Next Article 
Journal of Virology, February 1999, p. 863-870, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Transcriptional Regulation of the Human
Cytomegalovirus US11 Early Gene
Nha H.
Chau,
Cynthia D.
Vanson, and
Julie A.
Kerry*
Department of Microbiology and Molecular Cell
Biology, Eastern Virginia Medical School, Norfolk, Virginia 23501
Received 9 September 1998/Accepted 22 October 1998
 |
ABSTRACT |
The human cytomegalovirus (HCMV) US11 early gene encodes a protein
involved in the down-regulation of major histocompatibility complex
class I cell surface expression in HCMV-infected cells. Consequently,
this gene is thought to play an important role in HCMV evasion of
immune recognition. In this study, we examined the transcriptional
regulation of US11 gene expression. Analysis of deletions within the
US11 promoter suggests that two sequence elements are important for
activation by the viral immediate-early (IE) proteins. Deletion of a
CREB site located at
83 relative to the cap site resulted in a
reduction in promoter activity to 50% of the wild-type level. Deletion
of an additional ATF site immediately upstream of the TATA box resulted
in abrogation of responsiveness to the IE proteins. To confirm the role
of the CREB and ATF sites within the US11 promoter, mutagenesis of
these two sites, both individually and in combination, was carried out. Results indicate that both the CREB element and the ATF site were required for full promoter activity, with the ATF site critical for
US11 promoter activation. The loss of transcriptional activation correlated with a loss of cellular proteins binding to the mutated US11
promoter elements. In combination with the viral IE proteins, the HCMV
tegument protein pp71 (UL82) was found to up-regulate the US11 promoter
by six- to sevenfold in transient assays. These results suggest that
pp71 may contribute to the activation of the US11 promoter at early
times after infection. Up-regulation by pp71 required the presence of
the CREB and ATF sites within the US11 promoter for full activation.
The role of the ATF and CREB elements in regulating US11 gene
expression during viral infection was then assessed. The US11 gene is
not required for replication of HCMV in tissue culture. This property
was exploited to generate US11 promoter mutants regulating expression
of the endogenous US11 gene in the natural genomic context. We
generated recombinant HCMV that contained the US11 promoter with
mutations in either the CREB or ATF element or both regulating the
expression of the endogenous US11 gene. Northern blot analysis of
infected cell mRNA revealed that mutation of the CREB element reduced
US11 mRNA expression to approximately 25% of that of the wild-type promoter, with identical kinetics of expression. Mutation of the ATF
site alone reduced US11 mRNA levels to 6% of that of the wild-type promoter, with mRNA detectable only at 8 h after infection.
Mutation of both the CREB and ATF elements in the US11 promoter reduced US11 gene expression to undetectable levels. These results demonstrate that the CREB and ATF sites cooperate to regulate the US11 promoter in
HCMV-infected cells.
 |
INTRODUCTION |
The regulation of viral gene
expression in human cytomegalovirus (HCMV)-infected cells relies on a
complex interplay between cellular and viral factors. This process is
initiated by the binding of HCMV to its cellular receptor, resulting in
the enhanced expression of cellular transcription factors such as
c-Jun, c-Fos, and NF-
B, required for the initiation of viral gene
expression (3, 4, 49). Once the virus particle penetrates
the cell, HCMV gene expression follows an ordered and sequential
pathway which can be broken down into three broad classes:
immediate-early (IE), early, and late (5). The majority of
IE gene expression is directed by a complex promoter, the major IE
promoter (MIEP), which can be activated by cellular transcription
factors such as AP-1, NF-
B, and ATF/CREB (reviewed in reference
34). An HCMV tegument protein, pp71, functioning via
ATF and AP-1 sites, enhances the activation of the MIEP
(31). The IE proteins of HCMV are responsible for the
activation of subsequent viral gene expression (43, 44). The
HCMV IE2 protein, IE86, can bind directly to DNA, and binding sites for
this protein are involved in the regulation of the UL112-113 early
promoter (1, 35, 38, 39). In addition to its DNA binding
function, the IE86 protein of HCMV can interact with TATA binding
protein (TBP), TFIIB, and TBP-associated factors, as well as cellular
transcription factors such as p53, c-Jun, and CREB (6, 21, 30, 32, 37, 39, 40).
In HCMV-infected cells, transcriptional activation of early genes
relies on both cellular transcription factors and the viral IE proteins
(13, 23, 28, 30, 37, 39-41). Several subclasses of HCMV
early gene kinetics have been defined, indicating an additional level
of complexity in early gene regulation (43). One factor that
may contribute to the kinetic complexity of early gene regulation is
the presence of additional HCMV gene products able to stimulate viral
early gene expression (8, 14, 15, 24, 31, 36, 42, 48).
Previous studies assessing the activation of early promoters have
typically relied on transient assays such as cotransfection experiments
to assess promoter activity (13, 23, 28, 33, 37, 39, 41,
46). More recently, strategies have been developed to assess HCMV
early gene regulation in the context of the viral genome (24-26,
29, 35). These strategies have used a region of the HCMV genome
dispensable for growth of the virus in tissue culture (19,
20). Promoter constructs regulating the expression of reporter
genes such as the chloramphenicol acetyltransferase (CAT) gene have
been inserted into the viral genome in the unique short region between
open reading frames (ORFs) US9 and US10. These studies have
demonstrated that gene expression in the context of the viral genome is
much more complex than that found in transient assays. For example,
sequence elements that are not required for promoter activation in
transient assays can play critical roles in regulating gene expression
in the context of the viral genome (24, 25). In addition,
such studies have enabled the identification of HCMV promoter elements
that are involved in temporal regulation of early gene expression
(24, 25, 29, 35). However, these studies are hindered by the
inability to assess gene expression in the natural genomic context. Due
to the overlapping nature of HCMV transcriptional units, it is possible
that the transcription of upstream ORFs can influence transcription of
downstream genes. We have begun to address this problem by assessing
transcriptional regulation of genes within the nonessential US gene
region (19, 20). With this strategy, we can study the
regulation of endogenous genes within their natural gene environment.
The present study examines the regulation of the HCMV early gene, US11
(18, 20). This gene is nonessential for replication in
tissue culture but likely plays a critical role in HCMV pathogenesis (16, 17, 20, 47). The product of the US11 gene is an
endoplasmic reticulum glycoprotein that causes the rapid destruction of
major histocompatibility complex class I proteins, resulting in the down-regulation of cell surface expression of class I (16, 17, 47). Expression of the US11 gene can be detected within 2 h after infection of permissive cells with HCMV (18).
Interestingly, US11 is down-regulated at late times after infection,
which places it in the E1 subclass of viral early genes
(43). In this study, we focused on the transcriptional
regulation of US11 gene expression. The results demonstrate that two
ATF/CREB binding sites within the US11 promoter play significant roles
in transactivation by the viral IE proteins. The consensus ATF site
immediately adjacent to the TATA element was critical for US11 promoter
activation in transient assays. The pp71 protein was found to stimulate
activation of the US11 promoter by the IE proteins. Enhanced
transcription by pp71 was also dependent on the presence of the
ATF/CREB sites within the US11 promoter. To fully assess the role of
ATF/CREB in the regulation of this early gene, US11 promoter mutants
regulating the expression of the endogenous US11 gene were introduced
into the HCMV genome by homologous recombination. Analysis of US11 mRNA
revealed that both ATF/CREB sites within the US11 promoter contribute
to the transcriptional activation of this gene.
 |
MATERIALS AND METHODS |
Plasmids.
Plasmids pSVH, pSVOd, and pSVOCAT (9)
were obtained from R. M. Stenberg (Eastern Virginia Medical
School, Norfolk). pSVH contains the major IE genomic region expressed
under the control of the MIEP in the vector pSVOd. Mark F. Stinski
(University of Iowa, Iowa City) kindly provided plasmid pCMV71
(31), which contains the pp71 ORF downstream of the MIEP. In
addition, pCMV71dlPvuI, a carboxy-terminal deletion mutant of pCMV71
which is unable to transactivate the MIEP, was used as a control for
these experiments (31). The plasmid used for generating
recombinant viruses, pUS115'3', was kindly provided by T. R. Jones
(Wyeth-Ayerst Research, Pearl River, N.Y.). This plasmid was modified
by the elimination of a HindIII site within the
polylinker to generate pUS115'3'dH. The US11 promoter was cloned from
the HindIII site at nucleotide (nt) 205020 of the HCMV
genome to the XbaI site at nt 204555 (7) as a
HindIII fragment into the HindIII site of
the reporter vector, pSVOCAT, to generate pUS11CAT.
Generation of US11 promoter variants.
Nested deletions
within the US11 promoter were generated as previously described
(43). Briefly, the HindIII site at the 3' end
of the US11 promoter in pUS11CAT was eliminated to generate pUS11dHCAT.
This plasmid was then partially digested with either DpnI,
NlaIV, NspI, or RsaI, and the linear
DNA was isolated. The linearized DNA was then ligated to
HindIII linkers, the resultant DNA was digested with
HindIII, and the plasmid was recircularized. This
procedure results in the removal of sequences between the HindIII site 5' of the promoter and the inserted linker.
Deletions within the promoter region were selected by restriction
enzyme digestion and confirmed by DNA sequencing.
Site-directed mutagenesis of the CREB site was performed by overlapping
PCR mutagenesis using plasmid pUS11CAT with oligonucleotides CAT1
(5' GCTCTGATGCCGCATAGTTAAGCC), CAT2 (5'
GCGGGCAAGAATGTGAATAAAGGCCGG), US11Cm1 (5'
CACCGTGTTCTCCCGACGATATCACTAGATCACCACCCTG), and
US11Cm2 (5' CAGGGTGGTGATCTAGTGATATCGTCGGGAGAACACGGTG).
The mutated nucleotides are underlined. PCR using Vent DNA
polymerase (New England Biolabs, Beverly, Mass.) was performed on
pUS11CAT, using the primer pairs CAT1-US11Cm2 and CAT2-US11Cm1. This
PCR resulted in two fragments that overlap by 40 bp. The two fragments
were then combined and PCR performed with Taq DNA polymerase
(Gibco-BRL, Gaithersburg, Md.), using the CAT1-CAT2 primer pair. The
resultant fragment was digested with HindIII, and the
mutated US11 promoter fragment was recloned into pSVOCAT to generate
pUS11CmCAT. The presence of the CREB mutation was assessed by
restriction enzyme digestion as well as DNA sequencing. The construct
with the mutation in the US11 ATF site, pUS11AmCAT, was generated in a
similar manner, using primers US11Am1 (5'
CCACCCTGTTCCCCGTGAATTCCAAGACTACATGCTATAAG) and US11Am2 (5'
CTTATAGCATGTAGTCTTGGAATTCACGGGGAACAGGGTGG).
Mutation of both the ATF and CREB sites within the US11 promoter was
achieved by subjecting plasmid pUS11AmCAT to a second round of PCR
mutagenesis using primers US11Cm1 and US11Cm2. The resultant fragment
was then cloned as a HindIII fragment into pSVOCAT to
generate pUS11CAmCAT. All mutations were confirmed by restriction
enzyme digestion and DNA sequencing.
Transfections.
Cotransfection analysis of the US11 promoter
variants was performed as previously described (9, 45).
Briefly, primary human foreskin fibroblasts (HFFs) were transfected
with 10 µg of plasmid DNA by the DEAE-dextran method. Cells were
harvested 48 h after infection and assessed for CAT enzyme
activity (9).
Gel shift assays.
Gel shift analysis of proteins binding to
the CREB and ATF sites of the US11 promoter were performed essentially
as described previously (25). Briefly, the oligonucleotides
US11ATF-1 (5' CCTGTTCCCCGTGACGTGCAAGACTACAT), US11ATF-2
(5' CATGTAGTCTTGCACGTCACGGGGAACAG), US11CREB-1 (5'
GTGTTCTCCCGACGTCACTAGATCACC), and US11CREB-2 (5' GGGTGATCTAGTGACGTCGGGAGAACA) were annealed in 20 mM Tris-HCl (pH 7.5)-50 mM NaCl-10 mM MgCl2. The probes were end labeled
with [
-32P]ATP and T4 polynucleotide kinase and
purified by nondenaturing polyacrylamide gel electrophoresis followed
by electroelution. Nuclear extracts were isolated from uninfected HFFs
by a modified Dignam procedure (10, 23). Assays were
performed in 0.5× buffer D in the presence of 5 µg of
poly(dI-dC) · poly(dI-dC) and 30,000 to 40,000 cpm of probe DNA
(equivalent to 0.5 to 1 ng of probe DNA). Electrophoresis was performed
on a 4% polyacrylamide gel in 0.5× Tris-borate-EDTA buffer.
Competitor DNAs containing mutated ATF and CREB elements were generated
by annealing US11Cm1 and US11Cm2 or US11Am1 and US11Am2 as described above.
Genomic transfections and purification of recombinant
viruses.
Recombinant viruses were generated by homologous
recombination via a modified calcium phosphate transfection protocol
(20, 29). US11 promoter mutants generated in plasmid
pUS11CAT were digested with HindIII and NspI,
and the US11 promoter fragment was isolated. This fragment was then
cloned into an intermediate vector containing the
HindIII-to-XbaI US11 promoter fragment cloned into pBluescript KS(+) (Stratagene, La Jolla, Calif.). The mutant promoter regions were then cloned as
HindIII-to-XbaI fragments into the
pUS115'3'dH recombination vector digested with HindIII and XbaI. This results in the replacement of the wild-type
US11 promoter sequences with the mutated promoter fragments, upstream of the endogenous US11 ORF. The resultant plasmids were then linearized with either PstI or EcoRI and cotransfected into
primary HFFs with RV699 genomic DNA. RV699 contains the
-glucuronidase gene inserted into the US11 ORF (20).
Homologous recombination will result in the replacement of the
-glucuronidase gene region with the US11 ORF, regulated by mutant
US11 promoters. RV699 DNA for transfection was isolated as previously
described (29) or by using a GenomicPrep kit (Pharmacia
Biotech, Piscataway, N.J.). The recombinant virus, RVUS11, which
reconstructs the original AD169 genotype, was generated by the same
procedure except that the wild-type US11 promoter was used. Some
transfection experiments were performed with the addition of a plasmid,
pCMV71, that expresses the pp71 tegument protein. Studies have shown
that pp71 can enhance the infectivity of HCMV DNA (2).
Recombinant virus pools were screened for the presence of the
recombinant virus by either Southern blotting or PCR. PCR screening was
performed with Platinum Taq (Gibco Life Technologies, Grand Island,
N.Y.) on genomic DNA isolated by the GenomicPrep kit, using the primers
US11-1 (5' GTAATGCTTATTCTAGCCCTCTGGG) and US11-2 (5'
AATCACTGCCACCATCATCAGC). These primers will amplify a region of
the US11 ORF present in the recombinant viruses but absent in RV699.
Pools that showed evidence of the presence of recombinant viruses were
then screened for individual viruses lacking the
-glucuronidase gene
as previously described (29). The presence of the
appropriate mutations in the isolated recombinant viruses was confirmed
by Southern blot analysis.
Northern blot analysis.
Total-cell RNA was isolated from
infected cells by using the RNeasy system (Qiagen, Chatsworth, Calif.).
Equal quantities of RNA (5 µg) were subjected to Northern blot
analysis and hybridized to 32P-radiolabeled probe for US11.
RNA levels were quantitated by PhosphorImager (Molecular Dynamics,
Sunnyvale, Calif.) analysis. Multiplicity of infection was assessed by
stripping the Northern blots and reprobing with a
32P-radiolabeled probe to the endogenous pp28 gene (UL99).
 |
RESULTS |
Identification of US11 promoter elements required for promoter
activity.
Analysis of the US11 promoter sequence demonstrated the
presence of several putative transcription factor binding sites that could be important for promoter activity (Fig.
1). To assess the role of these sites in
US11 promoter activation, we generated a series of nested deletions
within the US11 promoter (Fig. 2A) and
analyzed their effects on US11 promoter activity in the presence of the
viral major IE proteins (Fig. 2B). Deletion of US11 promoter sequences
from
470 to
124 had little effect on US11 promoter activity,
indicating that promoter elements downstream of
124 were sufficient
for US11 promoter activation by the IE proteins. Additional deletion of
US11 promoter sequences from
124 to
70 resulted in a drop in
promoter activity to 50% of the level for the wild-type promoter. This
region contains a consensus CREB binding site at
83, suggesting that
this CREB site may contribute to activation of the US11 promoter.
Further deletion to
40 abrogated responsiveness of the US11 promoter
to the IE proteins. This deletion removes all sequences upstream of the
TATA element, including a consensus binding site for the ATF
transcription factor located at
53. Together, these data strongly
suggest that the CREB and ATF sites within the US11 promoter were
required for full promoter activity, consistent with a previous study
suggesting a role for this region in US11 promoter activation
(27).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence of the US11 promoter. The TATA element is
indicated in bold. Putative binding sites for the transcription factors
ATF, CREB, and CF1 are boxed. In addition, two copies of a direct
repeat element (DR1) as well as a palindromic sequence (P1) are
indicated.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Schematic diagram of the US11 promoter. Putative
promoter elements located within the US11 promoter (Fig. 1) and nested
deletions generated within the US11 promoter are indicated. (B)
Activation of the US11 promoter by the IE proteins. The US11 promoter
and the indicated deletion mutants were cotransfected into HFFs with a
construct (pSVH) expressing the IE gene region under the control of the
MIEP. Cells were harvested 48 h after transfection and assessed
for CAT activity. Activity is expressed relative to the wild-type
promoter at 100%. Except for the d40 deletion, the average (± standard deviation) of at least three experiments is represented.
Results for the d40 deletion represent data from two experiments. *,
P < 0.001 (student's t test).
|
|
To confirm the role of the CREB and ATF sites in US11 promoter
activity, these two elements were mutated within the context of the
entire promoter, both individually and in combination. Mutation of the
CREB site within the US11 promoter resulted in the insertion of 3 nt
(underlined) within the CREB site (CCCGACGTCACTAG to
CCCGACGATATCACTAG). Mutagenesis of the ATF site
within the US11 promoter resulted in a 3-nt substitution
(CCGTGACGTGCAA to CCGTGAATTCCAA). The effect of
mutating the US11 ATF and CREB elements on promoter activity was then
assessed (Fig. 3). Mutation of the CREB
site at
83 in the context of the entire promoter resulted in a
decrease in promoter activity to approximately 20% of the wild-type
level. These findings strongly suggest that the CREB site is the
functional element within this region. The mutation of the CREB element
within the entire US11 promoter resulted in a greater loss of promoter
activity than was observed upon deletion of this site, most likely due
to an effect of the promoter context; similar effects have been
observed with other HCMV early promoters (23). The mutation
of the ATF site located at
53 abrogated the responsiveness of the
US11 promoter to the viral IE proteins. This finding demonstrates that
the ATF site is critical for US11 promoter activity. Mutation of both
the ATF and CREB sites also resulted in the elimination of US11
promoter activation by the IE proteins. Together, these data show that
both the US11 CREB and ATF sites contribute to activation of the US11
promoter by the IE proteins.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Activation of the US11 promoter mutants by the IE
proteins. The US11 promoter and promoter variants containing mutations
in either the CREB site (Cm), the ATF site (Am), or both (CAm) were
assessed by cotransfection into HFFs with the IE proteins. Cells were
harvested 48 h after transfection and assessed for CAT activity.
Activity is expressed relative to the wild-type promoter at 100%. The
average (± standard deviation) of two experiments is represented. *,
P < 0.003.
|
|
As the US11 promoter is activated very early after infection
(20), we anticipated that the cellular proteins required for activating this promoter were likely present in uninfected cells. Figure 4 demonstrates that proteins
present in uninfected nuclear extracts were capable of binding to
oligonucleotides containing either the US11 ATF site or the CREB
element. Competition analysis with oligonucleotides containing the
wild-type CREB and ATF sites was performed. These studies showed that
DNA fragments containing the wild-type CREB and ATF sites were capable
of efficiently competing for binding to the appropriate probe DNA.
Similarly, the US11 ATF and CREB oligonucleotides were also able to
compete for binding to other known ATF/CREB binding sites
(22). However, oligonucleotides containing the mutated ATF
and CREB sites exhibited a greatly reduced ability to compete for the
wild-type DNA probes. The reduction in protein binding affinity to the
oligonucleotides containing the mutated ATF and CREB sites correlates
with the reduced activation exhibited by these mutants in
cotransfection experiments. To identify the cellular proteins
binding to the CREB and ATF sites, gel supershift analysis
was performed with specific antibodies to ATF-1, CREB, and
ATF-2 (22). However, none of these antibodies resulted
in a change in mobility of the proteins associated with the CREB or ATF site. It was noted that the protein-DNA complexes formed with either the CREB or ATF oligonucleotides migrated to the same position on the gel. In addition, it was found that the CREB
oligonucleotide was capable of efficiently competing for binding to the
ATF site and vice versa (22). Therefore, these two sites may
bind similar factors present in uninfected cell extracts.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 4.
Gel shift analysis of proteins binding to the US11 CREB
and ATF sites. Gel shift assays were performed with probes containing
the CREB or ATF site from the US11 promoter. Extracts were obtained
from uninfected HFFs. Competition analysis was performed with either a
10-, 25-, or 50-fold excess of cold competitor DNA consisting of either
the wild-type binding site or the mutated version of this site. The
image was generated with a Hewlett-Packard ScanJet IIcx with
Hewlett-Packard HP Deskscan II software (version 2.3.1) and labeled
with Microsoft PowerPoint.
|
|
Role of the UL82 tegument protein in activating the US11
promoter.
US11 mRNA can be detected within 2 h of viral
infection (18). However, this promoter exhibited a
weaker response to viral IE proteins than did other viral early
promoters (22). This level of activation appears
inconsistent with the kinetics of US11 gene expression. We
therefore wished to determine if other viral proteins were capable of
contributing to US11 promoter activation. One candidate viral protein
that could be involved in US11 promoter activation is the viral
tegument protein pp71 (UL82). This protein is postulated to enter the
cell upon viral infection and has been shown to stimulate the MIEP via
ATF and AP-1 sites (31). We accordingly tested the ability
of the pp71 protein to stimulate US11 promoter activity (Fig.
5). Figure 5 shows that in the presence of IE proteins, pp71 could stimulate US11 promoter activity six- to
sevenfold. To confirm the specificity of the promoter activation, we performed cotransfection experiments using plasmid
pCMV71dlPvuI, which expresses a truncated version of the pp71
protein and lacks the ability to activate the MIEP (31).
Cotransfection of the IE proteins with plasmid pCMV71dlPvuI did
not result in increased US11 promoter activity.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Activation of US11 promoter deletions by pp71.
pUS11dHCAT and the indicated deletion mutants were cotransfected into
HFFs with pSVH and either pCMV71 or pCMV71dlPvuI as described for Fig.
2. Cells were harvested 48 h after transfection and assessed for
CAT activity. The results are expressed as fold activation relative to
the activation by the IE proteins in the presence of the control
plasmid pCMV71dlPvuI and represent the average of three independent
experiments. *, P = 0.01. (B) Activation of the US11
promoter mutants by the pp71 tegument protein. The US11 promoter and
promoter variants containing mutations in either the CREB site (Cm),
the ATF site (Am), or both (CAm) were assessed by cotransfection into
HFFs with the IE proteins and either pCMV71 or pCMV71dlPvuI as
described for Fig. 3. Cells were harvested 48 h after transfection
and assessed for CAT activity. The results are expressed as fold
activation relative to the activation by the IE proteins in the
presence of the control plasmid pCMV71dlPvuI and represent the average
of three independent experiments. *, P 0.05.
|
|
Previous studies have demonstrated that pp71 activates promoters via
ATF and AP-1 sites (31). To determine the US11 promoter elements responsible for pp71 stimulation, we tested the ability of
pp71 to activate the US11 deletion mutants. Figure 5A demonstrates that
deletion of the CREB site at
83 (pUS11d70CAT) resulted in an
approximately twofold drop in the stimulation by pp71 of US11 promoter
activity (P = 0.03). Further deletion of the ATF site immediately upstream of the TATA element resulted in a loss of pp71
stimulation. This result suggests that pp71 activates the US11 promoter
via the ATF site located at
53. To confirm this, the US11 promoter
mutants were tested for the ability to be activated by pp71 (Fig. 5B).
Mutation of the CREB site at
83 resulted in a threefold drop in US11
promoter activation by pp71 (P = 0.05), suggesting
that this element can contribute to promoter stimulation. Cotransfection of the pp71 protein with the US11 promoter containing a
mutation in the ATF site resulted in the loss of US11 promoter stimulation compared to the IE proteins alone. Mutation of both the
CREB and ATF elements in the US11 promoter also completely abrogated
the ability of this promoter to be activated by pp71. These findings
strongly suggest that pp71 can stimulate transcription via the ATF and
CREB sites in the US11 promoter, with the ATF site being critical for activation.
Analysis of US11 gene expression in the context of the viral
genome.
Our previous results demonstrated a critical role for the
two ATF/CREB sites within the US11 promoter in regulating promoter activity in transient assays. To assess the role of the CREB and ATF
sites in regulating US11 gene expression during viral infection, we
generated recombinant viruses that contained the US11 promoter mutants
regulating expression of the endogenous US11 ORF. This approach was
possible because the US11 gene is not required for replication of the
virus in tissue culture (20). Four recombinant viruses were
generated by homologous recombination with the virus RV699,
which contains the
-glucuronidase gene inserted into the US11
ORF (20). The first virus, RVUS11, restored the
wild-type US11 promoter upstream of the US11 ORF and was used as
a control for these experiments. Three additional viruses, RVUS11Cm,
RVUS11Am, and RVUS11CAm, contained the US11 promoter with mutations in
the CREB site, the ATF site, and both, respectively. The integrity of
the viruses was confirmed by Southern blot analysis (22). US11 mRNA expression was then assessed in HFFs infected with the recombinant viruses and compared to the expression of US11 mRNA in
AD169-infected cells (Fig. 6). In all
cases, data were corrected for multiplicity of infection by assessing
the levels of UL99 mRNA expression (Table
1). Levels of expression of the US11 mRNA in AD169-infected cells were high at 8 h after infection and
declined thereafter, in accordance with previously reported analysis of US11 mRNA expression (18). Expression of the US11 gene in
cells infected with RVUS11 was indistinguishable from that in
AD169-infected cells. This result confirms that the RVUS11 virus
restores the AD169 phenotype. US11 mRNA expression in RVUS11Cm-infected
cells at 8 h after infection was reduced to approximately 24% of
that from the wild-type promoter, similar to the result observed when the CREB mutation was assessed in transient assays. Although the overall level of US11 mRNA was reduced, the kinetics of expression in
RVUS11Cm-infected cells was identical to that of the wild-type construct. Mutation of the ATF site within the US11 promoter (RVUS11Am) dramatically reduced US11 mRNA expression. Detectable levels of US11
mRNA were observed only at 8 h after infection. At this time point, US11 mRNA was 6% of that observed in AD169-infected cells; thereafter, US11 mRNA levels dropped to below detectable levels. Assessment of the RVUS11CAm virus revealed that mutation of both the
CREB and ATF elements within the US11 promoter reduced US11 gene
expression to undetectable levels. For all mutant virus constructs, as
well as the wild-type RVUS11 virus, expression of the downstream US10
gene was unaffected by the mutations in the US11 promoter region
(22). These results clearly demonstrate that the CREB and
ATF sites within the US11 promoter cooperate to activate US11 gene
expression in the context of the viral genome.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 6.
Northern blot analysis of recombinant HCMV. HFFs were
infected with 5 PFU of the indicated viruses per cell, harvested at the
indicated times, and assessed for US11 RNA levels by Northern blot
analysis utilizing a 32P-labeled probe to the US11 gene.
RNA levels were quantitated by PhosphorImager analysis. (A)
Representative Northern blot analysis of the 1.5-kb US11 mRNA in cells
infected with the recombinant viruses, as well as US11 mRNA levels in
AD169-infected cells. Values shown in panel B (average of results
from two replicate experiments) were corrected for multiplicities
of infection by stripping the blot and reprobing with a probe to the
UL99 gene and expressed relative to the level of US11 mRNA expression
in AD169-infected cells at 8 h after infection.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Northern blot analysis of US11 and UL99 mRNA levels
expressed in virus-infected cells as quantitated by
PhosphorImager analysis
|
|
 |
DISCUSSION |
Transcriptional regulation in HCMV-infected cells relies on a
complex interaction between cellular and viral transactivators (13, 23, 28, 37, 41, 43, 46). Several studies have implicated a role for the transcription factors ATF/CREB in early gene
regulation (25, 30, 35, 37, 39). For example, several early
promoters can be regulated by ATF/CREB sites in transient assays
(30, 35, 37, 39). In addition, a role for ATF/CREB in
the activation of the UL54 and UL112-113 promoters at early times
in the context of the viral genome has been demonstrated (25,
35). Our present analysis of the US11 promoter revealed that
expression of this early gene is also regulated by two ATF/CREB sites
within the promoter. The primary regulatory element of the US11
promoter, both in transient assays and in the context of the viral
genome, is an ATF site located immediately upstream of the TATA
element. In addition to the ATF site, the CREB site at
83 was also
involved in US11 promoter activation. In the context of the viral
genome, both elements were required for full activation of US11 mRNA
expression. These studies therefore add to the growing evidence for a
role of ATF/CREB in HCMV early gene regulation.
There are at least two potential mechanisms that could contribute to
activation by cellular ATF/CREB at early times in HCMV-infected cells.
First, the pp71 or UL82 viral tegument protein could influence HCMV
gene activation through ATF/CREB sites at the initial stages of
infection. This protein has previously been shown to up-regulate the
MIEP via ATF and AP-1 sites within the MIEP (31). In our present study, pp71 in combination with the IE proteins resulted in
enhanced activation of the US11 promoter. Analysis of the US11 mutants
revealed that pp71 activation of this promoter was also dependent on
the presence of the ATF and CREB sites within this promoter. Recently,
it has been demonstrated that pp71 protein from input virus can survive
in the nucleus for at least 3 h postinfection (12), a
time sufficient to activate some early promoters such as US11. However,
it is also possible that the pp71 protein could enhance US11 promoter
activity by increasing the level of the IE proteins via its effect on
the MIEP. Indeed, preliminary data indicate that pp71 can increase
steady-state levels of IE proteins approximately twofold
(22). However, at this stage we cannot rule out the
possibility that pp71 acts via a more direct mechanism to enhance IE
activation of the US11 promoter.
A second factor that could influence HCMV activation via ATF/CREB
proteins is the IE86 protein. The IE86 protein has been shown to
interact with the CREB protein in vitro (30, 37). This
interaction could contribute to activation via CREB sites at early
times after infection (35, 37). However, little is known
regarding the affinity of IE86 interactions with other ATF/CREB proteins. Our present study found that the ATF/CREB proteins binding to
the US11 promoter could not be supershifted by antibodies to ATF-1,
ATF-2, or CREB. Further studies will be required to identify the
ATF/CREB family member(s) involved in US11 promoter activation and to
determine if this protein can also interact with IE86. However, it is
clear that IE86 has the potential to play a critical role in
transcriptional activation via ATF/CREB sites within early gene
promoters at early times after infection. The role of IE86 interactions
with ATF/CREB in regulating gene expression at later times of infection
is less straightforward. High levels of the IE86 protein can be found
in infected cells at late times after infection (43). In
addition, our previous studies have demonstrated that the DNA binding
activity of one ATF/CREB subtype, ATF-1, is increased at late times
after infection (25). However, analysis of the UL54 and
UL112-113 promoters in the context of the viral genome revealed that
the ATF/CREB sites are less critical for the activation of these
promoters at late times (25, 35). In addition, results of
the present study demonstrate that two ATF/CREB sites within the US11
promoter are insufficient to activate the US11 promoter at late times
after infection. Thus, even though ATF/CREB factors and IE86 are
present in infected cells at late times, IE86 interactions with
ATF/CREB do not appear to be involved in the activation of early gene
promoters at late times. One possibility is that differential affinity
of IE86 for ATF/CREB subtypes may play a role in regulating
transcriptional activation at various stages of infection.
Alternatively, IE86 function could be modified at late times after
infection. For example, it is known that IE86 is phosphorylated in
infected cells (11). Differential phosphorylation could
potentially influence the ability of IE86 to interact with ATF/CREB
subtypes. The interaction of IE86 with IE86-related proteins such as
the p40 protein present in late infected cells (15) could
also modify the activity of IE86 at this stage of infection.
These studies analyzing the role of ATF/CREB in early gene activation
in the context of the viral genome have revealed that ATF/CREB plays an
important role in transcriptional activation at early but not late
times (24, 25, 35). This finding suggests that some early
gene promoters utilize differential mechanisms of promoter activation
at early and late times after infection. Two of these studies have
focused on early genes in the E2 subclass of HCMV early genes, UL54 and
UL112-113 (24, 25, 35). The E2 subclass of early genes is
characterized by mRNA expression at relatively constant levels
throughout the course of infection (48). Analysis of the
UL54 promoter revealed that cellular factors such as the IR1 binding
protein, which contains Sp1 as one of its components, and ATF/CREB,
were required for the activation of this promoter at early times after
infection (24, 25). However, these factors are not required
for activation of this promoter at late times after infection.
Similarly, the UL112-113 promoter is regulated primarily by a CREB site
and an IE86 binding site at early times after infection
(35). At late times, the CREB site within this promoter
plays a less significant role in UL112-113 promoter regulation. Thus,
early promoters of the E2 subclass rely on existing cellular factors
such as ATF/CREB and Sp1 for activation at early times, with additional
factors required at late times after infection. There is some evidence
for the use of alternate promoter start sites for both the UL54 and
UL112-113 promoters in late transcription (22, 35). This
finding suggests that different regions of the promoter may be required
for activation of transcription at late times. In addition, other viral
transactivators could also play a role in the activation of these early
promoters at late times (14, 24). In contrast to the E2
promoters, the US11 gene has been characterized as an E1 early gene, in
that mRNA levels are high at early times after infection and decline at
late times (43). Our analysis of the US11 promoter revealed that two ATF/CREB sites were sufficient for the activation of this
promoter at early times. Thus, the E1 subclass of early genes may
represent a class characterized by very simple promoters, with existing
cellular factors, IE proteins, and virion components such as pp71
sufficient for transcriptional activation. For these promoters, no
additional mechanisms for transcriptional activation would be proposed
to function at the late stages of infection. Thus, these studies are
allowing us to begin to dissect the mechanisms of regulation of the
different kinetic subclasses of HCMV early genes.
 |
ACKNOWLEDGMENTS |
This study was supported by Public Health Service grant AI38372
to J.A.K. from the National Institutes of Health and by American Cancer
Society grant IRG-201 to Eastern Virginia Medical School.
We express our sincere thanks to Richard M. Stenberg for helpful
discussions. We also thank Laura Cageao for advice regarding the PCR
mutagenesis procedure.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Molecular Cell Biology, Eastern Virginia Medical
School, P.O. Box 1980, 700 W. Olney Rd., Norfolk, VA 23501. Phone:
(757) 446-5663. Fax: (757) 624-2255. E-mail:
JAK{at}BORG.EVMS.EDU.
 |
REFERENCES |
| 1.
|
Arlt, H.,
D. Lang,
S. Gebert, and T. Stamminger.
1994.
Identification of binding sites for the 86-kilodalton IE2 protein of human cytomegalovirus within an IE2-responsive viral early promoter.
J. Virol.
68:4117-4125[Abstract/Free Full Text].
|
| 2.
|
Baldick, C. J., Jr.,
A. Marchini,
C. E. Patterson, and T. Shenk.
1997.
Human cytomegalovirus tegument protein pp71 (ppUL82) enhances the infectivity of viral DNA and accelerates the infectious cycle.
J. Virol.
71:4400-4408[Abstract].
|
| 3.
|
Boldogh, I.,
S. AbuBakar, and T. Albrecht.
1990.
Activation of proto-oncogenes: an immediate early event in human cytomegalovirus infection.
Science
247:561-564[Abstract/Free Full Text].
|
| 4.
|
Boldogh, I.,
S. AbuBakar,
C. Z. Deng, and T. Albrecht.
1991.
Transcriptional activation of cellular oncogenes fos, jun, and myc by human cytomegalovirus.
J. Virol.
65:1568-1571[Abstract/Free Full Text].
|
| 5.
|
Britt, W. J., and C. A. Alford.
1996.
Cytomegalovirus, p. 2493-2523.
In
B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Virology, 3rd ed. Raven Press, New York, N.Y.
|
| 6.
|
Caswell, R.,
C. Hagemeier,
C.-J. Chiou,
G. Hayward,
T. Kouzarides, and J. Sinclair.
1993.
The human cytomegalovirus 86K immediate early (IE) 2 protein requires the basic region of the TATA-box binding protein (TBP) for binding, and interacts with TBP and transcription factor TFIIB via regions of IE2 required for transcriptional regulation.
J. Gen. Virol.
74:2691-2698[Abstract/Free Full Text].
|
| 7.
|
Chee, M. S.,
A. T. Bankier,
S. Beck,
R. Bohni,
C. M. Brown,
R. Cerny,
T. Hersnell,
C. A. Hutchinson III,
T. Kouzarides,
J. A. Martignetti,
E. Preddie,
S. C. Satchwell,
P. Tomlinson,
K. M. Weston, and B. G. Barrell.
1990.
Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169.
Curr. Top. Microbiol. Immunol.
154:125-170[Medline].
|
| 8.
|
Colberg-Poley, A. M.,
L. D. Santomenna,
P. P. Harlow,
P. A. Benfield, and D. J. Tenney.
1992.
Human cytomegalovirus US3 and UL36-38 immediate-early proteins regulate gene expression.
J. Virol.
66:95-105[Abstract/Free Full Text].
|
| 9.
|
Depto, A. S., and R. M. Stenberg.
1989.
Regulated expression of the human cytomegalovirus pp65 gene: octamer sequence in the promoter is required for activation by viral gene products.
J. Virol.
63:1232-1238[Abstract/Free Full Text].
|
| 10.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 11.
|
Harel, N. Y., and J. C. Alwine.
1998.
Phosphorylation of the human cytomegalovirus 86-kilodalton immediate-early protein IE2.
J. Virol.
72:5481-5492[Abstract/Free Full Text].
|
| 12.
|
Hensel, G. M.,
H. H. Meyer,
I. Buchmann,
D. Pommerehne,
S. Schmolke,
B. Plachter,
K. Radsak, and H. F. Kern.
1996.
Intracellular localization and expression of the human cytomegalovirus matrix phosphoprotein pp71 (ppUL82): evidence for its translocation into the nucleus.
J. Gen. Virol.
77:3087-3097[Abstract/Free Full Text].
|
| 13.
|
Huang, L.,
C. L. Malone, and M. F. Stinski.
1994.
A human cytomegalovirus early promoter with upstream negative and positive cis-acting elements: IE2 negates the effect of the negative element, and NF-Y binds to the positive element.
J. Virol.
68:2108-2117[Abstract/Free Full Text].
|
| 14.
|
Iskenderian, A. C.,
L. Huang,
A. Reilly,
R. M. Stenberg, and D. G. Anders.
1996.
Four of eleven loci required for transient complementation of human cytomegalovirus DNA replication cooperate to activate expression of replication genes.
J. Virol.
70:383-392[Abstract].
|
| 15.
|
Jenkins, D. E.,
C. L. Martens, and E. S. Mocarski.
1994.
Human cytomegalovirus late protein encoded by ie2: a transactivator as well as a repressor of gene expression.
J. Gen. Virol.
75:2337-2348[Abstract/Free Full Text].
|
| 16.
|
Johnson, D. C., and A. B. Hill.
1998.
Herpesvirus evasion of the immune system.
Curr. Top. Microbiol. Immunol.
232:149-177[Medline].
|
| 17.
|
Jones, T. R.,
L. K. Hanson,
L. Sun,
J. S. Slater,
R. M. Stenberg, and A. E. Campbell.
1995.
Multiple independent loci within the human cytomegalovirus unique short region down-regulate expression of major histocompatibility complex class I heavy chains.
J. Virol.
69:4830-4841[Abstract].
|
| 18.
|
Jones, T. R., and V. P. Muzithras.
1991.
Fine mapping of transcripts expressed from the US6 gene family of human cytomegalovirus strain AD169.
J. Virol.
65:2024-2036[Abstract/Free Full Text].
|
| 19.
|
Jones, T. R., and V. P. Muzithras.
1992.
A cluster of dispensable genes within the human cytomegalovirus genome short component: IRS1, US1 through US5, and the US6 family.
J. Virol.
66:2541-2546[Abstract/Free Full Text].
|
| 20.
|
Jones, T. R.,
V. P. Muzithras, and Y. Gluzman.
1991.
Replacement mutagenesis of the human cytomegalovirus genome: US10 and US11 gene products are nonessential.
J. Virol.
65:5860-5872[Abstract/Free Full Text].
|
| 21.
|
Jupp, R.,
S. Hoffmann,
R. M. Stenberg,
J. A. Nelson, and P. Ghazal.
1993.
Human cytomegalovirus IE86 protein interacts with promoter-bound TATA-binding protein via a specific region distinct from the auto-repression domain.
J. Virol.
67:7539-7546[Abstract/Free Full Text].
|
| 22.
| Kerry, J. A. Unpublished data.
|
| 23.
|
Kerry, J. A.,
M. A. Priddy, and R. M. Stenberg.
1994.
Identification of sequence elements in the human cytomegalovirus DNA polymerase gene promoter required for activation by viral gene products.
J. Virol.
68:4167-4176[Abstract/Free Full Text].
|
| 24.
|
Kerry, J. A.,
M. A. Priddy,
T. Y. Jervey,
C. P. Kohler,
T. L. Staley,
C. D. Vanson,
T. R. Jones,
A. C. Iskenderian,
D. G. Anders, and R. M. Stenberg.
1996.
Multiple regulatory events influence human cytomegalovirus DNA polymerase (UL54) expression during viral infection.
J. Virol.
70:373-382[Abstract].
|
| 25.
|
Kerry, J. A.,
M. A. Priddy,
T. L. Staley,
T. R. Jones,
A. C. Iskenderian,
D. G. Anders, and R. M. Stenberg.
1997.
The role of ATF in regulating the human cytomegalovirus DNA polymerase (UL54) promoter during viral infection.
J. Virol.
71:2120-2126[Abstract].
|
| 26.
|
Kerry, J. A.,
M. A. Priddy,
C. P. Kohler,
T. L. Staley,
D. Weber,
T. R. Jones, and R. M. Stenberg.
1996.
Translational regulation of the human cytomegalovirus pp28 (UL99) late gene.
J. Virol.
71:981-987[Abstract].
|
| 27.
|
Kim, H.-J.
1996.
Regulation of the human cytomegalovirus US11 gene expression.
Mol. Cells
6:61-66.
|
| 28.
|
Klucher, K. M., and D. H. Spector.
1990.
The human cytomegalovirus 2.7-kilobase RNA promoter contains a functional binding site for the adenovirus major late transcription factor.
J. Virol.
64:4189-4198[Abstract/Free Full Text].
|
| 29.
|
Kohler, C. P.,
J. A. Kerry,
M. Carter,
V. P. Muzithras,
T. R. Jones, and R. M. Stenberg.
1994.
Use of recombinant virus to assess human cytomegalovirus early and late promoters in the context of the viral genome.
J. Virol.
68:6589-6597[Abstract/Free Full Text].
|
| 30.
|
Lang, D.,
S. Gebert,
H. Artl, and T. Stamminger.
1995.
Functional interaction between the human cytomegalovirus 86-kilodalton IE2 protein and the cellular transcription factor CREB.
J. Virol.
69:6030-6037[Abstract].
|
| 31.
|
Liu, B., and M. F. Stinski.
1992.
Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements.
J. Virol.
66:4434-4444[Abstract/Free Full Text].
|
| 32.
|
Lukac, D. M.,
N. Y. Harel,
N. Tanese, and J. C. Alwine.
1997.
TAF-like functions of human cytomegalovirus immediate-early proteins.
J. Virol.
71:7227-7239[Abstract].
|
| 33.
|
Luu, P., and O. Flores.
1997.
Binding of SP1 to the immediate-early protein-responsive element of the human cytomegalovirus DNA polymerase promoter.
J. Virol.
71:6683-6691[Abstract].
|
| 34.
|
Meier, J. L., and M. F. Stinski.
1996.
Regulation of human cytomegalovirus immediate-early gene expression.
Intervirology
39:331-342[Medline].
|
| 35.
|
Rodems, S. M.,
C. L. Clark, and D. H. Spector.
1998.
Separate DNA elements containing ATF/CREB and IE86 binding sites differentially regulate the human cytomegalovirus UL112-113 promoter at early and late times in the infection.
J. Virol.
72:2697-2707[Abstract/Free Full Text].
|
| 36.
|
Romanowski, M. J., and T. Shenk.
1997.
Characterization of the human cytomegalovirus irs1 and trs1 genes: a second immediate-early transcription unit within irs1 whose product antagonizes transcriptional activation.
J. Virol.
71:1485-1496[Abstract].
|
| 37.
|
Schwartz, R.,
B. Hemlich, and D. H. Spector.
1996.
CREB and CREB-binding proteins play an important role in the IE2 86-kilodalton protein-mediated transactivation of the human cytomegalovirus 2.2-kilobase RNA promoter.
J. Virol.
70:6955-6966[Abstract/Free Full Text].
|
| 38.
|
Schwartz, R.,
M. H. Sommer,
A. Scully, and D. H. Spector.
1994.
Site-specific binding of the human cytomegalovirus IE2 86-kilodalton protein to an early gene promoter.
J. Virol.
68:5613-5622[Abstract/Free Full Text].
|
| 39.
|
Scully, A. L.,
M. H. Sommer,
R. Schwartz, and D. H. Spector.
1995.
The human cytomegalovirus IE2 86-kilodalton protein interacts with an early gene promoter via site specific DNA binding and protein-protein associations.
J. Virol.
69:6533-6540[Abstract].
|
| 40.
|
Sommer, M. H.,
A. L. Scully, and D. H. Spector.
1994.
Transactivation by the human cytomegalovirus IE2 86-kilodalton protein requires a domain that binds to both the TATA box-binding protein and the retinoblastoma protein.
J. Virol.
68:6223-6231[Abstract/Free Full Text].
|
| 41.
|
Spector, D. H.
1996.
Activation and regulation of human cytomegalovirus early genes.
Intervirology
39:361-377[Medline].
|
| 42.
|
Stasiak, P. D., and E. S. Mocarski.
1992.
Transactivation of the cytomegalovirus ICP36 gene promoter requires the alpha gene product TRS1 in addition to IE1 and IE2.
J. Virol.
66:1050-1058[Abstract/Free Full Text].
|
| 43.
|
Stenberg, R. M.
1993.
Immediate-early genes of human cytomegalovirus: organization and function, p. 330-359.
In
E.-S. Huang (ed.), Molecular aspects of human cytomegalovirus diseases. Springer-Verlag, Heidelberg, Germany.
|
| 44.
|
Stenberg, R. M.
1996.
The human cytomegalovirus major immediate-early gene.
Intervirology
39:343-349[Medline].
|
| 45.
|
Stenberg, R. M.,
J. Fortney,
S. W. Barlow,
B. P. Magrane,
J. A. Nelson, and P. Ghazal.
1990.
Promoter-specific trans activation and repression by human cytomegalovirus immediate-early proteins involves common and unique protein domains.
J. Virol.
64:1556-1565[Abstract/Free Full Text].
|
| 46.
|
Wade, E. J.,
K. M. Klucher, and D. H. Spector.
1992.
An AP-1 binding site is the predominant cis-acting regulatory element in the 1.2-kilobase early RNA promoter of human cytomegalovirus.
J. Virol.
66:2407-2417[Abstract/Free Full Text].
|
| 47.
|
Wiertz, E. J.,
T. R. Jones,
L. Sun,
M. Bogyo,
H. J. Geuze, and H. L. Ploegh.
1996.
The human cytomegalovirus US11 gene product dislocates MHC class I heavy chains from the endoplasmic reticulum to the cytosol.
Cell
84:769-779[Medline].
|
| 48.
|
Winkler, M.,
S. A. Rice, and T. Stamminger.
1994.
UL69 of human cytomegalovirus, an open reading frame with homology to ICP27 of herpes simplex virus, encodes a transactivator of gene expression.
J. Virol.
68:3943-3954[Abstract/Free Full Text].
|
| 49.
|
Yurochko, A. D.,
E.-S. Hwang,
L. Rasmussen,
S. Keay,
L. Pereira, and E. S. Huang.
1997.
The human cytomegalovirus UL55 (gB) and UL75 (gH) glycoprotein ligands initiate the rapid activation of Sp1 and NF- B during infection.
J. Virol.
71:5051-5059[Abstract].
|
Journal of Virology, February 1999, p. 863-870, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cantrell, S. R., Bresnahan, W. A.
(2006). Human Cytomegalovirus (HCMV) UL82 Gene Product (pp71) Relieves hDaxx-Mediated Repression of HCMV Replication.. J. Virol.
80: 6188-6191
[Abstract]
[Full Text]
-
Preston, C. M., Nicholl, M. J.
(2006). Role of the cellular protein hDaxx in human cytomegalovirus immediate-early gene expression.. J. Gen. Virol.
87: 1113-1121
[Abstract]
[Full Text]
-
Bego, M., Maciejewski, J., Khaiboullina, S., Pari, G., St. Jeor, S.
(2005). Characterization of an Antisense Transcript Spanning the UL81-82 Locus of Human Cytomegalovirus. J. Virol.
79: 11022-11034
[Abstract]
[Full Text]
-
Cantrell, S. R., Bresnahan, W. A.
(2005). Interaction between the Human Cytomegalovirus UL82 Gene Product (pp71) and hDaxx Regulates Immediate-Early Gene Expression and Viral Replication. J. Virol.
79: 7792-7802
[Abstract]
[Full Text]
-
Forgacs, E., Gupta, S. K., Kerry, J. A., Semmes, O. J.
(2005). The bZIP Transcription Factor ATFx Binds Human T-Cell Leukemia Virus Type 1 (HTLV-1) Tax and Represses HTLV-1 Long Terminal Repeat-Mediated Transcription. J. Virol.
79: 6932-6939
[Abstract]
[Full Text]
-
Preston, C. M., Nicholl, M. J.
(2005). Human Cytomegalovirus Tegument Protein pp71 Directs Long-Term Gene Expression from Quiescent Herpes Simplex Virus Genomes. J. Virol.
79: 525-535
[Abstract]
[Full Text]
-
Fang, L., Stevens, J. L., Berk, A. J., Spindler, K. R.
(2004). Requirement of Sur2 for Efficient Replication of Mouse Adenovirus Type 1. J. Virol.
78: 12888-12900
[Abstract]
[Full Text]
-
Kronschnabl, M., Stamminger, T.
(2003). Synergistic induction of intercellular adhesion molecule-1 by the human cytomegalovirus transactivators IE2p86 and pp71 is mediated via an Sp1-binding site. J. Gen. Virol.
84: 61-73
[Abstract]
[Full Text]
-
Hannenhalli, S., Levy, S.
(2002). Predicting transcription factor synergism. Nucleic Acids Res
30: 4278-4284
[Abstract]
[Full Text]
-
Ishov, A. M., Vladimirova, O. V., Maul, G. G.
(2002). Daxx-Mediated Accumulation of Human Cytomegalovirus Tegument Protein pp71 at ND10 Facilitates Initiation of Viral Infection at These Nuclear Domains. J. Virol.
76: 7705-7712
[Abstract]
[Full Text]
-
Marshall, K. R., Rowley, K. V., Rinaldi, A., Nicholson, I. P., Ishov, A. M., Maul, G. G., Preston, C. M.
(2002). Activity and intracellular localization of the human cytomegalovirus protein pp71. J. Gen. Virol.
83: 1601-1612
[Abstract]
[Full Text]
-
Hofmann, H., Sindre, H., Stamminger, T.
(2002). Functional Interaction between the pp71 Protein of Human Cytomegalovirus and the PML-Interacting Protein Human Daxx. J. Virol.
76: 5769-5783
[Abstract]
[Full Text]
-
Gawn, J. M., Greaves, R. F.
(2002). Absence of IE1 p72 Protein Function during Low-Multiplicity Infection by Human Cytomegalovirus Results in a Broad Block to Viral Delayed-Early Gene Expression. J. Virol.
76: 4441-4455
[Abstract]
[Full Text]
-
Johnson, R. A., Ma, X.-L., Yurochko, A. D., Huang, E.-S.
(2001). The role of MKK1/2 kinase activity in human cytomegalovirus infection. J. Gen. Virol.
82: 493-497
[Abstract]
[Full Text]
-
Bresnahan, W. A., Shenk, T. E.
(2000). UL82 virion protein activates expression of immediate early viral genes in human cytomegalovirus-infected cells. Proc. Natl. Acad. Sci. USA
97: 14506-14511
[Abstract]
[Full Text]
-
Johnson, R. A., Huong, S.-M., Huang, E.-S.
(2000). Activation of the Mitogen-Activated Protein Kinase p38 by Human Cytomegalovirus Infection through Two Distinct Pathways: a Novel Mechanism for Activation of p38. J. Virol.
74: 1158-1167
[Abstract]
[Full Text]