Previous Article | Next Article 
Journal of Virology, February 1999, p. 948-957, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Effects of 3' Untranslated Region Mutations on Plus-Strand
Priming during Moloney Murine Leukemia Virus Replication
Nicole D.
Robson and
Alice
Telesnitsky*
Department of Microbiology and Immunology and
Comprehensive Cancer Center, University of Michigan Medical School,
Ann Arbor, Michigan 48109-0620
Received 30 July 1998/Accepted 21 October 1998
 |
ABSTRACT |
A conserved purine-rich motif located near the 3' end of retroviral
genomes is involved in the initiation of plus-strand DNA synthesis. We
mutated sequences both within and flanking the Moloney murine leukemia
virus polypurine tract (PPT) and determined the effects of these
alterations on viral DNA synthesis and replication. Our results
demonstrated that both changes in highly conserved PPT positions and a
mutation that left only the cleavage-proximal half of the PPT intact
led to delayed replication and reduced the colony-forming titer of
replication defective retroviral vectors. A mutation that altered the
cleavage proximal half of the PPT and certain 3' untranslated region
mutations upstream of the PPT were incompatible with or severely
impaired viral replication. To distinguish defects in plus-strand
priming from other replication defects and to assess the relative use
of mutant and wild-type PPTs, we examined plus-strand priming from an
ectopic, secondary PPT inserted in U3. The results demonstrated that
the analyzed mutations within the PPT primarily affected plus-strand
priming whereas mutations upstream of the PPT appeared to affect both plus-strand priming and other stages of viral replication.
 |
INTRODUCTION |
Retroviral reverse transcription
generates a double-stranded DNA copy of the single-stranded viral RNA
genome. The primer used to initiate plus-strand DNA synthesis is a
nucleolytic product of the viral genomic RNA. During minus-strand
synthesis, the RNase H activity of reverse transcriptase (RT) degrades
much of the genomic RNA as it forms an RNA-DNA duplex. However, the
polypurine tract (PPT) fragment persists. The PPT's protection from
degradation and subsequent selection as the plus-strand primer require
high degrees of molecular specificity (6).
All retroviral PPT regions are purine rich, but their composition
differs from virus to virus. In Fig. 1,
we aligned sequences of retrovirus and retroelement PPT regions. As in
previous reports (34),
1 is defined as the nucleotide 5'
of the primer cleavage site. Among sequences in this compilation, the
4 position is 93% conserved and the
2 position is 86% conserved.
Similar conservation for these positions is apparent in other PPT
compilations (34), but PPT conservation is less pronounced
in some retroviruses than others. For example, in spleen necrosis
virus, the PPT itself differs significantly from the consensus
(43), and a conserved T stretch whose presence upstream of
many retroviral PPTs has previously been noted (31) is
absent from caprine arthritis-encephalitis virus (37). Based
on PPT length and a prominent oligoribonucleotide that primes
plus-strand synthesis in vitro, we will consider the Moloney murine
leukemia virus (M-MuLV) PPT to span from
1 through
13
(35).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
Retroviral and retroelement PPT region sequences.
Sequences were aligned by plus-strand primer cleavage site as indicated
by the vertical line. The M-MuLV PPT is shaded; consensus bases greater
than 75% conserved are shown in bold. Sequences are from M-MuLV
(44), avian leukosis virus (ALV) (1), HIV
(33), feline leukemia virus (FeLV) (9), human
adult T-cell leukemia virus (HTLV) (42), mouse mammary tumor
virus (MMTV) (26), Mason-Pfizer monkey virus (MPMV)
(45), Rous sarcoma virus (RSV) (40), SIV
(16), simian retrovirus type 1 (SRV) (32), mouse
virus-like retrotransposon BVL-1 (VL30) (18), mouse
intracisternal A-Particle (IAP) (19), caprine
arthritis-encephalitis virus (CAEV) (37), and spleen
necrosis virus (SNV) (43).
|
|
Early evidence for the role of the PPT region in plus-strand priming
comes from the work of Sorge and Hughes (46), who showed that at least 9 and no more than 29 nucleotides upstream of the avian
sarcoma virus (ASV) long terminal repeat (LTR) are required in
cis for viral replication. Most subsequent plus-strand
priming studies have been performed with model substrates or in
permeabilized virions rather than during viral replication.
Rattray and Champoux made point mutations in the M-MuLV PPT and
found that sequences downstream of the PPT have no detectable effect on
priming specificity in model reactions, but that mutations at
1,
2,
4, and
7 cause additional cleavage sites (34). Powell
and Levin have shown that only the six G residues at the PPT 3' end
(that is,
1 through
6) are necessary for human immunodeficiency
virus type 1 (HIV) plus-strand priming in model reactions
(31). In those studies, plus-strand priming was the same
with the PPT in two different sequence contexts on short primer
templates, thus suggesting that sequences around the PPT do not affect
plus-strand priming.
Here, we developed a system to examine the extent to which sequences
within the PPT that alter priming in model reactions contribute to this
process during virus replication. We also examined the roles of
sequences upstream of the PPT which contact RT during plus-strand
primer generation. Targeted alterations in both highly conserved
regions within the M-MuLV PPT and in upstream regions were made, and
the effects of these mutations on viral replication and on plus-strand
priming were examined. Our results confirmed the importance of
sequences within the PPT and also demonstrated that sequences upstream
of the PPT were important for plus-strand priming. These 3'
untranslated region (3' UTR) sequences upstream of the PPT appeared to
function in other stages of viral replication as well.
 |
MATERIALS AND METHODS |
Plasmid construction.
3' UTR mutations were introduced into
a M-MuLV provirus plasmid and into a plasmid encoding a puromycin
resistance (Puror)-conferring replication-defective
retroviral vector. The proviral plasmids were derivatives of pNR163-4
or pMLV-neo. pNR163-4 is a derivative of a "tipless" M-MuLV plasmid
(22) which encodes intact M-MuLV RNA. pNR163-4 contains a
silent mutation that introduces an MfeI site in
env at M-MuLV position 7746. pMLV-neo contains the neomycin
resistance Neor gene in the backbone of a provirus plasmid.
An EcoRI-to-XbaI fragment containing the
Neor gene plus the PGK promoter and
polyadenylation signals from a pPNT derivative (53) was
subcloned into pNCA (8). The drug resistance gene is
transcribed opposite from the M-MuLV LTR and is not incorporated into
viral transcripts (Fig. 2A). Retroviral vectors were derivatives of pAM86-5 (22) (Fig. 2B). 3' UTR
mutations were introduced by using PCR-mediated site-directed
mutagenesis and other standard recombinant DNA techniques. Sequences of
all 3' UTR regions from the end of env through early in U3
were confirmed by dideoxy sequencing using a Sequenase II kit (U.S.
Biochemical).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Structures of proviral clones and retroviral vectors.
(A) Proviral clones. Single PPT mutations were introduced into
pNR163-4, and tandem PPT mutations were introduced into pMLV-neo.
Direction of Neor transcription is indicated with an arrow.
attwt, wild-type att site. (B) pAM86-5, the retroviral
vector into which PPT mutations were introduced. The direction of
Puror transcription is indicated with an arrow. (C)
Structures and predicted products of tandem-PPT constructs. The
inserted secondary PPT, designated PPT2, and mutated att
(attmut) at the 5' end of U3 are indicated. The first line
indicates the structure of the transfected proviral constructs, the
second line represents the structure of encapsidated RNAs, and the
final lines represent the two kinds of reverse transcription products
templated by tandem-PPT RNAs. Note that PPT regions are shown as
disproportionately large to present detail important to this study.
Primer extension products used to analyze PPT use (Fig. 8 and Table 3)
are represented with gray dashed arrows.
|
|
Tandem-PPT constructs contained the following insertion in the U3
NheI
site: AGCGGCCGCATAAAATAAAAGATTTTATTTAGTCTCC
AGAAAAAGG GGGGAACAACAAAA.
This PPT2 insertion is a duplication of sequences upstream of
and
including the PPT (underlined) followed by a mutated att (attachment)
sequence. All mutant tandem-PPT plasmids retained this wild-type
PPT
sequence in PPT2 except

21/

28PPT2, which contained mutant
upstream
sequences in PPT2 and wild-type sequences upstream of
PPT1.
Cells and viruses.
NIH 3T3 cells, D17 cells, Rat2 cells, and
derivatives were grown in Dulbecco's modified Eagle's medium
supplemented with 10% calf serum (Gibco).
NXA retroviral packaging
cells (29) and derived cell lines were grown in Dulbecco's
modified Eagle's medium supplemented with 10% fetal bovine serum (HyClone).
Stably transfected vector-producing cell pools were established by
transfecting

NXA cells with vector plasmids, using Lipofectamine
(Gibco) according to the manufacturer's instructions.
Puro
r cells were selected in 1 µg of puromycin
(Sigma) per ml. More
than 100 transfectants were pooled to generate
each producer
pool.
Viral supernatants (5 ml) were harvested from 10-cm-diameter plates of
90% confluent producer cells at 12-h intervals, filtered
through
0.45-µm-pore-size filters (Fisher), and stored at

70°C
prior to
use. Virion proteins were quantified by determining RT
DNA polymerase
activity levels (
52). Briefly, 5 µl of virus-containing
culture medium was added to 25 µl of a mixture containing 60 mM
Tris (pH 8.3), 24 mM dithiothreitol, 0.7 mM MnCl
2, 75 mM NaCl,
oligo(dT) (6 µg/ml), poly(rA) (12 µg/ml),
[

-
32P]dTTP (20 nCi/µl), 12 µM dTTP, and 0.06%
Nonidet P-40 and then
incubated for 60 min at 37°C. Duplicate 5-µl
aliquots were spotted
on DEAE-paper and washed with 0.3 M NaCl-30 mM
sodium citrate
(pH 7). Incorporated dTTP retained on washed DEAE-paper
was quantified
in a scintillation counter or with Image-quaNT software
and a
PhosphorImager (Molecular Dynamics). Serial dilutions in
fresh
culture medium of wild-type virus were assayed under the same
conditions to establish a standard curve (Table
1).
Viral RNA levels were quantified by slot blotting as follows. Virus was
pelleted from 7 to 9 ml of culture medium for 25 min
at 3 × 10
5 g at 4°C in a model M120EX microultracentrifuge
(Sorvall). Virions
were disrupted by incubation in 200 µl of a
mixture containing
100 mM NaCl, 50 mM Tris (pH 7.5), 10 mM EDTA, 1%
sodium dodecyl
sulfate, proteinase K (100 µg/ml), and yeast tRNA (50 µg/ml) at
37°C for 30 min. Samples were extracted with an
equal-volume mixture
of phenol plus chloroform and precipitated with
ethanol, and pellets
were suspended in 400 µl of
diethylpyrocarbonate-treated H
2O.
Duplicate 200-µl
samples or dilutions within the linear range
of the assay were applied
to a nylon membrane (Hybond N; Amersham)
by using a BioDot slot blotter
(Bio-Rad) and hybridized with a
32P-labeled
probe generated with a random primer kit (Boehringer
Mannheim
Biochemicals) under standard hybridization conditions
(
38).
The probe was synthesized from a Puro
r-encoding fragment of
pAM86-5. Quantification was performed with
a PhosphorImager as
described above. Serial dilutions of wild-type
viral RNA were blotted,
hybridized, and quantified to establish
a standard curve (Table
2); 1× was defined as the first RNA
dilution
above the linear range of the assay.
Puro
r CFU titers were obtained by infecting 3T3 and D17
cells and counting Puro
r colonies. Infections were
performed in the presence of 8 µg hexadimethrine
bromide
(Polybrene; Sigma) per ml for 2 h at 37°C. Two days after
infection, Puro
r cells were selected in 6 (3T3 cells) or 2 (D17 cells) µg of puromycin
per ml. CFU titers were normalized to
viral RNA levels determined
by RNA slot blotting and to virion protein
levels determined by
RT assay. Wild-type vector CFU per unit of RNA was
assigned a
value of 1. Titers, RNA levels, and virion levels were
determined
in at least three independent experiments using at least two
different
viral stocks for each
mutant.
Replication efficiency assay.
Replication efficiency was
determined as follows. Ten percent confluent 35-mm-diameter plates of
3T3 cells were transfected as described above with pNR163-4 or
pMLV-Neor derivatives. After 2 days, all cells were
passaged to 6-cm-diameter plates. Culture medium was sampled, and cells
were passaged 1:10 every 3 days thereafter. Virus spread was assayed by
RT activity (15). Each mutant was tested at least twice.
Note that this experimental protocol prevented direct measurements of
transfection efficiencies. However, all experiments included wild-type
and mutant controls, and the consistency between wild-type and mutant values in each experimental repetition suggests that transfection efficiencies were similar for all samples within each experiment.
Virus spread following infection of fresh cells was monitored as
follows. Equal amounts of each virus, quantified by RT assay
as
described above, were used to infect 10% confluent 3T3 cells.
Culture
medium was sampled once cells became confluent. Cells
were subsequently
passaged 1:5, and the medium was sampled every
2 days. Virus spread was
detected by RT
activity.
Preparation and analysis of viral DNA.
Low-molecular-weight
DNA enriched in unintegrated viral DNA was extracted from Rat2 cells
24 h postinfection (17). Viral DNA was analyzed by PCR
of the PPT region, using primers specific for env and U3,
followed by restriction analysis. For sequencing, ClaI-to-NheI restriction fragments of these PCR
products were introduced into pUC19, and individual subclones were sequenced.
PPT use for the tandem PPT constructs was analyzed by reiterative
primer extension. Briefly, antisense U5 (CCCCGCTGACGGGTAGTC;
complementary to positions 11 to 28 from the downstream edge of
U5) and U3 (CCATCTGTTCCTGACCTTGATCTGAACTTC; complementary to
positions
88 to 117 from the upstream edge of U3) primers were 5'
32P end labeled with polynucleotide kinase and
[

-
32P]ATP (Amersham). Reaction mixtures of 50 µl
contained 50 mM KCl,
10 mM Tris-HCl, 2mM MgCl
2, 200 µM
deoxynucleoside triphosphates,
4 pmol of labeled primer, and 2 U of
Taq polymerase. For each
reaction, 1/10 of the
low-molecular-weight DNA harvested from
a 10-cm-diameter culture plate
was used as the template. Primer
extension products were generated by
30 cycles of denaturation
(60 s at 94°C), annealing (60 s at 45°C),
and extension (45 s
at 72°C). Products were extracted with an
equal-volume mixture
of phenol plus chloroform, collected by ethanol
precipitation,
and suspended in 10% formamide. Products were denatured
by heating
at 80°C for 2 min prior to loading on a 6%
polyacrylamide-8 M
urea gel. Dried gels were exposed to
autoradiography film. Products
were quantified with a PhosphorImager as
described above. Relative
PPT use values obtained in separate
experiments differed by about
10%.
Sequence alignments were performed with Lasergene MegAlign (DNASTAR,
Inc.). BLAST searches (
www.ncbi.nlm.nih.gov/BLAST/) were
performed to
identify the origin of sequences found in

21/

28
revertants.
 |
RESULTS |
Retroviral vectors and proviral clones with targeted alterations to
the M-MuLV PPT region.
Targeted alterations were introduced into
the 3' UTRs of infectious proviral clones and replication-defective
retroviral vectors (Fig. 2A and B). These mutations allowed us to
examine effects of PPT region alterations on both a single round and
multiple rounds of viral replication. The 3' UTR mutations were also
introduced into proviral clones containing secondary PPTs that served
as competing plus-strand priming sites in cis (Fig. 2C).
Mutations (summarized in Fig.
3) included
point mutations in highly conserved PPT positions and larger
substitutions in sequences
within and near the PPT. Our rationale in
making upstream substitutions
was that during cleavage of the
plus-strand primer, RT is oriented
with its RNase H active site at the
3' end of the PPT and its
DNA polymerase domain extending in the 5'
direction (
20). Bound
in this orientation, RT's DNA
polymerase domain contacts about
25 nucleotides upstream of the point
of cleavage (
54).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
3' UTR mutations. The wild-type M-MuLV sequence is on
the first line. For mutants, bold indicates differences from the
wild-type sequence and dashes indicate deletions. The PPT is shaded
gray. The vertical line marks the PPT/U3 boundary and the normal site
of plus-strand primer cleavage. Footprint of RT positioned to cleave
the plus-strand primer (54) is underlined.
|
|
The

1/

6 substitution changed all PPT bases between

1 and

6,
including the highly conserved

2 and

4 positions. The

7/

17
mutation altered the upstream half of the PPT. The

14/

19 and

21/

28 mutations were in sequences upstream of the canonical
PPT.
Both mutations lie within the predicted footprint of RT positioned
to
cleave the plus-strand primer (Fig.
3) (
54) and within the
region implicated by Sorge and Hughes as being required for viral
replication in ASV (
46). The

21/

28 substitutions also
disrupted
an A · T-rich region which is conserved upstream of
several PPTs
(Fig.
1). The

14/

19 substitutions extended purine-rich
sequences
to upstream of the PPT. None of the PPT substitutions altered
the spacing of viral
elements.
3' UTR alterations and virus replication.
Proviral clones were
transfected into 3T3 cells, transfected cells were serially passaged,
and virus spread was monitored. In separate experiments, viral spread
was monitored after 3T3 cells were infected with uniform amounts of
infectious mutant viruses. Results are summarized in Fig. 4A and
C.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 4.
Replication of 3' UTR mutants. The leftmost edges of the
dark bars indicate time points at which virus was first detected by RT
activity. Standard deviations and number of experimental repetitions
for each mutant are presented at the right side (Std.Dev., standard
deviation; #, number of experimental repetitions). (A) Time course of
spread of single-PPT virus after transfection of 3T3 cells. Values for
21/ 28 and 14/ 19 are averages of values obtained from those
experiments where virus spread was detected. Variability in time course
of viral replication for these mutants reflects the reversion that was
required for viral spread. (B) Time course of spread of tandem-PPT
virus after transfection of 3T3 cells. (C) Time course of spread of
single-PPT virus after infection of 3T3 cells with mutant or revertant
virus. Also shown is the replication time course for three dilutions of
wild-type virus. All infections of mutants were performed with an
amount of virus equivalent to 1× wild-type virus as determined by RT
activity. Revertant sequences are shown in Fig. 5B and C. (D) Time
course of spread of tandem-PPT virus after infection of 3T3 cells with
mutant or revertant virus. Results are from a single experiment. The
21/ 28 tandem rev1 revertant sequence is shown in Fig. 5d.
|
|
These assays revealed that single-base substitutions in highly
conserved PPT residues caused relatively modest delays in virus
spread,
similar to delays observed when the input of wild-type
virus was
reduced 10- to 100-fold (Fig.
4A and C). The

7/

17
substitution in
the upstream half of the PPT was only slightly
more delayed than it was
in the point mutants. Restriction and
sequence analysis of viral DNAs
produced after several rounds
of replication revealed that for each of
these mutants, the original
mutation was retained throughout passage.
Viral spread was not
detected within 60 days after transfection for the

1/

6 substitution
in the cleavage-proximal half of the
PPT.
Replication of the

14/

19 mutant was detectable only after a
significant delay in two experiments or not at all in a third
experiment. Analysis of viruses detected after several rounds
of cell
passage revealed that the PPT region was altered. The
revertant
detected after one

14/

19 mutant transfection experiment
(

14/

19rev1) contained a single substitution within the originally
altered sequence (Fig.
5B). This
substitution was initially detected
because it obliterated the
DraI restriction site that tagged the

14/

19 mutation
(Fig.
5A, lanes 7 to 10). This revertant replicated
more efficiently
than the

4C and

7/

17 mutants (Fig.
4C). Virus
from another

14/

19 transfection experiment (

14/

19rev2) reverted
by
undergoing more significant sequence alterations upstream of
the PPT
(Fig.
5B). In both cases, the reverted genome was the
only viral
product detectable among replicating virus DNA. In
the third

14/

19
experiment, virus spread remained undetectable
throughout 90 days of
transfected cell passage.

View larger version (46K):
[in this window]
[in a new window]

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 5.
Analysis of PPT regions after mutant virus replication.
(A) PCR amplification of the region between env and the
beginning of U3 from unintegrated viral DNA harvested 24 h after
infection of Rat2 cells, and analysis for PPT mutation-associated
restriction sites. Arrows indicate cut PCR product (products which
retained restriction site that tagged parental mutation) and uncut
fragments. Mutant tested, source of PCR template, and restriction
enzymes used are indicated at the top. Passage 1 refers to DNA
templated by virus generated after transfection of 3T3 cells and
subsequent viral spread within the transfected cells; passage 2 refers
to DNA templated by virus generated after additional replication in
fresh cells of virus used for passage 1. Lanes: 1, marker
(positions indicated in base pairs at the left); 2, no template
PCR; 3 and 4, 21/ 28 plasmid; 5 to 8, 21/ 28rev5 virus; 9 and 10, 14/ 19 plasmid; 11 and 12, 14/ 19rev1 virus. In lane 5, the
larger band corresponds to the revertant sequence (shown in panel C)
and the shorter band corresponds to the original mutant sequence. The
implications of digestion patterns observed here that the 21/ 28
mutant replicated as a mixed population of revertant and parental
mutant virus but that all replication products of the 14/ 19 mutant
were revertants was confirmed by subcloning and sequencing individual
replication products. Slight differences in migration patterns between
digested and nondigested lanes were due to salt effects. (B) Sequences
of 14/ 19 revertants. Shown are PPT and upstream sequences before
and after replication in 3T3 cells from two individual experiments.
Revertants from the first and second experiments are designated rev1
and rev2, respectively. (C) Sequences of 21/ 28 revertants. The
first number after the suffix "rev" indicates which transfection
experiment yielded the indicated revertant, and the number after the
dash indicates each sequence class found within the population of
products from each transfection experiment. Insertions in rev3-1 and
rev3-2 apparently derive from a VL30-type retroelement called BVL-1
(18), and sequences in rev4-2 and rev5 are from
recombination with an endogenous murine retrovirus (47, 48).
(D) 21/ 28 tandem-PPT revertants. PPTA is the PPT acquired by one
revertant between PPT1 and PPT2. The 21/ 28 tandem rev1, 3 sequence
was obtained twice in two separate transfection experiments; the
21/ 28 rev2 sequence was obtained in one experiment. Parental
mutations are indicated by bold capital letters; dashes indicate sites
of insertions or gaps in the sequence; underlined bold lowercase
letters indicate sequences that differ from the parental mutant. PPT
sequences are shaded gray, and cleavage sites are indicated by a
vertical line.
|
|
The time course of detectable virus spread suggested that the

21/

28
mutant was severely impaired (Fig.
4A). Spread was observed
in only 7 of 10 repetitions of the transfection experiment. When
spread was
detected, viral DNA was initially tested for retention
of the
NotI restriction site used to tag the original mutation,
and
several individual subclones of viral DNA from each transfection
experiment were subsequently
sequenced.
The

21/

28 mutant appeared to be weakly infectious on its own. In
two experiments, the original mutation was still detectable
after
serial virus passage, but in most experimental repetitions,
virus
populations were dominated by revertants after extensive
passage.
Unlike other mutants, the virus found replicating after
transfection
with

21/

28 proviral plasmids often appeared as
mixed populations of
the parental mutant with one or more revertants
(for example, Fig.
5A
and

21/

28 revertant sequences in Fig.
5C). The time course of
revertant spread through 3T3 cells was
variable, with different
revertant populations spreading either
at the same rate as the wild
type or else with significant residual
delays.
Analysis of virus which emerged from two transfection experiments
(

21/

28rev4-2 and

21/

28rev5) revealed that whereas a
significant
portion of the preintegrative DNA contained the original
mutant
sequence, the original substitution had been replaced with
nonviral
sequences in other viral DNAs within the population.
A BLAST search
identified these nonviral sequences as being highly
homologous to
portions of several retroelements, including endogenous
murine
retrovirus MX27, the modified polytropic endogenous murine
retrovirus
MX33, and the murine retrovirus LTR insertion linked
to the hairless
mutation (
47,
48) (Fig.
5C). The presence
of endogenous
retrovirus sequences suggests that in these viruses,
the original
mutation had been reverted by patch repair (
41).
Less of the
original

21/

28 mutant and more of the revertant
were detected
within the viral population after subsequent infection
with this mixed
virus than after the original transfection (Fig.
5A, lanes 6 and
8).
Other classes of revertants arose during separate

21/

28
transfection experiments. Some (for example,

21/

28rev2) contained
only point mutations within the parental mutant sequences and
may or
may not have acquired increased replication fitness. In
one repetition
of the transfection experiment, virus was found
with duplicate M-MuLV
PPTs flanking a 61-bp insert that appeared
to be derived from a
VL30-type retroelement called BVL-1 (

21/

28rev3)
(
18). This insertion brought sequences similar to the
T-rich
PPT upstream region consensus (Fig.
1) into position flanking
the downstream PPT. Yet another transfection experiment yielded
a
series of revertants (

21/

28rev1) with different lengths of
additional A residues inserted into the PPT without alterations
to the
original

21/

28 mutations. The origin of function of these
A-tract
insertions is unclear, but they resulted in altered spacing
between the
PPT and the

21/

28 mutations. Further analysis will
be required to
determine whether all of the structurally disparate
reversions that we
observed restored the same function(s) to the

21/

28
mutant.
It is striking to note that one revertant of the

14/

19 mutant
(

14/

19rev2 [Fig.
5]) had an A-tract insertion that extended
the
PPT in a manner similar to the insertions seen in some

21/

28
revertants and that A-tract insertions have also been observed
in
experiments using a different retroviral system. In a study
of the
simian immunodeficiency virus (SIV) T-rich stretch, Ilyinskii
and
Desrosiers found similar insertion of T-rich sequences upstream
of the
PPT and elongation of the PPT A stretch among revertants
of T-stretch
mutants (
21).
Effects of 3' UTR alterations on a single round of vector DNA
synthesis.
To examine effects of 3' UTR alterations on a single
round of replication, we built mutations into retroviral vectors and determined vector-templated integrant titers. Vector producer cells
were generated by stably transfecting packaging cells with vector
plasmids, and virus was harvested from packaging cell pools. Vector DNA
production in infected 3T3 or D17 cells was monitored by comparing
Puror titers per unit of virion RNA. As predicted, we found
that our PPT alterations, because they were located upstream of the
plus-strand priming site, were not present at the tips of
preintegrative DNA (see Fig. 8). Because our 3' UTR mutations did not
affect the structure of preintegrative DNA and hence should not affect
its ability to become integrated, we assumed that reductions in titer per unit of RNA reflected reductions in amounts of DNA synthesized.
Results are summarized in Fig.
6. All
mutants except the

7/

17 mutant consistently yielded lower colony
counts per unit of
viral RNA than the wild-type vector, suggesting that
most of the
mutations affected plus-strand priming. Note that the
titers for
some mutants (most notably the

7/

17 mutant) were highly
variable,
suggesting that some mutations may have been unstable. Data
in
Fig.
6 represent three assay repetitions; variability for this
mutant was also evident in additional assays not shown. The

14/

19
and

21/

28 mutants had low titers. This finding was
consistent
with the inability of viruses harboring these mutations to
undergo
multiple rounds of replication without reverting but indicated
that some reverse transcription was possible for these mutants.
The

1/

6 mutant, replication of which was never detected, yielded
a
vector titer which was 1% of that of the wild type, comparable
to the
titer reported for a vector with no PPTs (
3). Note that
Fig.
6 presents titers as the number of drug-resistant colonies
per unit of
RNA; values for colonies per unit of virion were similar.
Whereas RNA
loss during purification was not measured, the good
agreement in values
for colonies per unit of RNA and per unit
of virion obtained in
experimental repetitions suggests that variations
in RNA loss during
purification were not great enough to seriously
affect our results.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 6.
Single-PPT mutant vector titers. Colonies per unit of
RNA ratios for wild-type PPT vectors were given a value of 1. Error
bars reflect variation in values for four (wild type [wt]), three
( 2C, 4C, 7/ 17, 14/ 19, and 21/ 28 mutants), two (mutant
att), and one ( 1/ 6 mutant) repetitions of each experiment. Methods
for virus and RNA quantification are described in Materials and
Methods.
|
|
Establishment of a tandem-PPT system for studying the effects of 3'
UTR alterations.
We also examined plus-strand priming from a
nonessential site by using tandem-PPT viruses (Fig. 2C). Our intention
with these tandem-PPT constructs was to assess effects on plus-strand
priming separately from other replication effects. Bowman et al. have shown that if two PPTs are built into a single vector, each can serve
to prime plus-strand synthesis some of the time (2). In our
experiments, we cloned a secondary PPT and flanking sequence (PPT2)
into the upstream edge of U3 (Fig. 2C). Previous studies have shown
that insertions at this site have minimal consequences for viral
replication (23, 49). For these experiments, we introduced
alterations into the PPT1 region while maintaining wild-type sequences
in PPT2.
In our constructs, PPT2 was adjacent to a mutated integration att site
(Fig.
3). This was intended to ensure that if a deletion
occurred
between the tandem PPTs during reverse transcription,
then the virus
would be rendered noninfectious since the resulting
DNA would lack
functional integration signals on one end. Note
that despite our
intention of creating an unusable att site (
5,
7),
single-PPT virus containing our mutated att could replicate
without
reversion, albeit with a significant delay relative to
the wild type
(Fig.
4A). Vectors with this att mutation yielded
a titer slightly
higher than that obtained with integrase mutants
(Fig.
6A) (
27,
51).
PCR analysis of preintegrative DNAs generated after several rounds of
replication showed that both PPTs were retained as intended
in the vast
majority of replication products (Fig.
7), suggesting
that DNAs ending with the
mutant att were integration defective
and at a selective disadvantage
for further replication. This
maintenance of both PPTs ensured that the
reverse transcription
machinery was provided with a choice of two
competing PPTs during
nearly all rounds of viral replication.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
PCR analysis of tandem-PPT viral DNA after passage
through 3T3 cells. The region between envelope and U5 was amplified
from unintegrated proviral DNA purified from Rat2 cells infected with
tandem-PPT virus. The size of the mutant att PCR product corresponds to
the expected product size if the tandem PPT had been deleted between
PPT1 and PPT2. Arrows indicate one, two, and three PPT product sizes.
Marker positions are indicated in base pairs at the left.
|
|
Effects of tandem PPT 3' UTR mutations on viral replication.
Tandem-PPT proviral plasmids were transfected into 3T3 cells, and viral
spread was monitored (Fig. 4B and D). Replication of
2C,
4C, and
7/
17 tandem-PPT mutants was detectable at time points similar to
those for the corresponding single-PPT mutants (Fig. 4A). The
14/
19
mutant replicated more efficiently in the tandem-PPT context than in
the single-PPT virus. After several rounds of replication, we detected
tandem
14/
19 replication products that did not contain reversions,
suggesting that sequences in the ectopic PPT might have compensated for
the
14/
19 defect. Surprisingly, the
1/
6 tandem-PPT mutant
reproducibly failed to replicate, even though the presence of PPT2
might have been predicted to allow replication as efficient as that of
mutant att virus. The stage where replication of this mutant was
blocked was not examined. PCR and sequence analysis of DNA synthesized by all tandem-PPT viruses that did replicate revealed that all tandem-PPT mutants except the
21/
28 mutant retained their original two PPTs without reversions even after prolonged passage (Fig. 7 and
data not shown). The
21/
28 mutant yielded two env/U3
region PCR products, one which corresponded to the presence of the
original two PPT and another which was longer (Fig. 7, lane 9).
Sequence analysis of the longer

21/

28 products revealed that it
contained a third wild-type PPT (PPTA) between the two PPTs
of the
original construct (Fig.
5D). This revertant contained
a

21/

28 PPT
region plus wild-type att followed by a wild-type
PPT plus wild-type
att and then another wild-type PPT plus mutant
att. This third PPT
insertion, which presumably arose via intermolecular
template switching
during reverse transcription of copackaged
tandem

21/

28 RNAs, was
observed in all three repetitions of
this experiment. However, as with
the

21/

28 mutation in the
single PPT, some unaltered virus with the
original tandem

21/

28
sequence could be detected in addition to the
altered sequence
among preintegrative DNAs produced in one experiment.
When the

21/

28 mutation was introduced into PPT2 instead of PPT1,
the
resultant

21/

28 PPT2 virus was capable of replicating with
wild-type
efficiency without reversion (Fig.
4B).
Assessing PPT use with the tandem-PPT system.
To determine the
relative abundance of products primed by PPT1 and by PPT2 during a
single cycle of reverse transcription, we infected fresh Rat2 cells
with tandem-PPT viruses and harvested preintegrative DNAs at a uniform
time point postinfection.
Two species of preintegrative DNAs should exist within the populations
templated by our tandem-PPT viruses: one with a left
end that results
from the use of PPT1 and a second that results
from the use of PPT2
(Fig.
2C). By comparing the ratio of the
two species among the DNA
products of a virus whose PPTs were
both wild type to the ratio of
these species for a virus with
one wild-type and one mutant PPT, we
examined the effects of our
PPT alterations on plus-strand initiation
site
selection.
We assumed that differences in product prevalence reflected differences
in the DNA products' production. This is because by
their nature, PPT
sequences specify viral DNA ends but do not
become a part of those
ends. Both the PPT1- and PPT2-primed DNA
products of each tandem-PPT
RNA had the same terminal sequences
as the corresponding products from
every other tandem-PPT RNA,
and hence the rate of integration of these
DNAs will not be affected
by which PPT specified their ends. Note that
mutant PPT products
which are relatively abundant at one time point
should remain
relatively abundant at all time points, thus ensuring
that assessing
any single time point should accurately reveal trends
among mutants
in relative PPT use. However, the precise magnitude of
differences
among mutants would vary at different time points since
some viral
DNAs with intact integration att termini would become
integrated
and removed from the preintegrative pool over
time.
The preintegrative DNAs were analyzed by primer extension assays with
U5 antisense end-radiolabeled primers (Fig.
2C). The
products were
separated on polyacrylamide gels, and the ratios
of PPT1- and
PPT2-primed products were compared (Fig.
8 and Table
3). Note that due to frequent reverse
transcription-associated
deletion of a repeated enhancer element in U3,
use of each PPT
is represented on the gel in Fig.
8 as two bands: one
resulting
from the use of a given PPT and the second resulting from the
use of that same PPT accompanied by enhancer deletion. The sum
of the
deleted and nondeleted products was used to compare PPT
usage frequency
(Table
3).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 8.
Primer extension analysis of PPT use among
preintegrative DNA products of tandem-PPT viruses performed with a U5
antisense primer. Marker sizes (left) and PPT product sizes (right) are
indicated in base pairs. Arrows indicate products from PPT1 and PPT2
use. PPT1 and PPT2 indicate products where one enhancer repeat
was deleted from the PPT1 and PPT2 products, respectively. For
21/ 28rev1, which has three PPTs, PPT1 and PPTA products are
indicated (Fig. 5D). For the wild-type, 2C, 4C, 7/ 17, 14/ 19
and 21/ 28PPT2 constructs, PPT1 is 640 bp, PPT1 is 565 bp, PPT2
is 555 bp, and PPT2 is 480 bp. For 21/ 28rev1, PPT1 is 725 bp,
PPT1 is 650 bp, PPTA is 640 bp, PPTA is 565 bp, PPT2 is 555 bp,
and PPT2 is 480 bp. Origins of the faint bands in lanes 3 and 6, which migrate at the same mobility as the 21/ 28 PPT1 band, were not
determined, but these bands are presumed to be products of rare
triple-PPT viruses. The longer band in lane 1 corresponds with priming
from the single wild-type M-MuLV PPT, and the shorter bands are
enhancer deletions of this product. Longer products which resulted from
primer annealing to the downstream LTR are not visualized in this
figure.
|
|
Under these conditions, products primed by PPT1 were about two and a
half times as prevalent as those from PPT2 among DNAs
templated by
virus with two wild-type PPTs (Fig.
8, lane 2). In
contrast, the
wild-type PPT2 was selected more frequently than
PPT1 when the PPT1
site contained the

2C,

4C, or

7/

17 mutation
(lanes 3 to 5). The

14/

19 mutation had little apparent effect
on primer selection, and
its calculated utilization was similar
to that of the wild type in this
assay (Fig.
8, lane 6; Table
3). For the tandem

21/

28 PPT mutant,
the wild-type PPT was
favored over the mutant site to an extent similar
to that observed
with the conserved PPT point mutations (Fig.
8, lane
8; Table
3). Similar selectivity against the

21/

28 mutation as a
priming
site was observed with the

21/

28 revertant, which retained
the

21/

28 mutation in one PPT (Fig.
5D) but which also contained
two wild-type PPTs

PPT2 and PPTA (Fig.
8, lane 7). Note that whereas
mutant PPT use was calculated considering the presence of three
PPTs
for the

21/

28 mutant, low levels of three PPT products
were also
detected for the wild type,

2C mutant, and

14/

19
mutant by primer
extension (Fig.
8, lanes 2, 3, and 6). In contrast,
these three PPT
products were not detected by PCR (Fig.
7, lanes
4, 5, and 8). This
discrepancy may be due to an overrepresentation
of short products by
PCR and the ability of primer extension to
detect rare products. If
this three-PPT product is considered
for the

14/

19 mutant, then its
priming may be somewhat more
impaired than calculated
here.
The plus-strand initiation site was examined by using primer extension
with a U3 antisense primer that allowed resolution
of single base
length differences. Although the conditions used
would not have allowed
detection of minor species, the major plus-strand
initiation site for
all mutants appeared to be the same as for
the wild type (not
shown).
 |
DISCUSSION |
We have examined the effects of altering specific highly conserved
positions in the M-MuLV PPT and flanking region on the ability of the
virus to replicate and to synthesize vector DNAs. Our results
demonstrated that the conserved regions within the PPT contributed to
optimal plus-strand priming. However, each of several conserved
features (positions
2,
4, and
7/
17) was dispensable
individually, thus suggesting a degree of redundancy among plus-strand
priming determinants. Alterations to 3' UTRs adjacent to and upstream
of the PPT affected both plus-strand priming and other aspects of replication.
Mutations in the conserved
2 and
4 positions, as well as a mutation
(
7/
17) which converted the cleavage site-distal half of the PPT to
a series of pyrimidine residues, were compatible with replication.
However, replication of these mutants was delayed relative to the wild
type, and use of the mutant PPTs was highly disfavored when a wild-type
PPT was available in cis.
The
1/
6 mutant, which contained substitutions in the cleavage
site-proximal half of the PPT, did not replicate and yielded a
titer 1% of that of a wild-type vector. Bowman et al. found that a
vector containing a deletion of both the PPT and att site, which should
not plus-strand prime, formed less than 2% of the Neor
resistant titer of a vector containing these sequences (3). Thus the
1/
6 mutant vector titer suggests this PPT was nonfunctional.
Titers for the
7/
17 mutant were variable but generally consistent
with the model that the U3-proximal half of the PPT is sufficient for
plus-strand priming (31).
7/
17 mutant use in tandem PPT
virus was consistent with this notion. However, replication of the
7/
17 mutant was more impaired than its colony-forming titer would
have predicted, which may indicate that this mutation affected more
than one replication stage.
Our results suggest sequences outside the PPT contribute to plus-strand
priming. As revealed in assays of tandem-PPT products, a mutant PPT
region that contained the
21/
28 alterations was used significantly
less often than a PPT containing the wild-type sequence. These findings
may indicate that altering the PPT flanking sequences affected the
conformation of the substrate or that contacts made by the DNA
polymerase domain are important to PPT recognition, or both. M-MuLV was
less tolerant of changes to these sequences than of changes to some
highly conserved positions within the PPT, since replication of the
21/
28 mutant was severely delayed and sometimes detectable only
after reversion had occurred.
There is experimental precedence for the concept that sequences or
structures upstream of RNase H cleavage sites or their interactions
with RT may affect retroviral RNA-DNA duplex cleavages. Footprinting
analysis reveals that M-MuLV RT protects the regions from
27 to +6 of
the template strand (numbered relative to the site of polymerization)
and from
26 to
1 of the primer strand when RT is bound in the
position to polymerize DNA (54). Additionally, some
mutations in RT's DNA polymerase domain have been reported to affect
RNase H activity (12, 14, 24, 30, 36, 39, 50). Hence,
contacts made by RT's DNA polymerase domain as well as the RNase H
domain may affect plus-strand priming.
It has been suggested that PPT recognition may involve a unique nucleic
acid structure that contributes to the PPT's resistance to RNase H
cleavage (10, 31). Double-stranded DNA typically forms a
B-form helix, and double-stranded RNA forms an A-form helix. DNA-RNA
hybrids adopt an intermediate conformation called H form
(11). H-form helices can be modeled to contact RT's RNase H
domain differently from A or B form helices, and these extra contacts
may confer RNase H specificity for RNA-DNA hybrids (11). Circular dichroism studies suggest that polypurine-rich RNA-DNA hybrids
have a structure distinct from that of random sequences (31)
and that polypurine-rich sequences have wider major and minor grooves
than random-sequence RNA-DNA hybrids (10). These structural
distinctions might contribute to the RNase H resistance of PPT
sequences. However, purine richness per se cannot be responsible for
PPT recognition, since Sorge and Hughes have shown that a mere stretch
of purines is not sufficient for replication (46) and Luo et
al. have demonstrated species specificity in PPT use (25).
Because the
21/
28 replication is more severely impaired than would
be expected due to its effects on plus-strand priming, some other step
of viral replication may be affected by this mutation. In a study
performed contemporaneously with this one, Ilyinskii and Desrosiers
found that in SIV, mutations of this A · T-rich region, which
they referred to as the U box, caused a block in reverse transcription
at a stage between the first strong-stop template switch and
plus-strand initiation (21). A similar role for the M-MuLV
T-rich region upstream of the PPT might explain the results we find here.
Several of our mutants addressed the effects on priming of purine
richness in the 3' UTR. In contrast to the other mutations, the
14/
19 mutation, which elongates the PPT, did not appear to affect
plus-strand priming significantly. This mutation had less effect on PPT
selection in tandem-PPT virus than did the other mutations, and the
tandem
14/
19 virus replicated more efficiently than the mutant
single-PPT virus. These results suggest that the mutation principally
affected replication steps other than plus-strand priming and that
these defects were overcome to at least some degree by the presence of
the ectopic PPT. Because this mutation was able to support plus-strand
priming in the tandem-PPT context, the
14/
19 alterations seem
unlikely to exert their negative effects on replication through
interfering with priming by perturbing the local structure of the PPT
region. However, the
14/
19 mutation likely affects some early step
in the replication of the virus, since this mutation had a significant
effect on CFU titer per unit of encapsidated RNA when incorporated into replication-defective vectors.
For M-MuLV and many other retroviruses, the PPT lies in an untranslated
region downstream of the envelope gene. For M-MuLVs, this genome region
plays no known roles in replication other than in plus-strand
initiation. However, we found that some alterations to this region have
defects more severe than would be predicted to occur due to effects on
plus-strand priming. These findings suggest that the M-MuLV 3' UTR may
function in replication steps other than plus-strand priming, as has
been reported for some other simple retroviruses.
One role that has previously been described for retroviral 3' UTRs is
in the regulation of RNA trafficking. For example, because the main
difference between avian leukosis virus and ASV is the presence of the
host-derived src gene in its 3' UTR, it was previously believed that the 3' UTR might be a functionally dispensable, genetically malleable region (13). However, it is now
apparent that DR1 and DR2 in the 3' UTR of Rous sarcoma virus function in nuclear export of unspliced RNA (28). These unspliced
RNAs are used as genomes for new virions and as mRNA for the Gag and Pol proteins. The simian retrovirus and Mason-Pfizer monkey virus contain in this region a cis-acting sequence, named the
constitutive transport element, which serves a similar RNA transport
function (4, 55).
The mechanism by which M-MuLV unspliced RNAs exit the nucleus is
unknown, and the uncharacterized functions of the M-MuLV 3' UTR
for
which we have found evidence
may include unspliced RNA export.
However, evidence for impairment of early replication stages by some
mutants examined here support the notion that the M-MuLV 3' UTR may
also participate in processes not previously known to rely on this
region of retroviral genomes. We are currently exploring these putative
replication roles of the M-MuLV 3' UTR through further mutagenesis,
revertant analysis, and complementation studies.
 |
ACKNOWLEDGMENTS |
We acknowledge Steve Tsang for providing the pPNT derivative,
Garry Nolan for providing retroviral packaging cells, Michael Imperiale
and Wes Dunnick for critical reading of the manuscript, and Rosa Yu for
help in early stages of this project.
This research was supported by NIH grants R29 CA 69300 to A.T. and T32
GM 07544 to N.D.R.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology and Comprehensive Cancer Center, University of Michigan Medical School, 6620 Medical Sciences Bldg. II, Ann Arbor,
MI 48109-0620. Phone: (734) 936-6466. Fax: (734) 764-3562. E-mail:
ateles{at}umich.edu.
 |
REFERENCES |
| 1.
|
Bieth, E., and J.-L. Darlix.
1991.
Complete nucleotide sequence of a highly infectious avian leukosis virus.
Nucleic Acids Res.
20:367[Free Full Text].
|
| 2.
|
Bowman, E. H.,
V. K. Pathak, and W.-S. Hu.
1996.
Efficient initiation and strand transfer of polypurine tract-primed plus-strand DNA prevent strand transfer of internally initiated plus-strand DNAs.
J. Virol.
70:1687-1694[Abstract].
|
| 3.
|
Bowman, R. R.,
W.-S. Hu, and V. K. Pathak.
1998.
Relative rates of retroviral reverse transcriptase template switching during RNA- and DNA-dependent DNA synthesis.
J. Virol.
72:5198-5206[Abstract/Free Full Text].
|
| 4.
|
Bray, M.,
S. Prasad,
J. W. Dubay,
E. Hunter,
K.-T. Jeang,
D. Rekosh, and M.-L. Hammarskjold.
1994.
A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent.
Proc. Natl. Acad. Sci. USA
91:1256-1260[Abstract/Free Full Text].
|
| 5.
|
Bushman, F. D., and R. Craigie.
1990.
Sequence requirements for integration of Moloney murine leukemia virus DNA in vitro.
J. Virol.
64:5645-5648[Abstract/Free Full Text].
|
| 6.
|
Champoux, J. J.
1993.
Roles of ribonuclease H in reverse transcription, p. 103-117.
In
A. M. Skalka, and S. P. Goff (ed.), Reverse transcriptase. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 7.
|
Colicelli, J., and S. P. Goff.
1985.
Mutants and pseudorevertants of Moloney murine leukemia virus with alterations at the integration site.
Cell
42:573-580[Medline].
|
| 8.
|
Colicelli, J., and S. P. Goff.
1988.
Sequence and spacing requirements of a retrovirus integration site.
J. Mol. Biol.
199:47-59[Medline].
|
| 9.
|
Donahue, P. R.,
E. A. Hoover,
G. A. Beltz,
N. Riedel,
V. M. Hirsch,
J. Overbaugh, and J. I. Mullins.
1988.
Strong sequence conservation among horizontally transmissible, minimally pathogenic feline leukemia viruses.
J. Virol.
62:722-731[Abstract/Free Full Text].
|
| 10.
|
Fedoroff, O. Y.,
Y. Ge, and B. R. Reid.
1997.
Solution structure of r(gaggacug):d(CAGTCCTC) hybrid: implications for the initiation of HIV-1 (+)-strand synthesis.
J. Mol. Biol.
269:225-239[Medline].
|
| 11.
|
Fedoroff, O. Y.,
M. Salazar, and B. R. Reid.
1993.
Structure of a DNA:RNA hybrid duplex. Why RNase H does not cleave pure RNA.
J. Mol. Biol.
233:509-523[Medline].
|
| 12.
|
Gao, H.-Q.,
P. L. Boyer,
E. Arnold, and S. H. Hughes.
1998.
Effects of mutations in the polymerase domain on the polymerase, RNase H and strand transfer activities of human immunodeficiency virus type 1 reverse transcriptase.
J. Mol. Biol.
277:559-572[Medline].
|
| 13.
|
Gelinas, C., and H. M. Temin.
1986.
Nondefective spleen necrosis-derived vectors define the upper size limit for packaging reticuloendotheliosis viruses.
Proc. Natl. Acad. Sci. USA
83:9211-9215[Abstract/Free Full Text].
|
| 14.
|
Ghosh, M.,
J. Williams,
M. D. Powell,
J. G. Levin, and S. F. J. LeGrice.
1997.
Mutating a conserved motif of the HIV-1 reverse transcriptase palm subdomain alters primer utilization.
Biochemistry
36:5758-5768[Medline].
|
| 15.
|
Goff, S. P.,
P. Traktman, and D. Baltimore.
1981.
Isolation and properties of Moloney murine leukemia virus mutants: use of a rapid assay for release of virion reverse transcriptase.
J. Virol.
38:239-248[Abstract/Free Full Text].
|
| 16.
|
Hirsch, V.,
N. Riedel, and J. I. Mullins.
1987.
The genome organization of STLV-3 is similar to that of the AIDS virus except for a truncated transmembrane protein.
Cell
49:307-319[Medline].
|
| 17.
|
Hirt, B.
1967.
Selective extraction of polyoma DNA from infected mouse cell cultures.
J. Mol. Biol.
26:365-369[Medline].
|
| 18.
|
Hodgson, C. P.,
R. Z. Fisk,
P. Arora, and M. Chotani.
1990.
Nucleotide sequence of mouse virus-like (VL30) retrotransposon BVL-1.
Nucleic Acids Res.
18:673[Free Full Text].
|
| 19.
|
Howe, C. C., and G. C. Overton.
1986.
Expression of the intracisternal A-particle is elevated during differentiation of embryonal carcinoma cells.
Mol. Cell. Biol.
6:150-157[Abstract/Free Full Text].
|
| 20.
|
Hughes, S. H.,
Z. Hostomsky,
S. F. J. Le Grice,
K. Lentz, and E. Arnold.
1996.
What is the orientation of DNA polymerases on their templates?
J. Virol.
70:2679-2683[Medline].
|
| 21.
|
Ilyinskii, P. O., and R. C. Desrosiers.
1998.
Identification of a sequence element immediately upstream of the polypurine tract that is essential for replication of simian immunodeficiency virus.
EMBO J.
17:3766-3774[Medline].
|
| 22.
|
Kulpa, D.,
R. Topping, and A. Telesnitsky.
1997.
Determination of the site of first strand transfer during Moloney murine leukemia virus reverse transcription and identification of strand transfer-associated reverse transcriptase errors.
EMBO J.
16:856-865[Medline].
|
| 23.
|
Lobel, L. I.,
M. Patel,
W. King,
M. C. Nguyen-Huu, and S. P. Goff.
1985.
Construction and recovery of viable retroviral genomes carrying a bacterial suppressor transfer RNA gene.
Science
228:329-332[Abstract/Free Full Text].
|
| 24.
|
Loya, S.,
H.-Q. Gao,
O. Avidan,
P. L. Boyer,
S. H. Hughes, and A. Hizi.
1997.
Subunit-specific mutagenesis of the cysteine 280 residue of the reverse transcriptase of human immunodeficiency virus type 1: effects on sensitivity to a specific inhibitor of the RNase H activity.
J. Virol.
71:5668-5672[Abstract].
|
| 25.
|
Luo, G.,
L. Sharmeen, and J. Taylor.
1990.
Specificities involved in the initiation of retroviral plus-strand DNA.
J. Virol.
64:592-597[Abstract/Free Full Text].
|
| 26.
|
Majors, J. E., and H. E. Varmus.
1983.
Nucleotide sequencing of an apparent proviral copy of env mRNA defines determinants of expression of the mouse mammary tumor virus env gene.
J. Virol.
47:495-504[Abstract/Free Full Text].
|
| 27.
|
Murphy, J. E., and S. P. Goff.
1992.
A mutation at one end of Moloney murine leukemia virus DNA blocks cleavage of both ends by the viral integrase in vivo.
J. Virol.
66:5092-5095[Abstract/Free Full Text].
|
| 28.
|
Ogert, R. A.,
L. H. Lee, and K. L. Beemon.
1996.
Avian retroviral RNA element promotes unspliced RNA accumulation in the cytoplasm.
J. Virol.
70:3834-3843[Abstract].
|
| 29.
|
Pear, W. S.,
M. L. Scott, and G. P. Nolan.
1996.
Generation of high titer, helper-free retroviruses by transient transfection, p. 41-57.
In
P. Robbins (ed.), Methods in molecular medicine: gene therapy protocols. Humana Press, Totowa, N.J.
|
| 30.
|
Powell, M. D.,
M. Ghosh,
P. S. Jacques,
K. J. Howard,
S. F. J. LeGrice, and J. G. Levin.
1997.
Alanine-scanning mutations in the "primer grip" of p66 HIV-1 reverse transcriptase result in selective loss of RNA priming activity.
J. Biol. Chem.
272:13262-13269[Abstract/Free Full Text].
|
| 31.
|
Powell, M. D., and J. G. Levin.
1996.
Sequence and structural determinants required for priming of plus-strand DNA synthesis by the human immunodeficiency virus type 1 polypurine tract.
J. Virol.
70:5288-5296[Abstract/Free Full Text].
|
| 32.
|
Power, M. D.,
P. A. Marx,
M. L. Bryant,
M. B. Gardner,
P. J. Barr, and P. A. Luciw.
1986.
Nucleotide sequence of SRV-1, a type D simian acquired immune deficiency syndrome retrovirus.
Science
231:1567-1572[Abstract/Free Full Text].
|
| 33.
|
Ratner, L.,
W. Haseltine,
R. Patarca,
K. J. Livak,
B. Starcich,
S. F. Josephs,
E. R. Doran,
J. A. Rafalski,
E. A. Whitehorn,
K. Baumeister,
L. Ivanoff,
S. R. Petteway, Jr.,
M. L. Pearson,
J. A. Lautenberger,
T. S. Papas,
J. Ghrayeb,
N. T. Chang,
R. C. Gallo, and F. Wong-Staal.
1985.
Complete nucleotide sequence of the AIDS virus, HTLV-III.
Nature
313:277-284[Medline].
|
| 34.
|
Rattray, A. J., and J. J. Champoux.
1989.
Plus-strand priming by Moloney murine leukemia virus: the sequence features important for cleavage by RNase H.
J. Mol. Biol.
208:445-456[Medline].
|
| 35.
|
Rattray, A. J., and J. J. Champoux.
1987.
The role of Moloney murine leukemia virus RNase H activity in the formation of plus-strand primers.
J. Virol.
61:2843-2851[Abstract/Free Full Text].
|
| 36.
|
Rausch, J. W., and S. F. J. Le Grice.
1997.
Substituting a conserved residue of the ribonuclease H domain alters substrate hydrolysis by retroviral reverse transcriptase.
J. Biol. Chem.
272:8602-8610[Abstract/Free Full Text].
|
| 37.
|
Saltarelli, M.,
G. Querat,
D. A. Konings,
R. Vigne, and J. E. Clements.
1990.
Nucleotide sequence and transcriptional analysis of molecular clones of CAEV which generate infectious virus.
Virology
179:347-364[Medline].
|
| 38.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 39.
|
Schultz, S. J., and J. J. Champoux.
1996.
RNase H domain of Moloney murine leukemia virus reverse transcriptase retains activity but requires the polymerase domain for specificity.
J. Virol.
70:8630-8638[Abstract].
|
| 40.
|
Schwartz, D. E.,
R. Tizard, and W. Gilbert.
1983.
Nucleotide sequence of Rous sarcoma virus.
Cell
32:853-869[Medline].
|
| 41.
|
Schwartzberg, P.,
J. Colicelli, and S. Goff.
1985.
Recombination between a defective retrovirus and homologous sequences in host DNA: reversion by patch repair.
J. Virol.
53:719-726[Abstract/Free Full Text].
|
| 42.
|
Seiki, M.,
S. Hattori,
Y. Hirayama, and M. Yoshida.
1983.
Human adult T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA.
Proc. Natl. Acad. Sci. USA
80:3618-3622[Abstract/Free Full Text].
|
| 43.
|
Shimotohno, K.,
S. Mizutani, and H. M. Temin.
1980.
Sequence of retrovirus provirus resembles that of bacterial transposable elements.
Nature
285:550-554[Medline].
|
| 44.
|
Shinnick, T. M.,
R. A. Lerner, and J. G. Sutcliffe.
1981.
Nucleotide sequence of Moloney murine leukaemia virus.
Nature
293:543-548[Medline].
|
| 45.
|
Sonigo, P.,
C. Barker,
E. Hunter, and S. Wain-Hobson.
1986.
Nucleotide sequence of Mason-Pfizer monkey virus: an immunosuppressive D-type retrovirus.
Cell
45:375-385[Medline].
|
| 46.
|
Sorge, J., and S. H. Hughes.
1982.
Polypurine tract adjacent to the U3 region of the Rous sarcoma virus genome provides a cis-acting function.
J. Virol.
43:482-488[Abstract/Free Full Text].
|
| 47.
|
Stoye, J. P., and J. M. Coffin.
1987.
The four classes of endogenous murine leukemia virus: structural relationships and potential for recombination.
J. Virol.
61:2659-2669[Abstract/Free Full Text].
|
| 48.
|
Stoye, J. P.,
S. Fenner,
G. E. Greenoak,
C. Moran, and J. M. Coffin.
1988.
Role of endogenous retroviruses as mutagens: the hairless mutation of mice.
Cell
54:383-391[Medline].
|
| 49.
|
Stuhlmann, H.,
R. Janisch, and R. C. Mulligan.
1989.
Construction and properties of replication-competent murine retroviral vectors encoding methotrexate resistance.
Mol. Cell. Biol.
9:100-108[Abstract/Free Full Text].
|
| 50.
|
Tanese, N., and S. P. Goff.
1988.
Domain structure of the Moloney murine leukemia virus reverse transcriptase: mutational analysis and separate expression of the DNA polymerase and RNase H activities.
Proc. Natl. Acad. Sci. USA
85:1777-1781[Abstract/Free Full Text].
|
| 51.
| Telesnitsky, A. Unpublished data.
|
| 52.
|
Telesnitsky, A.,
S. Blain, and S. P. Goff.
1995.
Assays for retroviral reverse transcriptase.
Methods Enzymol.
262:347-362[Medline].
|
| 53.
|
Tybulewicz, V. L.,
C. E. Crawford,
P. K. Jackson,
R. T. Bronson, and R. C. Mulligan.
1991.
Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene.
Cell
65:1153-1163[Medline].
|
| 54.
|
Wohrl, B. M.,
M. M. Georgiadis,
A. Telesnitsky,
W. A. Hendrickson, and S. F. J. LeGrice.
1995.
Footprint analysis of replicating murine leukemia virus reverse transcriptase.
Science
267:96-99[Abstract/Free Full Text].
|
| 55.
|
Zolotukhin, A. S.,
A. Valentin,
G. N. Pavlakis, and B. K. Felber.
1994.
Continuous propagation of RRE( ) and Rev( ) human immunodeficiency virus type 1 molecular clones containing a cis-acting element of simian retrovirus type 1 in human peripheral blood lymphocytes.
J. Virol.
68:7944-7952[Abstract/Free Full Text].
|
Journal of Virology, February 1999, p. 948-957, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chang, K. W., Oh, J., Alvord, W. G., Hughes, S. H.
(2008). The Effects of Alternate Polypurine Tracts (PPTs) and Mutations of Sequences Adjacent to the PPT on Viral Replication and Cleavage Specificity of the Rous Sarcoma Virus Reverse Transcriptase. J. Virol.
82: 8592-8604
[Abstract]
[Full Text]
-
McWilliams, M. J., Julias, J. G., Hughes, S. H.
(2008). Mutations in the Human Immunodeficiency Virus Type 1 Polypurine Tract (PPT) Reduce the Rate of PPT Cleavage and Plus-Strand DNA Synthesis. J. Virol.
82: 5104-5108
[Abstract]
[Full Text]
-
Rausch, J. W., Le Grice, S. F. J.
(2007). Purine analog substitution of the HIV-1 polypurine tract primer defines regions controlling initiation of plus-strand DNA synthesis. Nucleic Acids Res
35: 256-268
[Abstract]
[Full Text]
-
Oh, J., Chang, K. W., Alvord, W. G., Hughes, S. H.
(2006). Alternate polypurine tracts affect rous sarcoma virus integration in vivo.. J. Virol.
80: 10281-10284
[Abstract]
[Full Text]
-
Chang, K. W., Julias, J. G., Alvord, W. G., Oh, J., Hughes, S. H.
(2005). Alternate Polypurine Tracts (PPTs) Affect the Rous Sarcoma Virus RNase H Cleavage Specificity and Reveal a Preferential Cleavage following a GA Dinucleotide Sequence at the PPT-U3 Junction. J. Virol.
79: 13694-13704
[Abstract]
[Full Text]
-
An, W., Telesnitsky, A.
(2004). Human Immunodeficiency Virus Type 1 Transductive Recombination Can Occur Frequently and in Proportion to Polyadenylation Signal Readthrough. J. Virol.
78: 3419-3428
[Abstract]
[Full Text]
-
Hlavaty, J., Stracke, A., Klein, D., Salmons, B., Gunzburg, W. H., Renner, M.
(2004). Multiple Modifications Allow High-Titer Production of Retroviral Vectors Carrying Heterologous Regulatory Elements. J. Virol.
78: 1384-1392
[Abstract]
[Full Text]
-
Wilhelm, M., Uzun, O., Mules, E. H., Gabriel, A., Wilhelm, F.-X.
(2001). Polypurine Tract Formation by Ty1 RNase H. J. Biol. Chem.
276: 47695-47701
[Abstract]
[Full Text]
-
Robson, N. D., Telesnitsky, A.
(2000). Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication. J. Virol.
74: 10293-10303
[Abstract]
[Full Text]
-
Pfeiffer, J. K., Georgiadis, M. M., Telesnitsky, A.
(2000). Structure-Based Moloney Murine Leukemia Virus Reverse Transcriptase Mutants with Altered Intracellular Direct-Repeat Deletion Frequencies. J. Virol.
74: 9629-9636
[Abstract]
[Full Text]
-
Shin Yu, S., Kim, J.-M., Kim, S.
(2000). The 17 Nucleotides Downstream from the env Gene Stop Codon Are Important for Murine Leukemia Virus Packaging. J. Virol.
74: 8775-8780
[Abstract]
[Full Text]
-
Bacharach, E., Gonsky, J., Lim, D., Goff, S. P.
(2000). Deletion of a Short, Untranslated Region Adjacent to the Polypurine Tract in Moloney Murine Leukemia Virus Leads to Formation of Aberrant 5' Plus-Strand DNA Ends In Vivo. J. Virol.
74: 4755-4764
[Abstract]
[Full Text]
-
Kelleher, C. D., Champoux, J. J.
(2000). RNA Degradation and Primer Selection by Moloney Murine Leukemia Virus Reverse Transcriptase Contribute to the Accuracy of Plus Strand Initiation. J. Biol. Chem.
275: 13061-13070
[Abstract]
[Full Text]
-
Shin, N.-H., Hartigan-O'Connor, D., Pfeiffer, J. K., Telesnitsky, A.
(2000). Replication of Lengthened Moloney Murine Leukemia Virus Genomes Is Impaired at Multiple Stages. J. Virol.
74: 2694-2702
[Abstract]
[Full Text]