotypes of PV1(rpp) and PV1(rpr) suggested that the nature of the spacer sequence between the silent AUG (Fig. 4) and initiating AUG had little, if any, effect on the growth phenotype. In contrast, a converse viral recombinant, containing HRV2-derived sequences in the upper loop regions of domains V and VI of the PV IRES [construct PV1(prr) (Fig. 5)], suppressed replication in SK-N-MC cells. Exchange of the unconserved nucleotides within certain regions of the PV IRES domains V and VI (Fig. 4C) with their HRV2 counterparts was sufficient to reduce growth kinetics in SK-N-MC cells to the level found for PV1(RIPO) (Fig. 5).


View larger version (14K):
[in this window]
[in a new window]
  		FIG. 5.   Growth characteristics of PV1(rpr) (), PV1(rpp) (), and PV1(prr) (×) in HeLa cells and SK-N-MC cells compared to one-step growth curves of PV1(M) (bullet ) and PV1(RIPO) (open circle ). Growth curves established in SK-N-MC neuroblastoma cells (A) and HeLa cells (B) demonstrate cell-specific growth capacities exhibited by different IRES recombinants. All viruses replicated with equal efficiency in HeLa cells. Propagation of PV1(RIPO) in SK-N-MC cells is exceedingly poor. Replacing nucleotide sequences of PV1(M) within the upper loop regions of domains V and VI in an HRV2 background [PV1(rpp) and PV1(rpr)] restored neurovirulence, indicated by their wt growth characteristics in cells of neuronal derivation. The converse recombinant virus of PV1(rpr), containing HRV2 sequences in the uppermost regions of domain V and VI within a PV1(M) IRES [PV1(prr)], was unable to efficiently replicate in neuroblastoma cell lines, underlining the critical importance for cooperative function of stem loops V and VI in the determination of a neurovirulent phenotype of PV. p.i., postinfection.

We then tested PV1(rpp), PV1(rpr), and PV1(prr) in CD155 tg mice for neurovirulence. As anticipated from the growth properties in human neuroblastoma cells, both PV1(rpp) and PV1(rpr) expressed the neurovirulence phenotype, the 50% lethal dose (LD50) being slightly larger than with the parental wt virus, regardless of whether the isolates were administered intravenously or intracerebrally (Table 2). Accordingly, PV1(prr), carrying HRV2 sequences within critical regions of domains V/VI, lacked neurovirulent potential (Table 2). We conclude that the determinants for tropism for cells of neuronal origin, and neurovirulence in experimental animals, map to two specific regions in the IRES domains V and VI of PV.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 2.   Neurovirulent indices of PV/HRV2 chimeras in CD155 tg mice


    DISCUSSION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

IRES elements are arguably the most complex recognition signals known to be present on viral RNA genomes (41). Between 300 to 400 nt long, they contain many more bits of structural information than would seem necessary to attract ribosomal subunits and direct them to the proper initiation codon of translation (42). Although much work has been published since their discovery (14, 15, 24, 27), the mechanism of internal initiation of translation mediated by IRESes remains largely obscure (13). One of the perplexing properties of IRES elements is that different IRES elements function in very similar fashions despite an apparent lack of structural homology. Such differences are particularly striking when the PV IRES is compared with the IRES of encephalomyocarditis virus or hepatitis C virus. The assertion of similar functions in diverse genetic backgrounds, however, has been based solely on assays with artificial dicistronic mRNAs first constructed by Jang et al. (14), with dicistronic (24) or chimeric viruses (2), that were expressed either by cell-free translation or after transfection in tumor cell lines (13). Tissue-dependent restriction of IRES function in experimental animals, on the other hand, has been observed so far only with the PV chimera PV1(RIPO) in CD155 tg mice (7).

The phenotype of impaired growth of PV(RIPO) in human neuroblastoma cells or in CD155 tg mice is surprising because the IRES elements of PV and HRV2 are very closely related in structure. PV and HRV2, two picornaviruses belonging to related genera Enterovirus and Rhinovirus, respectively, have very similar genotypes and almost identical strategies of replication (11, 30). Indeed, among the IRESes of all picornaviruses, those of entero- and rhinoviruses have been classified into a single group, called type 1 IRESes (41).

The host cell restriction of PV1(RIPO) is apparent not only in CD155 tg mice or in a human neuronal tumor cell line (SK-N-MC) but also in primates, using standard protocols for poliovirus neurovirulence (Table 1). This is an important result because it shows that the mouse model is adequate to map IRES components influencing the neurovirulent phenotype. PV1(RIPO) is a chimera consisting of wt genetic elements of two picornaviruses. Remarkably, PV1(RIPO) proliferates in HeLa cells with the kinetics of the highly neurovirulent strain PV1(M), yet in the highly sensitive test of spinal cord damage in nonhuman primates (lesion scores), it has scored better than the currently used attenuated vaccine strain Sabin type 1.

Our analysis of genetic determinants within the HRV2 IRES responsible for the phenotype of PV1(RIPO) led to the construction of PV/HRV2 IRES chimeras. To our knowledge, this approach has not been taken before, and it was risky because the strategy required changes of primary sequences of the parental cis-acting RNA elements. Such changes could have abolished IRES function. For example, our original attempts to insert restriction sites into a single-stranded sequence (UCCUCC) linking domains IV and V of poliovirus yielded nonviable viruses (data not shown). While our studies were in progress, we learned from the work by Belov et al. (3) that for unknown reasons, the integrity of this sequence is essential for PV IRES function. Furthermore, it seems likely that different domains within an IRES element form tertiary interactions with each other (19). As an assay for the function of IRES chimeras in viral replication in HeLa cells, we have used a carcinoma cell line most commonly used for proliferation of PV. The focus of the study, however, was on a correlation between IRES structure and neurovirulence.

Most of the PVs with chimeric IRESes depicted in Fig. 1 and 4 replicated in HeLa cells with kinetics similar to that of wt PV at physiological temperature, and they yielded viral progeny in the range of 90 to 20% of PV1(M) (Fig. 2). These results demonstrated that exchanges of IRES domains V and/or VI between PV and HRV2 did not yield lethal phenotypes, an observation suggesting that the sequences that differ in these domains between PV and HRV2 (Fig. 3) do not participate in essential tertiary interactions with other upstream domains.

The spacer sequence between the conserved AUG (Fig. 4) and the initiating AUG had little, if any, influence on replication in tissue culture cells or on the neurovirulence phenotype, regardless of whether assayed in the context of a PV or HRV2 domain VI (Fig. 5). This observation, reported also previously for different viruses (35), was important for our neurovirulence tests, since we constructed chimeric viruses that initiated polyprotein synthesis 154 nt downstream of the conserved AUG, as in PV, or 33 nt downstream from the conserved AUG, as in rhinovirus.

Of all the IRES chimeras shown in Fig. 1, only construct D was neurovirulent in CD155 tg mice. This came as a surprise, as we had anticipated that the attenuating locus of PV1(RIPO) may reside in domain V, just as in the attenuated Sabin strains of PV vaccines where attenuating mutations have been mapped to domain V only (Fig. 4 and reference 40). However, recombinant virus E was also highly attenuated. On the other hand, a PV IRES of which domain V was exchanged to that of HRV2 (construct F) was also highly attenuated, just as IRES hybrid I, in which only domain VI was exchanged to HRV2. These observations strongly suggested that both domains V and VI of PV are required to produce a neurovirulent phenotype in CD155 tg mice. It appears, therefore, that specific sequences within domains V and VI are coordinately responsible for the neurovirulent phenotype of PV.

Comparison of the primary sequences of domains V and VI of PV1(M) and HRV2 reveals characteristic differences (Fig. 3). These appear to cluster predominantly to nucleotides in the upper portion of domains V and VI and to the length of domain VI. Starting with PV1(RIPO), the exchange of 13 nt in HRV2 domain V to corresponding nucleotides of PV1(M), together with the construction of a domain VI resembling that of PV1(M), yielded a derivative PV1(rpr) (Fig. 4B) with a tissue tropism phenotype similar to that of PV1(M) (Fig. 5). PV1(rpr) was highly neurovirulent in CD155 tg mice (Table 2). A similar recombinant virus in which the spacer was extended to that of PV [construct PV1(rpp) (Fig. 4A)] had properties similar to those of PV1(rpr) (Fig. 5; Table 2), an observation confirming that the spacer is of little consequence to the observed phenotypes.

As the exchange of few nucleotides in HRV2 domains V and VI with those of PV1(M) produced efficient replication in SK-N-MC cells and neurovirulence in CD155 tg mice, the reverse recombinant yielded the opposite phenotypes. PV1(prr) (Fig. 4C), in which the corresponding nucleotides of the PV1(M) V/VI domains were exchanged with those of HRV2, was attenuated, expressing a replication phenotype in SK-N-MC cells and neurovirulence potential in CD155 tg mice equal to those of PV1(RIPO). These data leave no doubt that neurovirulence of PV1(RIPO) can be restored through specific regions of domains V and VI.

What is the mechanism leading to the observed phenotypes? Preliminary evidence suggests that PV1(RIPO) RNA can be translated in cell extracts of SK cells, albeit with efficiency three- to fourfold lower than that for PV1(M) (24a). A mutation in domain V of PV1(M) was recently reported to result in reduced translation efficiency in a neuronal cell extract (9), but this study was not followed up with neurovirulence tests in experimental animals. RNA of a luciferase-expressing derivative of PV1(RIPO) (in which the P1 coding region was exchanged with the luciferase ORF) yielded a luciferase signal on transfection into SK-N-MC cells. Again, the signal was reduced in comparison to PV1(M) (24a). Thus, diminished translational efficiency in cells of neuronal origin may not be the sole reason for the observed phenotype of PV1(RIPO).

The requirement of domains V/VI for neurovirulence in the chimeric viruses seems to indicate that these domains are engaged in IRES function under the specific circumstances of proliferation in the central nervous system. This conclusion is supported by reports that the removal of the entire domain VI resulted in attenuation in monkeys (12) or in mice (35). The latter experiments used a specific PV1(M) constructed to produce neurovirulence in wt mice (25). It is important to note that even construct I was attenuated. Thus, the presence of HRV2 domain VI diminished expression in SK cells and abrogated neurovirulence in CD155 tg mice. Chimeric IRESes, therefore, may express phenotypes distinct from those observed in wt mice with some deletion or insertion mutants of PV1 (35).

It is possible that domains V and VI bind specifically factors involved in IRES function and that these factors are either modified or in short supply in neuronal cells. Synergy of domains V and VI in binding of cellular proteins in cell extracts has been observed (8), but whether these effects relate to the observation of the remarkable tissue tropism reported here remains to be seen.


    ACKNOWLEDGMENTS

We thank D. Blaas, Vienna, Austria, for kindly providing an infectious cDNA clone of HRV2.

This work was supported in part by NIH grants RO1AI32100 and RO1AI39485.


    FOOTNOTES

* Corresponding author. Mailing address: Dept. of Molecular Genetics and Microbiology, State University of New York at Stony Brook, Stony Brook, NY 11794. Phone: (516) 632-8806. Fax: (516) 632-8891. E-mail: gromeier{at}asterix.bio.sunysb.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Agol, V. I., S. G. Drozdov, T. A. Ivannikova, M. S. Kolesnikova, M. B. Korolev, and E. A. Tolskaya. 1989. Restricted growth of attenuated poliovirus strains in cultured cells of a human neuroblastoma. J. Virol. 63:4034-4038[Abstract/Free Full Text].
2. Alexander, L., H. H. Lu, and E. Wimmer. 1994. Polioviruses containing picornavirus type 1 and/or type 2 IRES elements: genetic hybrids and the expression of a foreign gene. Proc. Natl. Acad. Sci. USA 91:1406-1410[Abstract/Free Full Text].
3. Belov, G. A., A. P. Gmyl, S. V. Maslova, E. V. Pilipenko, and V. I. Agol. 1995. The critical significance of a conserved single-stranded interdomain linker in the 5'-untranslated region of poliovirus RNA. Mol. Biol. (Moscow) 29:294-300.
4. Bodian, D. 1972. Poliomyelitis, p. 2323-2344. In J. Minckler (ed.), Pathology of the nervous system. McGraw-Hill, New York, N.Y.
5. Bouchard, M. J., D. H. Lam, and V. R. Racaniello. 1995. Determinants of attenuation and temperature sensitivity in the type 1 poliovirus Sabin vaccine. J. Virol. 69:4972-4978[Abstract].
6. Evans, D. M., G. Dunn, P. D. Minor, G. C. Schild, A. J. Cann, G. Stanway, J. W. Almond, K. Currey, and J. V. Maizel. 1985. Increased neurovirulence associated with a single nucleotide change in a noncoding region of the Sabin type 3 poliovaccine genome. Nature 314:548-550[Medline].
7. Gromeier, M., L. Alexander, and E. Wimmer. 1996. Internal ribosomal entry site substitution eliminates neurovirulence in intergeneric poliovirus recombinants. Proc. Natl. Acad. Sci. USA 93:2370-2375[Abstract/Free Full Text].
8. Haller, A., and B. Semler. 1995. Stem-loop structure synergy in binding cellular proteins to the 5' noncoding region of poliovirus RNA. Virology 206:923-934[Medline].
9. Haller, A., S. R. Stewart, and B. L. Semler. 1996. Attenuation stem-loop lesions in the 5' noncoding region of poliovirus RNA: neuronal cell-specific translation defects. J. Virol. 70:1467-1474[Abstract].
10. Hellen, C. U., T. V. Pestova, and E. Wimmer. 1994. Effect of mutations downstream of the internal ribosomal entry site on initiation of poliovirus protein synthesis. J. Virol. 68:6312-6322[Abstract/Free Full Text].
11. Hyypia, T., T. Hovi, N. Knowles, and G. Stanway. 1997. Classification of enteroviruses based on molecular and biological properties. J. Gen. Virol. 78:1-11[Medline].
12. Iizuka, N., H. Yonekawa, and A. Nomoto. 1991. Nucleotide sequences important for translation initiation of enterovirus RNA. J. Virol. 65:4867-4873[Abstract/Free Full Text].
13. Jackson, R. J., and A. Kaminski. 1995. Internal initiation of translation in eukaryotes: the picornavirus paradigm and beyond. RNA 1:985-1000[Medline].
14. Jang, S. K., H. G. Kräusslich, M. J. H. Nicklin, G. M. Duke, A. C. Palmenberg, and E. Wimmer. 1988. A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J. Virol. 62:2636-2643[Abstract/Free Full Text].
15. Jang, S. K., M. V. Davies, R. J. Kaufman, and E. Wimmer. 1989. Initiation of protein synthesis by internal entry of ribosomes into the 5' nontranslated region of encephalomyocarditis virus RNA in vitro. J. Virol. 63:1651-1660[Abstract/Free Full Text].
16. Kawamura, N., M. Kohara, S. Abe, T. Komatsu, K. Tago, M. Arita, and A. Nomoto. 1989. Determinants in the 5' noncoding region of poliovirus Sabin 1 RNA that influence the attenuation phenotype. J. Virol. 63:1302-1309[Abstract/Free Full Text].
17. Kitamura, N., B. L. Semler, P. G. Rothberg, G. R. Larsen, C. J. Adler, A. J. Dorner, E. A. Emini, R. Hanecak, J. Lee, S. van der Werf, C. W. Anderson, and E. Wimmer. 1981. Primary structure, gene organization and polypeptide expression of poliovirus RNA. Nature 291:547-553[Medline].
18. Koike, S., C. Taya, T. Kurata, S. Abe, I. Ise, H. Yonekawa, and A. Nomoto. 1991. Transgenic mice susceptible to poliovirus. Proc. Natl. Acad. Sci. USA 88:951-955[Abstract/Free Full Text].
19. Kuge, S., and A. Nomoto. 1987. Construction of viable deletion and insertion mutants of the Sabin strain of type 1 poliovirus: function of the 5' noncoding sequence in viral replication. J. Virol. 61:1478-1487[Abstract/Free Full Text].
20. La Monica, N., and V. R. Racaniello. 1989. Differences in replication of attenuated and neurovirulent poliovirus in human neuroblastoma cell line SH-SY5Y. J. Virol. 63:2357-2360[Abstract/Free Full Text].
21. Le, S. Y., J. H. Chen, N. Sonenberg, and J. V. Maizel. 1992. Conserved tertiary structure elements in the 5' untranslated region of human enteroviruses and rhinoviruses. Virology 191:858-866[Medline].
22. Lu, H. H., and E. Wimmer. 1996. Poliovirus chimeras replicating under the translational control of genetic elements of hepatitis C virus reveal unusual properties of the internal ribosomal entry site of hepatitis C virus. Proc. Natl. Acad. Sci. USA 93:1412-1417[Abstract/Free Full Text].
23. McGoldrick, A., A. J. Macadam, G. Dunn, A. Rowe, J. Burlison, P. D. Minor, J. Meredith, D. J. Evans, and J. W. Almond. 1995. Role of mutations G-480 and C-6203 in the attenuation phenotype of Sabin type 1 poliovirus. J. Virol. 69:7601-7605[Abstract].
24. Molla, A., S. K. Jang, A. V. Paul, Q. Reuer, and E. Wimmer. 1992. Cardioviral internal ribosomal entry site is functional in a genetically engineered dicistronic poliovirus. Nature 356:255-257[Medline].
24a. Muellen, S., and E. Wimmer. Unpublished results.
25. Murray, M. G., J. Bradley, X. F. Yang, E. Wimmer, E. G. Moss, and V. R. Racaniello. 1988. Poliovirus host range is determined by a short amino acid sequence in neutralization antigenic site I. Science 241:213-215[Abstract/Free Full Text].
26. Omata, T., M. Kohara, S. Kuge, T. Komatsu, S. Abe, B. L. Semler, A. Kameda, H. Itoh, M. Arita, and E. Wimmer. 1986. Genetic analysis of the attenuation phenotype of poliovirus type 1. J. Virol. 58:348-358[Abstract/Free Full Text].
27. Pelletier, J., and N. Sonenberg. 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334:320-325[Medline].
28. Pilipenko, E. V., V. M. Blinov, B. K. Chernov, T. M. Dmitrieva, and V. I. Agol. 1989. Conservation of the secondary structure elements of the 5'-untranslated region of cardio- and aphthovirus RNAs. Nucleic Acids Res. 17:5701-5711[Abstract/Free Full Text].
29. Pilipenko, E. V., V. M. Blinov, L. I. Romanova, A. N. Sinyakov, S. V. Maslova, and V. I. Agol. 1989. Conserved structural domains in the 5'-untranslated region of picornaviral genomes: an analysis of the segment controlling translation and neurovirulence. Virology 168:201-209[Medline].
30. Rodrigo, M. J., and J. Dopazo. 1995. Evolutionary analysis of the picornavirus family. J. Mol. Evol. 40:362-371[Medline].
31. Sabin, A. 1956. Poliomyelitis. Science 123:1151-1157[Free Full Text].
32. Sabin, A., and L. Boulger. 1973. History of Sabin attenuated poliovirus oral live vaccine strains. J. Biol. Stand. 1:115-118.
33. Skern, T., W. Sommergruber, D. Blaas, P. Gruendler, F. Fraundorfer, C. Pieler, I. Fogy, and E. Kuechler. 1985. Human rhinovirus 2: complete nucleotide sequence and proteolytic processing signals in the capsid protein region. Nucleic Acids Res. 13:2111-2126[Abstract/Free Full Text].
34. Skinner, M. A., V. R. Racaniello, G. Dunn, J. Cooper, P. D. Minor, and J. W. Almond. 1989. New model for the secondary structure of the 5' non-coding RNA of poliovirus is supported by biochemical and genetic data that also shows that RNA secondary structure is important in neurovirulence. J. Mol. Biol. 207:379-392[Medline].
35. Slobodskaya, O. R., A. P. Gmyl, S. V. Maslova, E. A. Tolskaya, E. G. Viktorova, and V. I. Agol. 1996. Poliovirus neurovirulence correlates with the presence of a cryptic AUG upstream of the initiator codon. Virology 221:141-150[Medline].
36. Svitkin, Y. V., S. V. Maslova, and V. I. Agol. 1985. The genomes of attenuated and virulent poliovirus strains differ in their in vitro translation efficiencies. Virology 147:243-252[Medline].
37. Svitkin, Y. V., T. Pestova, S. V. Maslova, and V. I. Agol. 1988. Point mutations modify the response of poliovirus RNA to a translation initiation factor: a comparison of neurovirulent and attenuated strains. Virology 166:394-404[Medline].
38. Svitkin, Y. V., N. Cammack, P. D. Minor, and J. W. Almond. 1990. Translation deficiency of the Sabin type 3 poliovirus genome: association with an attenuating mutation C472-U. Virology 175:103-109[Medline].
39. Tsukiyama-Kohara, K., N. Iizuka, M. Kohara, and A. Nomoto. 1992. Internal ribosome entry site within hepatitis C virus RNA. J. Virol. 66:1476-1483[Abstract/Free Full Text].
40. Wimmer, E., C. U. T. Hellen, and X. M. Cao. 1993. Genetics of poliovirus. Annu. Rev. Genet. 27:353-436[Medline].
41. Wimmer, E. (ed.). 1997. Seminars in virology, vol. 8. Academic Press, Oxford, England.
42. Witherell, G., and E. Wimmer. 1993. Cap-independent translation of picornavirus mRNAs, p. 237-247. In W. Doerfler, and P. Boehn (ed.), Virus strategies. Verlag Chemie, Weinheim, Germany.
43. World Health Organization. 1983. Requirements for poliomyelitis vaccine (oral). WHO expert committee on biological standardization. Annex 4. Tech. Rep. Ser. 687:130-133.

Journal of Virology, February 1999, p. 958-964, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • de Breyne, S., Yu, Y., Unbehaun, A., Pestova, T. V., Hellen, C. U. T. (2009). Direct functional interaction of initiation factor eIF4G with type 1 internal ribosomal entry sites. Proc. Natl. Acad. Sci. USA 106: 9197-9202 [Abstract] [Full Text]  
  • Jiang, Y., Langley, B., Lubin, F. D., Renthal, W., Wood, M. A., Yasui, D. H., Kumar, A., Nestler, E. J., Akbarian, S., Beckel-Mitchener, A. C. (2008). Epigenetics in the Nervous System. J. Neurosci. 28: 11753-11759 [Abstract] [Full Text]  
  • Arita, M., Nagata, N., Iwata, N., Ami, Y., Suzaki, Y., Mizuta, K., Iwasaki, T., Sata, T., Wakita, T., Shimizu, H. (2007). An Attenuated Strain of Enterovirus 71 Belonging to Genotype A Showed a Broad Spectrum of Antigenicity with Attenuated Neurovirulence in Cynomolgus Monkeys. J. Virol. 81: 9386-9395 [Abstract] [Full Text]  
  • de Sessions, P. F., Dobrikova, E., Gromeier, M. (2007). Genetic Adaptation to Untranslated Region-Mediated Enterovirus Growth Deficits by Mutations in the Nonstructural Proteins 3AB and 3CD. J. Virol. 81: 8396-8405 [Abstract] [Full Text]  
  • Toyoda, H., Yin, J., Mueller, S., Wimmer, E., Cello, J. (2007). Oncolytic Treatment and Cure of Neuroblastoma by a Novel Attenuated Poliovirus in a Novel Poliovirus-Susceptible Animal Model. Cancer Res. 67: 2857-2864 [Abstract] [Full Text]  
  • Campbell, S. A., Mulvey, M., Mohr, I., Gromeier, M. (2007). Attenuation of Herpes Simplex Virus Neurovirulence with Picornavirus cis-Acting Genetic Elements. J. Virol. 81: 791-799 [Abstract] [Full Text]  
  • Macadam, A. J., Ferguson, G., Stone, D. M., Meredith, J., Knowlson, S., Auda, G., Almond, J. W., Minor, P. D. (2006). Rational design of genetically stable, live-attenuated poliovirus vaccines of all three serotypes: relevance to poliomyelitis eradication.. J. Virol. 80: 8653-8663 [Abstract] [Full Text]  
  • Merrill, M. K., Gromeier, M. (2006). The Double-Stranded RNA Binding Protein 76:NF45 Heterodimer Inhibits Translation Initiation at the Rhinovirus Type 2 Internal Ribosome Entry Site. J. Virol. 80: 6936-6942 [Abstract] [Full Text]  
  • Merrill, M. K., Dobrikova, E. Y., Gromeier, M. (2006). Cell-Type-Specific Repression of Internal Ribosome Entry Site Activity by Double-Stranded RNA-Binding Protein 76.. J. Virol. 80: 3147-3156 [Abstract] [Full Text]  
  • Kauder, S., Kan, S., Racaniello, V. R. (2006). Age-Dependent Poliovirus Replication in the Mouse Central Nervous System Is Determined by Internal Ribosome Entry Site-Mediated Translation. J. Virol. 80: 2589-2595 [Abstract] [Full Text]  
  • DeJesus, N., Franco, D., Paul, A., Wimmer, E., Cello, J. (2005). Mutation of a Single Conserved Nucleotide between the Cloverleaf and Internal Ribosome Entry Site Attenuates Poliovirus Neurovirulence. J. Virol. 79: 14235-14243 [Abstract] [Full Text]  
  • Rattiner, L. M., Davis, M., Ressler, K. J. (2005). Brain-Derived Neurotrophic Factor in Amygdala-Dependent Learning. Neuroscientist 11: 323-333 [Abstract]  
  • Harvala, H., Kalimo, H., Bergelson, J., Stanway, G., Hyypia, T. (2005). Tissue tropism of recombinant coxsackieviruses in an adult mouse model. J. Gen. Virol. 86: 1897-1907 [Abstract] [Full Text]  
  • Campbell, S. A., Lin, J., Dobrikova, E. Y., Gromeier, M. (2005). Genetic Determinants of Cell Type-Specific Poliovirus Propagation in HEK 293 Cells. J. Virol. 79: 6281-6290 [Abstract] [Full Text]  
  • Wahid, R., Cannon, M. J., Chow, M. (2005). Dendritic Cells and Macrophages Are Productively Infected by Poliovirus. J. Virol. 79: 401-409 [Abstract] [Full Text]  
  • Rattiner, L. M., Davis, M., Ressler, K. J. (2004). Differential regulation of brain-derived neurotrophic factor transcripts during the consolidation of fear learning. Learn. Mem. 11: 727-731 [Abstract] [Full Text]  
  • Merrill, M. K., Bernhardt, G., Sampson, J. H., Wikstrand, C. J., Bigner, D. D., Gromeier, M. (2004). Poliovirus receptor CD155-targeted oncolysis of glioma. Neuro Oncol Duke 6: 208-217 [Abstract]  
  • Dobrikova, E., Florez, P., Bradrick, S., Gromeier, M. (2003). Activity of a type 1 picornavirus internal ribosomal entry site is determined by sequences within the 3' nontranslated region. Proc. Natl. Acad. Sci. USA 100: 15125-15130 [Abstract] [Full Text]  
  • Yanagiya, A., Ohka, S., Hashida, N., Okamura, M., Taya, C., Kamoshita, N., Iwasaki, K., Sasaki, Y., Yonekawa, H., Nomoto, A. (2003). Tissue-Specific Replicating Capacity of a Chimeric Poliovirus That Carries the Internal Ribosome Entry Site of Hepatitis C Virus in a New Mouse Model Transgenic for the Human Poliovirus Receptor. J. Virol. 77: 10479-10487 [Abstract] [Full Text]  
  • Ochs, K., Zeller, A., Saleh, L., Bassili, G., Song, Y., Sonntag, A., Niepmann, M. (2002). Impaired Binding of Standard Initiation Factors Mediates Poliovirus Translation Attenuation. J. Virol. 77: 115-122 [Abstract] [Full Text]  
  • Harvala, H., Kalimo, H., Dahllund, L., Santti, J., Hughes, P., Hyypia, T., Stanway, G. (2002). Mapping of tissue tropism determinants in coxsackievirus genomes. J. Gen. Virol. 83: 1697-1706 [Abstract] [Full Text]  
  • Ochs, K., Saleh, L., Bassili, G., Sonntag, V. H., Zeller, A., Niepmann, M. (2002). Interaction of Translation Initiation Factor eIF4B with the Poliovirus Internal Ribosome Entry Site. J. Virol. 76: 2113-2122 [Abstract] [Full Text]  
  • Bradrick, S. S., Lieben, E. A., Carden, B. M., Romero, J. R. (2001). A Predicted Secondary Structural Domain within the Internal Ribosome Entry Site of Echovirus 12 Mediates a Cell-Type-Specific Block to Viral Replication. J. Virol. 75: 6472-6481 [Abstract] [Full Text]  
  • Zhao, W. D., Lahser, F. C., Wimmer, E. (2000). Genetic Analysis of a Poliovirus/Hepatitis C Virus (HCV) Chimera: Interaction between the Poliovirus Cloverleaf and a Sequence in the HCV 5' Nontranslated Region Results in a Replication Phenotype. J. Virol. 74: 6223-6226 [Abstract] [Full Text]  
  • Gale, M. Jr., Tan, S.-L., Katze, M. G. (2000). Translational Control of Viral Gene Expression in Eukaryotes. Microbiol. Mol. Biol. Rev. 64: 239-280 [Abstract] [Full Text]  
  • Schneider-Schaulies, J. (2000). Cellular receptors for viruses: links to tropism and pathogenesis. J. Gen. Virol. 81: 1413-1429 [Full Text]  
  • Dunn, J. J., Chapman, N. M., Tracy, S., Romero, J. R. (2000). Genomic Determinants of Cardiovirulence in Coxsackievirus B3 Clinical Isolates: Localization to the 5' Nontranslated Region. J. Virol. 74: 4787-4794 [Abstract] [Full Text]  
  • Crotty, S., Lohman, B. L., Lu, F. X.-S., Tang, S., Miller, C. J., Andino, R. (1999). Mucosal Immunization of Cynomolgus Macaques with Two Serotypes of Live Poliovirus Vectors Expressing Simian Immunodeficiency Virus Antigens: Stimulation of Humoral, Mucosal, and Cellular Immunity. J. Virol. 73: 9485-9495 [Abstract] [Full Text]  
  • Kew, O., Morris-Glasgow, V., Landaverde, M., Burns, C., Shaw, J., Garib, Z., Andre, J., Blackman, E., Freeman, C. J., Jorba, J., Sutter, R., Tambini, G., Venczel, L., Pedreira, C., Laender, F., Shimizu, H., Yoneyama, T., Miyamura, T., van der Avoort, H., Oberste, M. S., Kilpatrick, D., Cochi, S., Pallansch, M., de Quadros, C. (2002). Outbreak of Poliomyelitis in Hispaniola Associated with Circulating Type 1 Vaccine-Derived Poliovirus. Science 296: 356-359 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gromeier, M.
Right arrow Articles by Wimmer, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gromeier, M.
Right arrow Articles by Wimmer, E.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»