Previous Article | Next Article 
Journal of Virology, February 1999, p. 1399-1410, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mutational Analysis of the Avian Adenovirus CELO,
Which Provides a Basis for Gene Delivery Vectors
Anne-Isabelle
Michou,
Heike
Lehrmann,
Mediyha
Saltik, and
Matt
Cotten*
Institute for Molecular Pathology, 1030 Vienna, Austria
Received 23 July 1998/Accepted 20 October 1998
 |
ABSTRACT |
The avian adenovirus CELO is being developed as a gene transfer
tool. Using homologous recombination in Escherichia coli, the CELO genome was screened for regions that could be deleted and
would tolerate the insertion of a marker gene (luciferase or
enhanced green fluorescent protein). For each mutant genome, the
production of viable virus able to deliver the transgene to target
cells was monitored. A series of mutants in the genome identified a set of open reading frames that could be deleted but which
must be supplied in trans for virus replication. A region of the genome which is dispensable for viral replication and allows the
insertion of an expression cassette was identified and a vector based
on this mutation was evaluated as a gene delivery reagent. Transduction
of avian cells occurs at 10- to 100-fold greater efficiency (per virus
particle) than with an adenovirus type 5 (Ad5)-based vector
carrying the same expression cassette. Most important for gene
transfer applications, the CELO vector transduced mammalian
cells as efficiently as an Ad5 vector. The CELO vector is
exceptionally stable, can be grown inexpensively in chicken embryos, and provides a useful alternative to Ad5-based vectors.
 |
INTRODUCTION |
Adenovirus has been studied for its
role in human disease (25), as a model for many important
discoveries in molecular biology, including mRNA splicing, DNA
replication, transcription, and cell transformation (reviewed in
reference 44), and more recently as a powerful
reagent for transient gene expression (12, 46). A detailed
description of the adenovirus life cycle is well established (reviewed
in reference 50). Since the initial efforts to use adenovirus as a gene transfer vector (18, 27, 52), the virus has gained in popularity as a vector and a number of methods of generating alterations in the viral genome to carry novel genes have
been developed (see references 2, 5, 11, 15, 21, 23, 26, 32,
38, 41, 43, and 48 and the reviews in references 31 and 49). Because of
the ease of vector construction and purification and because these
vectors have a potent ability to transiently transduce novel genetic
material into a variety of mammalian cell types in vivo, adenovirus
vectors were used extensively in early efforts at clinical gene
therapy. Unfortunately, several features of the adenovirus type 5 (Ad5)-based vectors initially used have limited the success in the
initial applications. These included both the host immune response to
adenovirus (reviewed in reference 55) as well as the
failure of the virus to efficiently enter certain target cell
types (20, 58, 59). Thus, there is now an interest in
adenovirus types that could provoke less aggressive host immune
responses and could enter target cells with greater efficiency.
A large number of alternate adenovirus serotypes are known and may
provide advantages in some applications over Ad5-based vectors.
Additional adenoviruses that have recently been modified as vectors
include the ovine adenovirus 287 (53, 56), the bovine
adenovirus type 3 (40, 60), and the canine adenovirus (30). It is considered that these alternate serotypes would provide a novel vector backbone to which there is no preexisting immune
response in the target host. Furthermore, because adenoviruses are
extremely species specific in their replication capacity
(50), a degree of security against inappropriate vector
replication is gained by using an vector derived from a distant species
of adenovirus.
CELO (chicken embryo lethal orphan or fowl adenovirus type 1; reviewed
in reference 39) was characterized as an infectious agent in 1957 (57). However, there are few serious health or economic consequences of CELO virus infection. CELO can be isolated from healthy chickens and, in general, does not cause disease when
experimentally reintroduced into chickens (10).
CELO virus is structurally similar to the mammalian adenoviruses, with
an icosahedral capsid of 70 to 80 nm made up of hexon and penton
structures (33); the CELO virus genome is a linear, double-stranded DNA molecule with the DNA condensed within the virion
by virus-encoded core proteins (33, 36). CELO virus has a
larger genome than Ad5 (44 kb versus ca. 36 kb [6]). The CELO virion has been reported to have two fibers of different lengths at each vertex (24, 33, 35) rather than the single fiber of most other serotypes (reviewed in reference
50). CELO virus is not able to complement the E1A
functions of Ad5, and CELO virus replication is not facilitated by Ad5
E1 activity (37). The complete DNA sequence of CELO
(6) revealed additional differences between CELO virus and
the mastadenoviruses, including the absence of sequences corresponding
to the Ad5 early regions E1A, E1B, E3, and E4. The CELO genome contains
approximately 5 kb of sequence at the left end and 12 kb at the right
end, rich in open reading frames, which have no sequence homology to
Ad5 but probably encode the early functions of the virus.
We are developing CELO into a gene delivery vector. The virus is
naturally defective in mammalian cells, and this property should limit
the possibility of complementation by wild-type mammalian adenovirus.
The CELO virion has increased DNA packaging capacity and much greater
physical stability than the Ad5 virion. One practical feature of CELO
is the ability to grow the virus in chicken embryos, a system of low
cost and high convenience (9, 33).
This article reports our efforts to characterize the frontier sequences
of CELO, i.e., the leftmost 5 kb and rightmost 13 kb of the CELO genome
that are largely unexplored and are not common to other
adenoviruses. A series of altered CELO genomes were constructed,
bearing specific deletions combined with the insertion of a luciferase
expression cassette. The modified CELO genomes were engineered as
bacterial plasmids using homologous recombination in Escherichia
coli (5). Subsequently, after their release from the
plasmid backbone by enzymatic digestion, the viral genomes were
transfected into a chicken cell line supporting wild-type CELO virus
replication. Monitoring the production of luciferase in cells treated
with lysates of the initial transfectants allowed us to determine if
virus replication and production of transducing viral particles had
occurred. These strategies were used to determine the essential
portions of both left and right frontier sequence. As anticipated, some
of the sequences were required in cis and presumably
these contain packaging signals, transcriptional promoters, or other
transcription signals. In addition, this study has defined a
number of virus sequences that were essential for virus replication yet
could be supplied in trans. This information will be useful
in the design of subsequent replication-defective viruses and
complementing cell lines.
A major practical outcome of this study was the development of a CELO
vector, CELO AIM46, that carries a deletion of CELO sequence near the
right end of the genome, allows the insertion of an expression cassette
for novel genes, and replicates without complementation. Cell tropism
studies with CELO AIM46 demonstrated that the CELO derivative delivered
genes into avian cells with efficiencies 10- to 100-fold better than an
Ad5 vector. Surprisingly, in a variety of mammalian cell types, CELO
AIM46 functions with efficiencies that are comparable to those of an
Ad5 vector, demonstrating the utility of CELO vectors for mammalian
gene transfer applications.
 |
MATERIALS AND METHODS |
Cloning the terminal fragments of the CELO genome.
The two
terminal HindIII fragments of CELO were cloned. CELO
genomic DNA (CsCl purified) was digested with HindIII;
the 1,601-bp left end fragment and the 959-bp right end fragment were
purified from a low-melting-point agarose gel. The 5' ends of
adenovirus genomes are linked by a phosphodiester bond to a serine
residue on the viral terminal protein (22, 47). The peptide
remaining after proteinase digestion must be removed to allow ligation
and cloning. Accordingly, the terminal peptides were removed from the
DNA fragments by adding NaOH to 0.3 N and heating at 37°C for 90 min
(22). The solutions were then cooled to room temperature; Tris pH 7.4 was added to 0.1 M and HCl was added to 0.3 M to neutralize the NaOH. The fragments were heated to 56°C for 20 min and slowly cooled to room temperature (1 h) to facilitate reannealing. The DNA was
then purified (Qiaquick column; Qiagen), SpeI linkers (New
England Biolabs; catalog no. 1085) were added, and each fragment was
cloned via SpeI and HindIII sites into a
pBR327 (GenBank accession no. L08856 [51]) derivative
containing an SpeI site in a destroyed EcoRI site
(Fig. 1A). Both the left and the right
terminal HindIII fragments were cloned in this manner,
and DNA sequence analysis was performed to verify the terminal 300 bp
of both fragments.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
Construction of plasmids carrying wild-type and mutant
CELO genomes. (A) Construction of a plasmid bearing the termini of the
CELO genome. CELO genomic DNA was digested with HindIII,
and the two terminal fragments were isolated, treated to remove the
terminal peptides, and cloned as SpeI-HindIII
fragments after the addition of SpeI linkers to generate the
plasmid pWü-H35. (B) Cloning of full-length CELO genome as a
bacterial plasmid. pWü-H35 was linearized with
HindIII and recombined with CELO genomic DNA to generate
the full-length plasmid clones of the CELO genome. The natural terminal
repeats were flanked by SpeI sites to allow excision of the
viral genome from the bacterial plasmid. There are no SpeI
sites within the CELO genome. (C) Cloning of modified versions of the
CELO genome. Transfer vectors were produced by manipulating
subfragments of the CELO genome, as either pWü-H35 (with the
terminal HindIII fragments of CELO) or pWüHpa
(with the terminal HpaI fragments of CELO), using standard
ligation cloning methods in order to delete portions of the CELO genome
and insert a luciferase cassette. The linearized transfer vector was
recombined with wild-type genomic CELO DNA. Recombination occurs in two
ways, either to include the deletion/luciferase cassette or to exclude
the deletion/luciferase cassette to generate a wild-type CELO plasmid.
Plasmids bearing the desired mutation were identified and used to
initiate virus infection.
|
|
Subsequently, the two CELO end fragments were cloned into a pBR327
derivative containing an
SpeI site, a destroyed
EcoRI site,
and a
ClaI/
BamHI excision
to remove the second
HindIII site, creating
the plasmid
pWü-H35 (Fig.
1A). Details and full sequence information
of these
intermediate plasmids are available upon
request.
Cloning the entire CELO genome.
HindIII-linearized, alkaline phosphatase-treated
pWü-H35 vector was mixed with purified CELO virus DNA and
introduced into electrocompetent E. coli JC8679 (17,
42) by electroporation. Recombination between the CELO terminal
sequences on pWü-H35 and the termini of the CELO genomic DNA
generated a plasmid containing a full-length CELO genome (pCELO)
flanked by SpeI sites (Fig. 1B).
Modifications in the left end of the CELO genome.
The
luciferase cassette containing the cytomegalovirus (CMV)
immediate-early enhancer/promoter and luciferase cDNA (14) followed by a rabbit
-globin intron/polyadenylation signal was derived from pCLuc (45), modified by PCR to add flanking
BamHI sites, and cloned into pBlueScript II (SK) to generate
pBlueLuc. For most of the CELO insertions, the luciferase cassette was
isolated from pBlueLuc by BamHI digestion and the termini
were made blunt by treatment with Klenow enzyme.
Modifications of the left end CELO region were made by using pAIM3,
which contains, on a pBR327 backbone, the CELO left end
(nucleotide
[nt] 1 to 5501) and a portion of the right end (nt
30500 to 30639 and
nt 40065 to 43804; derived by removing an
Asp718
fragment
from pWüHpa). The deletions in the CELO genome involved
digestion
of pAIM3 at two enzyme sites in the CELO left end sequence,
excision of
the subregion, and then insertion of a luciferase
cassette. All
manipulations were confirmed by restriction analysis
and sequence
analysis. This strategy was used to generate the
transfer plasmids
pAIM7, -16, -22, -23, and -24 (Table
1).
Note
that the CELO nucleotide sequence numbering is derived from
reference
6 and GenBank accession no.
U46933.
Generation of recombinant CELO genomes.
The plasmids pAIM7,
-16, -22, -23, and -24 were linearized by double digestion, using
Asp718 and HpaI, and recombined with purified
CELO DNA by homologous recombination in E. coli BJ5183 (5, 13) to generate the CELO genome plasmids pAIM11, -21, -25, -26, and -27 (Fig. 1C and Tables 1 and
2). Restriction enzyme digestions were
performed to identify the correct recombinants. Furthermore, all
constructs were sequenced across the deleted regions to verify the
constructs (Table 1).
Modifications in the right end of the CELO genome.
Using
methods similar to those described above, plasmids containing both the
left and right HpaI fragments of CELO were generated and
manipulated to insert the luciferase cassette and to remove an
EcoRV fragment from either nt 33358 to 43684 (pAIM43) or nt 41731 to 43684 (pAIM44). These plasmids were linearized at the unique
HpaI site and recombined in BJ5183 cells with wild-type CELO
DNA to generate either pAIM45 or pAIM46.
Evaluation of the recombinant CELO genomes on LMH cells and
preparation of viral stocks.
The recombinant CELO plasmids were
digested with SpeI to release the viral genome from the
plasmid, extracted with phenol and chloroform, and then purified by gel
filtration (Pharmacia Nick Column) equilibrated with TE (10 mM Tris
[pH 7.5], 0.1 mM EDTA).
Transfection complexes were prepared using a modification of the PEI
technique (
1,
3). The DNA was condensed with PEI
in two
steps as follows: PEI,
Mr, 2,000 (2.5 µl of 10 mM PEI in
125 µl of HBS [150 mM NaCl, 20 mM HEPES, pH 7.4]), was
added dropwise
to 3 µg of DNA diluted in 125 µl of HBS. The sample
was incubated
at room temperature for 20 min. Subsequently, PEI,
Mr, 25,000
(3.5 µl of 10 mM PEI in 125 µl of
HBS) was added dropwise to the
sample, and the complex was incubated at
room temperature for
an additional 20
min.
Leghorn male hepatoma (LMH) cells (
28) were seeded the day
before transfection in 24-well plates at 7 × 10
4
cells per well (24-well dish). For transfection, the cell culture
medium was replaced by 400 µl of Dulbecco modified Eagle medium
(DMEM) supplemented with 10 µg of polymyxin B (no serum)/ml. The
transfection complex (90 µl per well) was added to the cells for
4 h at 37°C, after which the medium was replaced with fresh,
serum-containing
medium. Transfection efficiency was monitored by
measuring luciferase
activity in cell lysates at 24 h
posttransfection.
To test for amplification of virus, cleared lysates from transfected or
transduced cells were prepared as follows. Cells plus
supernatant were
harvested and collected by centrifugation, and
the cell pellets were
resuspended in 2 ml of processed supernatant.
The material was frozen
and thawed three times and sonicated in
a bath sonicator to release
viral particles, the cell debris was
removed by centrifugation, and the
cleared lysate was used for
further amplification on fresh cultures of
LMH cells. CELO purification
by CsCl gradient was performed as
previously described (
9).
Virus was quantified based on
protein content, with a conversion
factor of 1 mg protein/ml equal to
3.4 × 10
12 virus particles/ml (
34).
Construction of EGFP expressing CELO AIM53.
The luciferase
cDNA in pAIM46 was replaced by a enhanced green fluorescent protein
(EGFP) cDNA to generate pAIM53. The replacement was obtained by
homologous recombination in E. coli between pAIM46, linearized at the unique PacI site in the luciferase cDNA,
and pAIM52, a transfer plasmid carrying an EGFP cDNA under the control of the same CMV promoter, and the
-globin intron and polyadenylation signal used in the luciferase cassette of pAIM46, thus providing homologies for recombination.
Generation of recombinant type 5 adenoviruses. (i) AdLuc.
The luciferase cassette was cloned via the flanking BamHI
sites into pDE1sp1B (2), to produce pDE1sp1BLuc, with the
luciferase cDNA in the same orientation as E1 transcription.
Recombinant virus was generated by using recombination after
cotransfecting pDE1sp1BLuc with pJM17 (2) into 293 cells
(19). At 10 days posttransfection, cell lysates were
prepared and used to infect fresh 293 monolayers and virus was
amplified from a single plaque. The virus stock used here was prepared
from material that was subsequently passed through two additional
rounds of plaque purification, amplified, purified by banding in CsCl,
and quantified by protein content (1 mg/ml protein = 3.4 × 1012 virus particles/ml) (34).
(ii) AdGFP.
A fragment containing the CMV promoter, EGFP
coding region, and simian virus 40 poly(A) sequences was excised from
pEGFP-C1 (Clontech), using AseI/MluI. Overhanging
ends were filled in by Klenow and cloned into the EcoRV site
of pDE1sp1B (2), with the EGFP cassette in the same
orientation as E1 transcription. Recombinant virus was generated as
described above by using recombination with pJM17 in 293 cells.
Analysis of heat stability of viruses.
CELO AIM46 and AdLuc
were diluted to 4 × 109 particles/100 µl
concentration in HBS (final glycerol concentration was 2.4%
[vol/vol]) and exposed for 30 min to temperatures ranging from 48 to
68°C. Subsequently, aliquots of the virus were tested for the ability to transduce luciferase activity into either A549 or CEF38 cells.
Immunofluorescence.
LMH cells were plated on gelatin-coated
glass slides (Labtek; Nunc) at 105 cells/chamber and
infected the next day with CELO virus ranging from 10 to 1,000 viral
particles/cell in DMEM medium containing 2% fetal calf serum (FCS). At
the indicated times after the infection, cells were fixed in cold
methanol-acetone (1:1) at room temperature and CELO proteins were
visualized by immunofluorescence as follows. Nonspecific binding sites
were blocked by using phosphate-buffered saline (PBS) + 1% bovine
serum albumin (BSA) at room temperature for 1 h. Polyclonal
anti-CELO antibody was diluted 1:1,000 in PBS + 1% BSA and
incubated for 1 h. After three 5-min washes in PBS at room
temperature, a goat-anti-rabbit (Boehringer-Mannheim) detection
antibody coupled to fluorescein isothiocyanate (1:400 dilution) was
added in PBS + 1% BSA. The slides were again washed, 4',6-diamidino-2-phenylindole (DAPI) was included in the last wash for
visualization of the nuclei, and the slides were mounted in Mowiol for
examination by fluorescence microscopy.
Generation of anti-CELO virion polyclonal serum.
Rabbits
were injected with 100 µg of CsCl-purified, heat-inactivated (70°C
for 60 min) CELO virions in complete Freund's adjuvant, they were
boosted at 2, 4, and 5 weeks with 100 µg of CELO in incomplete
Freund's adjuvant, and serum was collected subsequently. Western
analysis demonstrated that the pooled sera used here reacted specifically with all major CELO capsid proteins but not with lysates
of noninfected avian cells.
Additional reagents.
Wild-type CELO (FAV-1 and Phelps) virus
was originally obtained from G. Monreal (Free University of Berlin) and
purified from infected chicken embryos as previously described
(9).
The LMH cell line (
28) was obtained from Ulla Protzer (ZMBH,
Heidelberg, Germany), the A549 cell line was from the ATCC,
the chicken
fibroblast CEF38 cell line was obtained from Martin
Zenke (MDC, Berlin,
Germany), and healthy human dermal fibroblasts
were obtained from
Clonetics and were used between passages 5
and 15; all four cell types
were cultured in DMEM-10% FCS. The
293 cell line (
19) was
from the ATCC and was cultured in MEMalpha
with 10% newborn calf
serum.
 |
RESULTS |
Construction of a plasmid copy of the CELO genome.
Initially,
the terminal HindIII fragments of CELO were purified
from CELO virus DNA, treated with base to remove the terminal peptides,
linkers encoding SpeI restriction sites were added, and the
two terminal fragments were cloned in the correct orientation into a
low-copy-number plasmid (Fig. 1A and Materials and Methods). This
plasmid, encoding the two ends of the virus (pWü-H35), was linearized with the unique HindIII site and recombined
with CELO genomic DNA to generate a full-length CELO genome flanked by
SpeI sites on a bacterial plasmid (Fig. 1B). Several
independent clones of the viral genome were obtained, and the correct
structure was verified by restriction analysis and by the production of
virus upon transfection (results not shown).
Analysis of unique sequences required for virus replication.
We developed a screening method for determining the requirement of CELO
sequences for virus replication. Deletions were first introduced into
bacterial plasmid copies of the viral genome by using homologous
recombination in bacteria. In all cases, the deleted viral sequences
were replaced with a luciferase cassette to allow monitoring of both
the initial transfection efficiency into cells that support wild-type
virus replication and the replication and transduction potential of the
mutant virus in subsequent passages. As will be shown below,
the CELO genome allows the insertion of at least 2 kb of sequence
beyond the wild-type genome size; thus, the concern that introducing
the luciferase cassette itself might impair replication was not
realized. The mutant viral genomes were excised from the plasmid and
transfected into LMH cells either alone, to determine if the deletion
removed essential DNA sequences, or with a plasmid bearing the region
of the CELO genome that spans the deletion, to determine if
complementation of the deletion could occur. Five days after
transfection, the cells were lysed, a portion of the lysate was assayed
for luciferase activity to monitor transfection efficiency, and a
second portion was used to infect a fresh monolayer of LMH cells. After
another 5-day period, the cells were monitored for cytopathic effect
and lysates were prepared and assayed for luciferase and a portion was
again used to infect fresh LMH cells.
Analysis of CELO left end.
Using the strategy described
above, the unique left-end CELO sequences were analyzed for
replication function. The map of the left-end open reading frames
(ORFs) of 99 amino acids and larger is shown in the upper portion of
Fig. 2. An ORF encoding a
functional dUTPase is found at position 784 (54).
An ORF beginning at position 1991 encodes a protein with significant
homology to the parvovirus rep gene. An additional five ORFs
are also indicated. Mutant genomes were constructed that removed
first the entire region (pAIM11) or deleted single or small groups
of ORFs (pAIM21, -25, -26, and -27). The genome plasmids were
introduced into LMH cells by transfection. pAIM11, which has a
deletion removing the entire region, was positive for luciferase in the
first lysate but unable to transfer luciferase gene expression in
subsequent passaging attempts, either in the absence or presence of a
complementing left-end fragment (Fig. 2). A more discrete mutant
(pAIM21) disrupts only three of the unknown ORFs but leaves intact the
dUTPase and the rep-like ORFs. However, similar to
pAIM11, the pAIM21 genome was also unable to transfer luciferase gene
expression in subsequent passaging attempts either in the absence or
presence of a complementing left-end fragment (Fig. 2). Thus, both of
the mutations alter sequences that must be present in cis
for virus replication. pAIM27 deletes only rep, while pAIM25
and -26 delete the dUTPase, rep, and one unknown ORF.
These three genomes all produced luciferase activity in the first
lysate. Subsequent passage of the material revealed that CELO AIM25,
-26, and -27 were not capable of replicating in the absence of
complementation. However, unlike pAIM11 and -21, passageable luciferase
activity was observed if the initial transfection contained the
complementing left-end plasmid (Fig. 2). These three complemented
viruses (CELO AIM25+, -26+, and -27+) were amplified for an additional
six passages in LMH cells with, surprisingly, only modest declines in
their ability to transduce luciferase activity (results not shown). PCR
and Southern analysis revealed a substantial contribution of
apparently wild-type CELO in the passage three material,
demonstrating that recombination had occurred that reintroduced
the sequences deleted in the original mutants. Thus, an apparently
wild-type CELO was produced which provided complementation
functions for the luciferase-bearing mutant CELO.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of CELO left-end mutations. (Top) ORFs of
greater than 99 amino acids in the left ~5,000 nt of the CELO genome
are indicated in either black (rightward transcription) or grey
(leftward transcription). The ORFs coding for a dUTPase and a
protein with parvovirus rep homologies are indicated.
(Bottom) Analysis of replication. The nucleotide numbers of deletions
introduced into the CELO genome are listed. The modified CELO genomes
were linearized with SpeI to release the genome from the
bacterial plasmid and transfected into LMH cells either alone or in the
presence of a plasmid (pB5.5) bearing wild-type CELO sequences from nt
1 to 5501 (plus left end). At 5 days posttransfection, cells were
harvested and lysed by freezing-thawing and sonication and the lysates
were applied to a fresh LMH culture. This amplification was repeated
twice, and equal aliquots from the third passage of virus were tested
for their ability to transduce luciferase activity in LMH cells. The
averages of three transductions with the standard deviations are
indicated.
|
|
In conclusion, of the left-end sequences, a region was identified
(between nt 2981 and 4334) that is essential in
cis for
virus replication. This requirement could be due to the presence
of
cis-acting signals (e.g., polyadenylation sites) in the
deleted
region or it could be due to inappropriate or insufficient
protein
expression from ORFs carried on the plasmid rather than within
the virus genome. A second region was identified (between nt 940
and 2900) which is essential for virus replication but could be
supplied in
trans. Formally, it is possible that a series of
recombination
events generated a viral genome that contained both the
originally
deleted sequence and the luciferase cassette; however, the
simplest
explanation of this pattern is that a simple recombination
occurred
between pB5.5 and the mutant CELO genome to generate a
wild-type
CELO genome, which in subsequent passages provided
complementation
activity for a small number of the mutant (luciferase
positive)
viruses in the mixture. Some of these viral genomes contain
net
insertions of sequence over the wild-type size, with the largest
containing a 1,612-bp deletion combined with a 3.3-kb luciferase
cassette insertion. Thus CELO virus, which in the wild-type form
is
already 8 kb larger than Ad5, can package, at least, an additional
1,700 bp of
sequence.
A portion of the CELO right end is dispensable.
A similar
mutational strategy was used for an analysis of the right-end sequences
of CELO. The genome plasmid pAIM45 contains a large deletion from 33358 to 43684, deleting 10 ORFs of 99 amino acids or larger, including the
previously characterized GAM1 gene (Fig.
3) (7). The plasmids pAIM46,
pAIM69, and pAIM70 contain more discrete deletions and disrupts either
two ORFs (pAIM46 and -69) or three ORFs (pAIM70; Fig. 3). All of these
mutant genomes included a luciferase cassette in place of the deleted
sequences.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of CELO right-end mutations. Analysis was
performed as outlined in the legend to Fig. 2 except that the right-end
complementing plasmid pB13.3 was used in place of the pB5.5 (plus right
end).
|
|
The genomes were transfected into LMH cells either alone or with a
plasmid bearing the wild-type CELO right-end sequences
(pB13.3).
Luciferase activity was determined for lysates of the
transfected cells
demonstrating successful transfection (results
not shown). Subsequent
passage of the material on fresh LMH cells
revealed that pAIM45, with
the extensive right-end deletion, was
not capable of generating
infectious CELO particles, either in
the absence or in the presence of
the intact right-end sequences
(Fig.
3). Not surprisingly, this
extensive deletion removed sequences
that were essential and most
likely some of these are required
in
cis, as evidenced by
the absence of complementation by the
wild-type right-end sequences. In
contrast, the pAIM46, -69, and
-70 genomes were found to generate
infectious and passageable
virus in both the presence or the absence of
the complementing
genome fragment (Fig.
3). The disrupted ORFs in
pAIM46, -69, and
-70 are thus dispensable for cell culture growth of
CELO as well
as for growth in chicken embryos (see
below).
To verify the structure of pAIM46 and of the genome carried by CELO
AIM46, a PCR analysis was performed to demonstrate that
the
deletion/insertion constructed in the plasmid was maintained
in the
genome of the amplified CELO AIM46 virus. As shown in Fig.
4, both the plasmid pAIM46 and DNA
isolated from the CELO virus
AIM46 produced the expected PCR products.
Primers that span the
deletion/insertion site generate the predicted
PCR product of
3,422 bp with pAIM46 target DNA (Fig.
4, lane 4) and
with DNA
derived from two CELO AIM46 preparations (Fig.
4, lanes 5 and
6), while PCR with wild-type CELO virus DNA produces the predicted
DNA
molecule of 2,039 bp (Fig.
4, lane 3). Furthermore, primers
that
recognize the luciferase insert produce the predicted 958-bp
product
from DNA derived from pAIM46 or from two isolates of CELO
AIM46 (Fig.
4, lanes 9 to 11) but not from DNA derived from wild-type
CELO (Fig.
4,
lane 8).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
PCR analysis of wild-type CELO versus CELO AIM46. Lanes:
M, marker DNA, (EcoRI/HindIII-cut lambda
DNA); 2 to 6, primers OAIM24+OAIM26 were used with irrelevant target
DNA (lane 2), wild-type CELO DNA (lane 3), plasmid pAIM46 DNA (lane 4),
DNA isolated from CELO AIM46 (lanes 5 and 6); 7 to 11, primers OAIM24
and OAIM26 were used with irrelevant DNA (lane 7), wild-type CELO DNA
(lane 8), plasmid pAIM46 DNA (lane 9), DNA isolated from CELO AIM46 DNA
(lanes 10 and 11). DNA sizes (in base pairs) are indicated for some of
the marker molecules (left side) and for the expected PCR products
(right side). The primers used for PCR are the following: OAIM24
(CCGAGAATCCACCAATCGTA) is a sense oligonucleotide
hybridizing in the CELO virus right end (nt 41699). OAIM25
(CAGCGTGTCGCTATACGCAA) is an antisense oligonucleotide
hybridizing in the CELO virus right end (nt 43752). OAIM26:
(GCGATGACGAAATTCTTAGC) is a sense oligonucleotide
hybridizing in the luciferase expression cassette. PCR with OAIM24 and
OAIM25 should give a 2,053-bp product with a wild-type CELO template
and a 3,422-bp product with the AIM46 template. PCR with OAIM24 and
OAIM26 should give a 958-bp product with an AIM46 template and no
product, with the wild-type CELO template.
|
|
Immunofluorescence analysis of CELO AIM46 versus wild-type CELO
replication.
Luciferase data showed that CELO AIM46 can replicate
in LMH cells in the absence of complementation. To analyze more
directly the replication of CELO AIM46 in comparison to wild-type CELO, the two virus types were used to infect LMH cells and the progression of virus infection was monitored by immunofluorescence microscopy using
a polyclonal antiserum directed against CELO capsid proteins (Fig. 5). For both wild-type CELO and
CELO AIM46, replication is first detectable at 10 h postinfection
and the signal increases over the next 30 h until cytopathic
effect results in detachment of cells and a decline in the fluorescence
signal. Thus, in a cell culture infection, CELO AIM46 appears to
replicate with kinetics that are similar to those of wild-type CELO.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5.
Immunofluorescence, monitoring the replication of
wild-type CELO versus CELO AIM46. LMH cultures were infected at 500 particles per cell with either CELO AIM46 or wild-type CELO. Cell
samples were fixed at the indicated times postinfection, and production
of CELO virion proteins was monitored by immunofluorescence, using an
antiserum against CELO virion.
|
|
Growth of CELO AIM46 in chicken embryos.
In the initial stages
of this work, LMH cells were used for cell culture propagation of CELO
AIM46. Because the nature of the transformation event that established
this cell line is not clear, it remains possible that the LMH cells
provide some helper functions for CELO AIM46 that wild-type chicken
embryonic cells might lack. We were also interested to determine if
CELO AIM46 was capable of growing in chicken embryos for practical
considerations: the low cost and ease of handling of embryos would
facilitate production of these viruses. Equal quantities of either
wild-type CELO or CELO AIM46 were injected into the allantoic cavities
of 9-day-old chicken embryos. After incubation at 37°C for 3 days, the allantoic fluid was harvested and virus was purified by banding in
CsCl density gradients. Yields of purified wild-type CELO ranged from
0.149 to 0.9 mg per egg (average, 0.427 mg/egg), while CELO AIM46
yields were from 0.119 to 0.828 mg per egg (average, 0.301 mg/egg;
Table 3). The modifications introduced in
CELO AIM46 appear to affect the growth of AIM46 in chicken embryos to
only a modest extent.
Physical stability of CELO AIM46.
A distinctive feature of the
CELO virion is physical stability, most readily measured by resistance
of the virion to elevated temperatures. While mastadenoviruses such as
Ad5 are inactivated by exposure to temperatures of 48°C and higher
(4, 8, 16), CELO was originally reported to be stable at
56°C (57) and subsequent isolates of the virus have been
reported with stability at higher temperatures as well as to other
harsh treatments (reviewed in reference 39). The
molecular nature of CELO virus stability has not been determined. A
major component of Ad5 capsid stability, pIX, has not been identified
in CELO virus. Perhaps hexon or other capsid components have altered
sequences which allow more stable protein-protein interactions. It is
likely that this stability is important in the wild for CELO virus
survival in the harsh avian environment. In any case, it was of
interest to determine if the CELO recombinant vector retains the
stability of the wild-type CELO virion.
A recombinant Ad5 bearing a luciferase expression unit (AdLuc) and CELO
AIM45 were exposed to heat titration (30-min exposure
to defined
temperatures from 42 to 68°C). Subsequently, each sample
was tested
for its ability to transfer luciferase activity to
either human A549 or
avian CEF cells (Fig.
6). As previously
demonstrated
for Ad5, the virus capsid, and thus the transduction
ability of
the virus, is sensitive to heat (
4,
8,
16). Ad5
transduction
of human cells declines by a factor of more than 100 when
exposed
to 48°C for 30 min and is inactivated at 52°C and higher
temperatures
(Fig.
6). In strong contrast, CELO AIM46 transduction
ability
is not affected by heating at 56°C and the virus only begins
to
lose activity when exposed to 60°C for 30 min (Fig.
6). We found
that transduction with wild-type CELO displays similar heat stability
(results not shown), indicating that the alterations introduced
in CELO
AIM46 do not significantly alter the virion's stability.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
Heat stability of AIM46 versus AdLuc. Aliquots of CELO
AIM46 or AdLuc (4 × 109 virus particles in 100 µl
of HBS-2.4% glycerol) were exposed to the indicated temperatures for
30 min. The treated virus was then used to transduce either human A549
cells or chicken CEF cells (103 virus particles/cell) in
triplicate. Luciferase activity was measured 24 h later. The
values are the averages of three transductions with the standard
deviations indicated.
|
|
CELO can transduce a variety of cell types.
In considering
future applications, it is of interest to determine the types of cells
that can be transduced by a CELO-based vector. We tested a
panel of commonly used mammalian and chicken cell types for their
transducibility by CELO AIM46. For comparison, we used the Ad5
derivative Adluc carrying the same luciferase expression cassette. The
results for four of these cell types are presented in Fig.
7. Cells of avian origin (e.g., the
chicken fibroblast line CEF38) were transduced with nearly 100-fold
greater efficiency with the CELO vector than with the human AdLuc (Fig. 7). Note that CEF38 cells do not support virus replication, so the
difference between the Ad5 vector and the CELO vector cannot be
ascribed to virus replication and must be due to primary transduction or gene expression effects. In the human cell types tested, CELO virus
acted comparably to the Ad5 vector. The human cell types include the
hepatoma line HepG2, the lung epithelial carcinoma line A549, and
primary human dermal fibroblasts (Fig. 7). Similar results were
obtained with the human carcinoma line HeLa, the murine myoblast line
C2C12, and the canine epithelial line MDCK (results not shown).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 7.
Tropism of CELO virus versus Ad5. The indicated cell
types were exposed to aliquots of AdLuc or CELO AIM46 of from 1000, 300, 100 or 30 particles per cell (see Materials and Methods for the
protocol for a 24-well plate). At 24 h postinfection, luciferase
activity was determined. The values are the averages of three
transductions with the standard deviations indicated.
|
|
In conclusion, we find that CELO AIM46 is capable of
transducing avian cells approximately 100-fold more
efficiently than
a human Ad5 vector. Surprisingly, CELO AIM46 also
transduces mammalian
cell types with efficiencies comparable to
those of an Ad5-based
vector.
GFP expression from adenovirus and CELO vectors.
GFP has
emerged as a useful marker for gene transfer studies. Accordingly, we
prepared a CELO vector (CELO AIM53) expressing EGFP (Clontech) in
the CELO AIM46 background. The activity of this vector was compared to
that of an Ad5 vector bearing the same CMV/EGFP/
-globin
expression unit. We find that both vectors function to transfer a GFP
gene in human A549 cells (Fig. 8). Although immunofluorescence with GFP is not quantitative in this format, it appears that, similar to the luciferase recombinants, there
are not large differences in transduction capacity between the
CELO and the Ad5 EGFP viruses when transducing human A549 cells.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 8.
Transduction of EGFP using recombinant Ad5 or CELO
vectors. The EGFP-expressing adenovirus AdGFP and CELO AIM53 were used
to infect human A549 cells over a range of virus/cell ratios (10 to
1,000 particles per cell). At 24 h postinfection, cells were fixed
and GFP expression was monitored by fluorescence microscopy.
|
|
 |
DISCUSSION |
We have identified CELO genome regions that are essential for
virus replication. Most importantly, we have identified a region in the
left end of the virus genome that can be deleted and supplied in
trans. This region is thus an appropriate candidate for
establishing a complementing cell line. We have also identified a
region in the right end of the genome that can be deleted with no
detectable effects on virus replication in either cell culture or in
embryos. We have shown that an expression cassette for foreign genes
can be inserted in this region to generate a gene delivery vector. We
have demonstrated that CELO vectors can package an additional 1.7 kb of
DNA sequence over the wild-type genome size, which is already 8 kb
larger than Ad5 vectors. Replication-competent CELO vectors bearing
either a luciferase expression unit or an EGFP expression unit were
developed. These vectors were monitored for their ability to transduce
a variety of avian and mammalian cell types. As expected, the CELO
vectors work much better than an Ad5 vector in avian cells. However, in
all mammalian cell types tested, the CELO vectors functioned with
transduction efficiencies comparable to those of Ad5 vectors,
suggesting that CELO vectors based on this genome will be useful for
gene transfer applications in mammalian systems. Furthermore, these
vectors have obvious vaccine applications in avian species for which
viral replication can promote immune responses. The ability to
propagate the virus in inexpensive chicken embryos will certainly
facilitate production of large quantities of the vector for any of
these applications.
A variety of nonhuman adenovirus vectors have been developed in recent
times, including a vector based on the bovine adenovirus type 3 (40), on the ovine adenovirus OAV287 (29, 53),
and on the canine adenovirus type 2 (30). There are
several justifications for pursuing these alternate viral subtypes. For
vaccine applications in nonhuman hosts, these viruses, if properly
modified, may provoke more effective immune responses than a human
adenovirus-based vector. Furthermore, a more robust immune response
might be expected from a replication-competent virus; thus, a vector is
most useful in a host in which replication is partially or fully
permissive. This is not the case with human adenovirus-based vectors in
nearly all nonhuman hosts. In this regard, the CELO vector described here, AIM46, is ideally suited for avian vaccine applications.
An additional argument for pursuing a nonhuman adenovirus comes from
human gene therapy applications. Preexisting immune responses to human
adenovirus can impair the initial transduction by human adenovirus-based vectors or might exacerbate the cellular immune response to transduced cells. A patient may have no immune experience with an adenovirus from a distant species (although two of seven patients had neutralizing antibodies to the canine adenovirus vector
[30]), and initial transductions will not be
compromised by the host response to viral antigens. Except for certain
agricultural workers, a previous immune exposure to CELO antigens would
not be expected in most of the human population. CELO vectors might therefore have an advantage over vectors based on more common human
adenovirus serotypes.
An additional conceptual advantage of CELO-based vectors is that CELO,
like the bovine, ovine, and canine adenoviruses, is naturally
replication defective in human cells. Thus, rampant replication of
these vectors is not going to occur in human patients even in the
presence of a wild-type human adenovirus infection. A more likely
problem however, may be caused by expression of viral proteins in human
cells. The expression of viral genes in human cells has only been
carefully examined in OAV287 vectors (29), and a similar
analysis will have to be performed with CELO vectors.
Our future efforts will focus on several aspects of CELO. The
transforming genes of this virus are not yet defined. Using functional
assays, we have identified GAM-1, an E1B 19K homologue (7),
and a protein that interacts with Rb and stimulates the E2F pathway
(33a). CELO functions that disrupt p53 signalling are
expected to exist and these are being sought. This information is of
biological interest and, similar to the human adenovirus examples, the
application of CELO vectors will be dependent on the clear
identification and removal of all transforming genes. The ability to
generate a replication-defective CELO vector will be facilitated by the
deletion analysis performed here. Efforts to construct cell lines
expressing CELO complementing functions are under way.
 |
ACKNOWLEDGMENTS |
We thank Jola Glotzer for assistance with microscopy and image
processing. We are grateful to Gerhard Christofori for critical reading
of the manuscript and to Gotthold Schaffner, Robert Kurzbauer, Elisabeth Aigner, and Ivan Botto for DNA sequencing and oligonucleotide synthesis. We thank Ulla Protzer for providing LMH cells.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute for
Molecular Pathology, Dr. Bohr Gasse 7, 1030 Vienna, Austria. Phone: 43 1 797 30 526. Fax: 43 1 798 71 53. E-mail:
Cotten{at}nt.imp.univie.ac.at.
 |
REFERENCES |
| 1.
|
Baker, A.,
M. Saltik,
H. Lehrmann,
I. Killisch,
V. Mautner,
G. Lamm,
G. Christofori, and M. Cotten.
1997.
Polyethylenimine is a simple, inexpensive and effective reagent for condensing and linking plasmid DNA to adenovirus for gene delivery.
Gene Ther.
4:773-782[Medline].
|
| 2.
|
Bett, A. J.,
W. Haddara,
L. Prevec, and F. L. Graham.
1994.
An efficient and flexible system for construction of adenovirus vectors with insertions or deletions in early regions 1 and 3.
Proc. Natl. Acad. Sci. USA
91:8802-8806[Abstract/Free Full Text].
|
| 3.
|
Boussif, O.,
F. Lezoualc'h,
M. A. Zanta,
M. D. Mergny,
D. Scherman,
B. Demeneix, and J.-P. Behr.
1995.
A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine.
Proc. Natl. Acad. Sci. USA
92:7297-7301[Abstract/Free Full Text].
|
| 4.
|
Caravokyri, C., and K. N. Leppard.
1995.
Constitutive episomal expression of polypeptide IX (pIX) in a 293-based cell line complements the deficiency of pIX mutant adenovirus type 5.
J. Virol.
69:6627-6633[Abstract].
|
| 5.
|
Chartier, C.,
E. Degryse,
M. Gantzer,
A. Dieterle,
A. Pavirani, and M. Mehtali.
1996.
Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coli.
J. Virol.
70:4805-4810[Abstract].
|
| 6.
|
Chiocca, S.,
R. Kurzbauer,
G. Schaffner,
A. Baker,
V. Mautner, and M. Cotten.
1996.
The complete DNA sequence and genomic organization of the avian adenovirus CELO.
J. Virol.
70:2939-2949[Abstract].
|
| 7.
|
Chiocca, S.,
A. Baker, and M. Cotten.
1997.
Identification of a novel anti-apoptotic protein, GAM-1, encoded by the CELO adenovirus.
J. Virol.
71:3168-3177[Abstract].
|
| 8.
|
Colby, W. W., and T. Shenk.
1981.
Adenovirus type 5 virions can be assembled in vivo in the absence of detectable polypeptide IX.
J. Virol.
39:977-980[Abstract/Free Full Text].
|
| 9.
|
Cotten, M.,
E. Wagner,
K. Zatloukal, and M. L. Birnstiel.
1993.
Chicken adenovirus (CELO virus) particles augment receptor-mediated DNA delivery to mammalian cells and yield exceptional levels of stable transformants.
J. Virol.
67:3777-3785[Abstract/Free Full Text].
|
| 10.
|
Cowen, B.,
B. W. Calnek,
N. A. Menendez, and R. F. Ball.
1978.
Avian adenoviruses: effect on egg production, shell quality and feed consumption.
Avian Dis.
22:459-470[Medline].
|
| 11.
|
Crouzet, J.,
L. Naudin,
C. Orsini,
E. Vigne,
L. Ferrero,
A. Le Roux,
P. Benoit,
M. Latta,
C. Torrent,
D. Branellec,
P. Denefle,
J. F. Mayaux,
M. Perricaudet, and P. Yeh.
1997.
Recombinational construction in Escherichia coli of infectious adenoviral genomes.
Proc. Natl. Acad. Sci. USA
94:1414-1419[Abstract/Free Full Text].
|
| 12.
|
DeGregori, J.,
G. Leone,
A. Miron,
L. Jakoi, and J. R. Nevins.
1997.
Distinct roles for E2F proteins in cell growth control and apoptosis.
Proc. Natl. Acad. Sci. USA
94:7245-7250[Abstract/Free Full Text].
|
| 13.
|
Degryse, E.
1996.
In vivo intermolecular recombination in Escherichia coli: applications to plasmid construction.
Gene
170:45-50[Medline].
|
| 14.
|
de Wet, J. R.,
K. V. Wood,
M. DeLuca,
D. R. Helinski, and S. Subramani.
1987.
Firefly luciferase gene: structure and expression in mammalian cells.
Mol. Cell. Biol.
7:725-737[Abstract/Free Full Text].
|
| 15.
|
Fisher, K. J.,
H. Choi,
J. Burda,
S. J. Chen, and J. M. Wilson.
1996.
Recombinant adenovirus deleted of all viral genes for gene therapy of cystic fibrosis.
Virology
217:11-22[Medline].
|
| 16.
|
Ghosh-Choudhury, G.,
Y. Haj-Ahmad, and F. L. Graham.
1987.
Protein IX, a minor component of the human adenovirus capsid, is essential for the packaging of full length genomes.
EMBO J.
6:1733-1739[Medline].
|
| 17.
|
Gillen, J. R.,
D. K. Willis, and A. J. Clark.
1974.
In
R. F. Greil (ed.), Mechanisms in genetic recombination, p. 123-135.
Plenum, New York, N.Y.
|
| 18.
|
Gluzman, Y.,
H. Reichl, and D. Solnick.
1982.
Helper-free adenovirus type 5 vectors, p. 187-192.
In
Y. Gluzman (ed.), Eukaryotic viral vectors. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 19.
|
Graham, F. L.,
J. Smiley,
W. C. Russell, and R. Nairn.
1977.
Characteristics of a human cell line transformed by DNA from human adenovirus type 5.
J. Gen. Virol.
36:59-74[Abstract/Free Full Text].
|
| 20.
|
Grubb, B. R.,
R. J. Pickles,
H. Ye,
J. R. Yankaskas,
R. N. Vick,
J. F. Engelhardt,
J. M. Wilson,
L. G. Johnson, and R. C. Boucher.
1994.
Inefficient gene transfer by adenovirus vector to cystic fibrosis airway epithelia of mice and humans.
Nature
371:802-806[Medline].
|
| 21.
|
Hardy, S.,
M. Kitamura,
T. Harris-Stansil,
Y. Dai, and M. L. Phipps.
1997.
Construction of adenovirus vectors through Cre-lox recombination.
J. Virol.
71:1842-1849[Abstract].
|
| 22.
|
Hay, R. T.,
N. D. Stow, and I. M. McDougall.
1984.
Replication of adenovirus mini-chromosomes.
J. Mol. Biol.
175:493-510[Medline].
|
| 23.
|
He, T. C.,
S. Zhou,
L. T. da Costa,
J. Yu,
K. W. Kinzler, and B. A. Vogelstein.
1998.
Simplified system for generating recombinant adenoviruses.
Proc. Natl. Acad. Sci. USA
95:2509-2514[Abstract/Free Full Text].
|
| 24.
|
Hess, M.,
A. Cuzange,
R. W. H. Ruigrok,
J. Chroboczek, and B. Jacrot.
1995.
The avian adenovirus penton: two fibres and one base.
J. Mol. Biol.
252:379-385[Medline].
|
| 25.
|
Horwitz, M. S.
1996.
Adenoviruses, p. 2149-2171.
In
B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 26.
|
Imler, J. L.,
C. Chartier,
A. Dieterle,
D. Dreyer,
M. Mehtali, and A. Pavirani.
1995.
An efficient procedure to select and recover recombinant adenovirus vectors.
Gene Ther.
2:263-268[Medline].
|
| 27.
|
Karlsson, S.,
R. K. Humphries,
Y. Gluzman, and A. W. Nienhuis.
1985.
Transfer of genes into hematopoietic cells using recombinant DNA viruses.
Proc. Natl. Acad. Sci. USA
82:158-162[Abstract/Free Full Text].
|
| 28.
|
Kawaguchi, T.,
K. Nomura,
Y. Hirayama, and T. Kitagawa.
1987.
Establishment and characterization of a chicken hepatocellular carcinoma cell line, LMH.
Cancer Res.
47:4460-4464[Abstract/Free Full Text].
|
| 29.
|
Khatri, A.,
Z. Z. Xu, and G. W. Both.
1997.
Gene expression by atypical recombinant ovine adenovirus vectors during abortive infection of human and animal cells in vitro.
Virology
239:226-237[Medline].
|
| 30.
|
Klonjkowski, B.,
P. Gilardi-Hebenstreit,
J. Hadchouel,
V. Randrianarison,
S. Boutin,
P. Yeh,
M. Perricaudet, and E. J. Kremer.
1997.
A recombinant E1-deleted canine adenoviral vector capable of transduction and expression of a transgene in human-derived cells and in vivo.
Hum. Gene Ther.
8:2103-2115[Medline].
|
| 31.
|
Kovesdi, I.,
D. E. Brough,
J. T. Bruder, and T. J. Wickham.
1997.
Adenoviral vectors for gene transfer.
Curr. Opin. Biotechnol.
8:583-589[Medline].
|
| 32.
|
Kumar-Singh, R., and J. S. Chamberlain.
1996.
Encapsidated adenovirus minichromosomes allow delivery and expression of a 14 kb dystrophin cDNA to muscle cells.
Hum. Mol. Genet.
5:913-921[Abstract/Free Full Text].
|
| 33.
|
Laver, W. G.,
H. B. Younghusband, and N. G. Wrigley.
1971.
Purification and properties of chick embryo lethal orphan virus (an avian adenovirus).
Virology
45:598-614[Medline].
|
| 33a.
| Lehrmann, H., and M. Cotten. Unpublished results.
|
| 34.
|
Lemay, P.,
M. L. Boudin,
M. Milleville, and P. Boulanger.
1980.
Human adenovirus type 2 protein IIIa. I. Purification and characterization.
Virology
101:131-143[Medline].
|
| 35.
|
Li, P.,
A. J. D. Bellett, and C. R. Parish.
1984.
The structural proteins of chick embryo lethal orphan virus (fowl adenovirus type I).
J. Gen. Virol.
65:1803-1815[Abstract/Free Full Text].
|
| 36.
|
Li, P.,
A. J. D. Bellett, and C. R. Parish.
1984.
Structural organization and polypeptide composition of the avian adenovirus core.
J. Virol.
52:638-649[Abstract/Free Full Text].
|
| 37.
|
Li, P.,
A. J. D. Bellett, and C. R. Parish.
1984.
DNA-binding proteins of chick embryo lethal orphan virus: lack of complementation between early proteins of avian and human adenoviruses.
J. Virol.
65:1817-1825.
|
| 38.
|
Lieber, A.,
C. Y. He,
I. Kirillova, and M. A. Kay.
1996.
Recombinant adenoviruses with large deletions generated by Cre-mediated excision exhibit different biological properties compared with first-generation vectors in vitro and in vivo.
J. Virol.
70:8944-8960[Abstract].
|
| 39.
|
McFerran, J. B., and B. M. Adair.
1977.
Avian adenoviruses a review.
Avian Pathol.
6:189-217[Medline].
|
| 40.
|
Mittal, S. K.,
L. Prevec,
F. L. Graham, and L. A. Babiuk.
1995.
Development of a bovine adenovirus type 3-based expression vector.
J. Gen. Virol.
76:93-102[Abstract/Free Full Text].
|
| 41.
|
Miyake, S.,
M. Makimura,
Y. Kanegae,
S. Harada,
Y. Sato,
K. Takamori,
C. Tokuda, and I. Saito.
1996.
Efficient generation of recombinant adenoviruses using adenovirus DNA-terminal protein complex and a cosmid bearing the full-length virus genome.
Proc. Natl. Acad. Sci. USA
93:1320-1324[Abstract/Free Full Text].
|
| 42.
|
Oliner, J. D.,
K. W. Kinzler, and B. Vogelstein.
1993.
In vivo cloning of PCR products in E. coli.
Nucleic Acids Res.
21:5192-5197[Abstract/Free Full Text].
|
| 43.
|
Parks, R. J.,
L. Chen,
M. Anton,
U. Sankar,
M. A. Rudnicki, and F. L. Graham.
1996.
A helper-dependent adenovirus vector system: removal of helper virus by Cre-mediated excision of the viral packaging signal.
Proc. Natl. Acad. Sci. USA
93:13565-13570[Abstract/Free Full Text].
|
| 44.
|
Petersson, U., and R. J. Roberts.
1986.
Adenovirus gene expression and replication: a historical review, p. 37-57.
In
M. Botchan, T. Grodzicker, and P. A. Sharp (ed.), DNA tumor viruses: control of gene expression and replication Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 45.
|
Plank, C.,
K. Zatloukal,
M. Cotten,
K. Mechtler, and E. Wagner.
1992.
Gene transfer into hepatocytes using asialoglycoprotein receptor mediated endocytosis of DNA complexed with an artificial tetra-antennary galactose ligand.
Bioconjugate Chem.
3:533-539[Medline].
|
| 46.
|
Polyak, K.,
Y. Xia,
J. L. Zweier,
K. W. Kinzler, and B. Vogelstein.
1997.
Model for p53-induced apoptosis.
Nature
389:300-305[Medline].
|
| 47.
|
Robinson, A. J.,
H. B. Younghusband, and A. J. Bellett.
1973.
A circular DNA-protein complex from adenoviruses.
Virology
56:54-69[Medline].
|
| 48.
|
Schaack, J.,
S. Langer, and X. Guo.
1995.
Efficient selection of recombinant adenoviruses by vectors that express beta-galactosidase.
J. Virol.
69:3920-3923[Abstract].
|
| 49.
|
Shenk, T.
1995.
Group C adenovirus as vectors for gene therapy, p. 43-54.
In
M. G. Kaplitt, and A. D. Lowy (ed.), Viral vectors. Academic Press, San Diego, Calif.
|
| 50.
|
Shenk, T.
1996.
Adenoviridae: the viruses and their replication, p. 2111-2148.
In
B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 51.
|
Soberon, X.,
L. Covarrubias, and F. Bolivar.
1980.
Construction and characterization of new cloning vehicles. IV. Deletion derivatives of pBR322 and pBR325.
Gene
9:287-305[Medline].
|
| 52.
|
Van Doren, K.,
D. Hanahan, and Y. Gluzman.
1984.
Infection of eucaryotic cells by helper-independent recombinant adenoviruses: early region 1 is not obligatory for integration of viral DNA.
J. Virol.
50:606-614[Abstract/Free Full Text].
|
| 53.
|
Vrati, S.,
E. S. Macavoy,
Z. Z. Xu,
C. Smole,
D. B. Boyle, and G. W. Both.
1996.
Construction and transfection of ovine adenovirus genomic clones to rescue modified viruses.
Virology
220:200-203[Medline].
|
| 54.
|
Weiss, R. S.,
S. S. Lee,
B. V. Prasad, and R. T. Javier.
1997.
Human adenovirus early region 4 open reading frame 1 genes encode growth-transforming proteins that may be distantly related to dUTP pyrophosphatase enzymes.
J. Virol.
71:1857-1870[Abstract].
|
| 55.
|
Wilson, C., and M. A. Kay.
1995.
Immunomodulation to enhance gene therapy.
Nat. Med.
1:887-889[Medline].
|
| 56.
|
Xu, Z. Z.,
A. Hyatt,
D. B. Boyle, and G. W. Both.
1997.
Construction of ovine adenovirus recombinants by gene insertion or deletion of related terminal region sequences.
Virology
230:62-71[Medline].
|
| 57.
|
Yates, V. J., and D. E. Fry.
1957.
Observations on a chicken embryo lethal orphan (CELO) virus.
Am. J. Vet. Res.
18:657-660[Medline].
|
| 58.
|
Zabner, J.,
B. G. Zeiher,
E. Friedman, and M. J. Welsh.
1996.
Adenovirus-mediated gene transfer to ciliated airway epithelia requires prolonged incubation time.
J. Virol.
70:6994-7003[Abstract/Free Full Text].
|
| 59.
|
Zabner, J.,
P. Freimuth,
A. Puga,
A. Fabrega, and M. J. Welsh.
1997.
Lack of high affinity fiber receptor activity explains the resistance of ciliated airway epithelia to adenovirus infection.
J. Clin. Invest.
100:1144-1149[Medline].
|
| 60.
|
Zheng, B.,
S. K. Mittal,
F. L. Graham, and L. Prevec.
1994.
The E1 sequence of bovine adenovirus type 3 and complementation of human adenovirus type 5 E1A function in bovine cells.
Virus Res.
31:163-186[Medline].
|
Journal of Virology, February 1999, p. 1399-1410, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jaggi, F., Cabrita, M. A., Perl, A.-K. T., Christofori, G.
(2008). Modulation of Endocrine Pancreas Development but not {beta}-Cell Carcinogenesis by Sprouty4. Mol Cancer Res
6: 468-482
[Abstract]
[Full Text]
-
Logunov, D. Y., Zubkova, O. V., Karyagina-Zhulina, A. S., Shuvalova, E. A., Karpov, A. P., Shmarov, M. M., Tutykhina, I. L., Alyapkina, Y. S., Grezina, N. M., Zinovieva, N. A., Ernst, L. K., Gintsburg, A. L., Naroditsky, B. S.
(2007). Identification of HI-Like Loop in CELO Adenovirus Fiber for Incorporation of Receptor Binding Motifs. J. Virol.
81: 9641-9652
[Abstract]
[Full Text]
-
Cabrita, M. A., Jaggi, F., Widjaja, S. P., Christofori, G.
(2006). A Functional Interaction between Sprouty Proteins and Caveolin-1. J. Biol. Chem.
281: 29201-2912
[Abstract]
[Full Text]
-
Le Goff, F., Mederle-Mangeot, I., Jestin, A., Langlois, P.
(2005). Deletion of open reading frames 9, 10 and 11 from the avian adenovirus CELO genome: effect on biodistribution and humoral responses. J. Gen. Virol.
86: 2019-2027
[Abstract]
[Full Text]
-
Eickhoff, J. E., Cotten, M.
(2005). NF-{kappa}B activation can mediate inhibition of human cytomegalovirus replication. J. Gen. Virol.
86: 285-295
[Abstract]
[Full Text]
-
Vadivelu, S. K., Kurzbauer, R., Dieplinger, B., Zweyer, M., Schafer, R., Wernig, A., Vietor, I., Huber, L. A.
(2004). Muscle Regeneration and Myogenic Differentiation Defects in Mice Lacking TIS7. Mol. Cell. Biol.
24: 3514-3525
[Abstract]
[Full Text]
-
Eickhoff, J., Hanke, M., Stein-Gerlach, M., Kiang, T. P., Herzberger, K., Habenberger, P., Muller, S., Klebl, B., Marschall, M., Stamminger, T., Cotten, M.
(2004). RICK Activates a NF-{kappa}B-dependent Anti-human Cytomegalovirus Response. J. Biol. Chem.
279: 9642-9652
[Abstract]
[Full Text]
-
Ursu, K., Harrach, B., Matiz, K., Benko, M.
(2004). DNA sequencing and analysis of the right-hand part of the genome of the unique bovine adenovirus type 10. J. Gen. Virol.
85: 593-601
[Abstract]
[Full Text]
-
Cotten, M., Stegmueller, K., Eickhoff, J., Hanke, M., Herzberger, K., Herget, T., Choidas, A., Daub, H., Godl, K.
(2003). Exploiting features of adenovirus replication to support mammalian kinase production. Nucleic Acids Res
31: e128-e128
[Abstract]
[Full Text]
-
Kumin, D., Hofmann, C., Rudolph, M., Both, G. W., Loser, P.
(2002). Biology of Ovine Adenovirus Infection of Nonpermissive Cells. J. Virol.
76: 10882-10893
[Abstract]
[Full Text]
-
Daub, H., Blencke, S., Habenberger, P., Kurtenbach, A., Dennenmoser, J., Wissing, J., Ullrich, A., Cotten, M.
(2002). Identification of SRPK1 and SRPK2 as the Major Cellular Protein Kinases Phosphorylating Hepatitis B Virus Core Protein. J. Virol.
76: 8124-8137
[Abstract]
[Full Text]
-
Tan, P. K., Michou, A.-I., Bergelson, J. M., Cotten, M.
(2001). Defining CAR as a cellular receptor for the avian adenovirus CELO using a genetic analysis of the two viral fibre proteins. J. Gen. Virol.
82: 1465-1472
[Abstract]
[Full Text]
-
François, A., Eterradossi, N., Delmas, B., Payet, V., Langlois, P.
(2001). Construction of Avian Adenovirus CELO Recombinants in Cosmids. J. Virol.
75: 5288-5301
[Abstract]
[Full Text]
-
Impagnatiello, M.-A., Weitzer, S., Gannon, G., Compagni, A., Cotten, M., Christofori, G.
(2001). Mammalian Sprouty-1 and -2 Are Membrane-Anchored Phosphoprotein Inhibitors of Growth Factor Signaling in Endothelial Cells. JCB
152: 1087-1098
[Abstract]
[Full Text]
-
Glotzer, J. B., Michou, A.-I., Baker, A., Saltik, M., Cotten, M.
(2001). Microtubule-Independent Motility and Nuclear Targeting of Adenoviruses with Fluorescently Labeled Genomes. J. Virol.
75: 2421-2434
[Abstract]
[Full Text]
-
Compagni, A., Wilgenbus, P., Impagnatiello, M.-A., Cotten, M., Christofori, G.
(2000). Fibroblast Growth Factors Are Required for Efficient Tumor Angiogenesis. Cancer Res.
60: 7163-7169
[Abstract]
[Full Text]
-
Soudais, C., Boutin, S., Hong, S. S., Chillon, M., Danos, O., Bergelson, J. M., Boulanger, P., Kremer, E. J.
(2000). Canine Adenovirus Type 2 Attachment and Internalization: Coxsackievirus-Adenovirus Receptor, Alternative Receptors, and an RGD-Independent Pathway. J. Virol.
74: 10639-10649
[Abstract]
[Full Text]
-
Russell, W. C.
(2000). Update on adenovirus and its vectors. J. Gen. Virol.
81: 2573-2604
[Full Text]
-
Kremer, E. J., Boutin, S., Chillon, M., Danos, O.
(2000). Canine Adenovirus Vectors: an Alternative for Adenovirus-Mediated Gene Transfer. J. Virol.
74: 505-512
[Abstract]
[Full Text]
-
Lehrmann, H., Cotten, M.
(1999). Characterization of CELO Virus Proteins That Modulate the pRb/E2F Pathway. J. Virol.
73: 6517-6525
[Abstract]
[Full Text]