Previous Article | Next Article 
Journal of Virology, February 1999, p. 1254-1261, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Expression of the Human Endogenous Retrovirus HTDV/HERV-K Is
Enhanced by Cellular Transcription Factor YY1
Michael
Knössl,
Roswitha
Löwer, and
Johannes
Löwer*
Virology Department, Paul-Ehrlich-Institut,
D-63225 Langen, Germany
Received 20 July 1998/Accepted 15 October 1998
 |
ABSTRACT |
The human endogenous retrovirus HTDV/HERV-K, which resides in
moderate copy numbers in the human genome, is expressed in a cell-type-specific manner, predominantly in teratocarcinoma cells. We
have analyzed the regulatory potential of the 5' enhancer of the HERV-K
long terminal repeat. Protein extracts of HERV-K-expressing teratocarcinoma cell lines (GH and Tera2) and nonexpressing HeLa and
HepG2 cells form different protein complexes on the enhancer sequence
as detected by electrophoretic mobility shift assays (EMSA). Using
competition EMSAs, DNase I footprinting, and supershift experiments, we
localized the binding site of these complexes to a 20-bp sequence
within the enhancer and showed that the transcription factor YY1 is one
component of the HERV-K enhancer complex. Replacement of the YY1
binding site with unrelated sequences reduced expression of the
luciferase gene as a reporter in transient-transfection assays.
 |
INTRODUCTION |
Endogenous retroviral sequences
comprise a significant proportion of the genome in all vertebrates.
They probably are remnants of ancient germ line infections of exogenous
retroviruses which have been transmitted as stable genetic traits via
the germ line. Thus, endogenous retroviruses (ERVs) in principle have
the same genomic organization as exogenous ones. Approximately 1 to
12% of the human genome consists of ERV elements. The high copy number most probably arose by repeated cycles of infection and
retrotransposition. ERVs may still significantly contribute to
recombination events and genetic instability. Many different families
of ERVs have been detected in the human genome. However, the vast
majority of them have accumulated point mutations and deletions over
time, leaving either full-length or truncated proviruses, which are unable to code for infectious virus particles (reviewed in references 21 and 41). Almost all endogenous
retroviruses are expressed on the RNA level in a rather
cell-type-specific manner; however, only a few of them encode
functional proteins. In agreement with their fate as retroelements,
ERVs are transcribed primarily in cells and tissues of the reproductive
tract or in dedifferentiated tumor cells (14, 21, 41).
The human endogenous retrovirus HTDV/HERV-K family consists of 25 to 50 proviral copies and approximately 10,000 solitary long terminal repeats
(LTRs), which presumably originated from homologous LTR-LTR
recombination and excision of the retroviral genome in between
(16, 26). HERV-K proviruses have retained the full
complement of retroviral genes (gag, pol, and
env) and additionally contain a central open reading frame
encoding a small protein, termed cORF, with similarities to the HIV Rev
protein (20). Homologs of HERV-K are found only in Old World
monkeys and other primates, so that the primary germ line infection is traced back to a time after the separation of these species from New
World monkeys (36). Despite this long period, the retroviral genes of HERV-K have retained coding competence, leading to formation of all viral protein products (reviewed in references
21 and 40). However, it is not
known whether different proviruses complement intact genes in
trans or whether a single provirus contains all the
retroviral genes in one functional sequence. HERV-K is highly expressed
in teratocarcinoma cell lines like GH and Tera2, where four mRNA
species have been identified: a full-length mRNA (8.6 kb), a singly
spliced env mRNA (3.3 kb), a doubly spliced cORF mRNA (1.8 kb), and a further singly spliced mRNA (1.5 kb) of unknown function. This expression pattern thus resembles that of exogenous retroviruses with complex regulation (18-20). Moreover, due
to its coding competence, HERV-K is the only ERV known to encode retroviral particles, termed human teratocarcinoma-derived virus particles (HTDV); however, they seem not to be infectious (4, 17,
19).
Expression of retroviral sequences is regulated primarily by
transcriptional regulatory elements within the LTR, especially the U3
region, at the 5' end of the provirus. Cellular factors bind to these
elements to initiate transcription (22). LTRs not only
regulate the expression of their own downstream proviruses but also may
influence the expression of neighboring cellular genes. The 3' LTR of
the mouse intracisternal A particles (IAPs) initiates transcription of
the homeobox gene Hox-2.4 (12). The human HERV-R provirus
generates a readthrough hybrid transcript from its 5' LTR, with a
downstream gene (H-plk) encoding a putative zinc finger
protein (9). A hybrid transcript between HERV-H and the
cellular gene PLA2L, which contains two phospholipase A2
homologous domains, is also known (7). Moreover, during primate evolution, insertion of a HERV-E element in front of an ancestral amylase gene converted its pancreas-specific promoter to a
parotidic promoter as well. In this case, retroviral insertion altered
the tissue-specific expression of a downstream cellular gene
(39). So far, no cellular gene is known to be regulated by
HERV-K; however, given the large number of HERV-K LTR copies in the
human genome, it seems likely that many examples await discovery. The
above examples clearly stress the importance of studying the potential
of endogenous LTRs as regulatory elements of cellular genes.
The U3 region of many retroviruses contains two major domains which
control expression: a promoter immediately preceding the transcription
start site at the U3-R boundary and an enhancer domain further upstream
within U3 (22). Detailed studies have been performed to
reveal the regulation of expression of exogenous retroviruses like the
avian retroviruses or human immunodeficiency virus (e.g., see
references 10 and 30); however,
much less is known for ERVs. Transcription of ERV-9, for example, is
initiated at its promoter by the cellular transcription factor Sp1 and
an unidentified protein binding to an initiator-like element (13, 37). Members of the Sp1 family also activate transcription from the HERV-H promoter (35). For HERV-K, we have identified a
5' enhancer at the very 5' end of U3 and a minimal promoter region at
its 3' end by analyzing the ability of LTR deletion constructs to drive
the expression of the luciferase gene as a reporter in transient-transfection experiments with teratocarcinoma cells. Deletion
of either the enhancer or the promoter markedly reduced the expression
of the reporter, indicating that both regions are important
determinants of transcriptional activation from the HERV-K LTR
(11).
In this study, we have further analyzed the HTDV/HERV- K
5' enhancer. Using electrophoretic mobility shift assays
(EMSA), we detected different protein complexes in nuclear extracts of HERV-K-expressing cell lines (GH and Tera2), as opposed to
nonexpressing ones (HeLa and HepG2). All complexes assemble at only a
short sequence between bp 62 and 83 and contain the cellular
transcription factor YY1 as a major DNA-binding protein. In luciferase
reporter assays, we further show that these 5'-enhancer complexes
activate HERV-K expression.
 |
MATERIALS AND METHODS |
Cell culture.
The human teratocarcinoma cell lines GH and
Tera2 (American Type Culture Collection) (17), the human
hepatocarcinoma cell line HepG2, and the human cervical carcinoma cell
line HeLa (both purchased from the American Type Culture Collection)
were grown at 37°C in Dulbecco's modified Eagle's medium (Biochrom)
supplemented with 10% fetal calf serum, 2 mM glutamine, and
antibiotics. The cells were split weekly after trypsinization in a 1:10
(GH, Tera2, and HepG2) or 1:20 (HeLa) ratio, with one change of medium
after 3 days.
Protein preparation.
Protein extracts were prepared as
described previously (6) and stored under a nitrogen
atmosphere at
70°C. The protein concentration was measured by the
Bio-Rad protein assay.
Cloning of the LTR subfragments.
The following
oligonucleotides (Eurogentec, Interactiva) were used for cloning; the
name, sequence, and approximate position within the HERV-K10 LTR are
given (positions according to reference 26); mutated
bases are in boldface type, restriction sites are underlined, and the
respective restriction enzyme is mentioned: MK13,
GAGAGATCGAATTCTTACTGTG,
nucleotide (nt) 25, EcoRI; MK14,
TAACAGAATCTCGAGGCAGAAG, nt 105, XhoI; MK15, GACTCCATCTAGATATGTGCTAAG,
nt 75, XbaI; MK16, GAGCACGGAATTCGGGGTAAGGTC,
nt 135, EcoRI; MK18,
CATTCAACCTCGAGTTGACACAGC, nt 170, XhoI; MK21,
P-AGCTTAGACATAGGAGACTCCATTA, nt 60, HindIII; MK22,
P-AGCTTAATGGAGTCTCCTATGTCTA, nt 65, HindIII; MK23,
P-AGCTTAGGAGACTCCATTTTGTTATGTGCTA, nt 70, HindIII; MK24,
P-AGCTTAGCACATAACAAAATGGAGTCTCCTA, nt
75, HindIII; MK25,
P-AGCTTGTGTAGAAAGAAGTAGACATAGGA, nt
50, HindIII; MK26,
P-AGCTTCCTATGTCTACTTCTTTCTACACA, nt 55, HindIII; MK27,
P-AGCTTTTTGTTATGTGCTAAGAAAAA, nt 80, HindIII; MK28,
P-AGCTTTTTTCTTAGCACATAACAAAA, nt 85, HindIII; MK29,
P-AGCTTAAGAAAAATTCTTCTGCCTTGAGA, nt
95, HindIII; MK30,
P-AGCTTCTCAAGGCAGAAGAATTTTTCTTA, nt 100, HindIII; MK39,
CCCGGGCTGCAGGAATTCGATATCATGTCTACTTCTTTCTAC, nt
60; MK40, GATATCGAATTCCTGCAGCCCGGGTAAGAAAAATTCTTCTGCC, nt 80; MK41, CGGTATCGATAAGCTTTGTGGGGAAAAGCAAGAG,
nt 10, ClaI, HindIII; and MK42,
GGGAGAAACCTTGGACAATACCTGG, nt 340.
The plasmids used in this work are based on pBHK10LTR, which contains
the full-length HERV-K10 LTR (unpublished data). HERV-K10 LTR
subfragments were amplified by PCR from pBHK10LTR with Taq DNA polymerase (Perkin-Elmer) and the primers listed above.
Subfragments were restricted according to the restriction sites
introduced by the primers, purified by agarose gel electrophoresis on
low-melting-point (LMP) agarose, and ligated into appropriately
restricted and dephosphorylated pBluescript (Stratagene). Recombinant
plasmids were transformed into Escherichia coli DH5
(Gibco BRL) and isolated by using a plasmid kit (Qiagen) as specified
by the manufacturer. All plasmids were verified by sequencing with the
Sequenase V2.0 DNA sequencing kit (Amersham).
To produce pB30-103K10. The 102-bp PCR product, amplified with
MK13 and MK14, was restricted with
EcoRI and
XhoI
and ligated
into pBluescript, which had been digested with the same
enzymes.
The same strategy was also used the next four constructs, so
only
the primers and enzymes used to produce the PCR fragments along
with their sizes are mentioned: pB30-134K10, MK13/MK16, 132-bp
product, and
EcoRI; pB78-170K10, MK15/MK18, 119-bp
product, and
XbaI und
XhoI; and subfragments
[1-54] and [1-167],
HindIII-
AccI
and
HindIII-
HincII restriction fragments of
the HERV-K10 LTR,
respectively. After digestion of the LTR, the
fragments were purified
by agarose gel electrophoresis on LMP
agarose.
To produce the following constructs, 5'-phosphorylated oligonucleotides
(listed above) were annealed to yield double-stranded
DNA fragments,
which contained
HindIII sites at both ends and
the
HERV-K10 LTR sequence as demarcated in the plasmid name (in
base
pairs). The annealed fragments then were cloned into
HindIII-digested,
dephosphorylated pBluescript:
pB40-64K10, MK25/MK26 hybrid; pB54-73K10,
MK21/MK22 hybrid;
pB60-86K10, MK23/MK24 hybrid; pB72-93K10, MK27/MK28
hybrid;
pB85-109K10, MK29/MK30 hybrid. All subfragments were isolated
after
HindIII digestion and electrophoresis with LMP
agarose gels
as described
above.
For the YY1 binding-site mutant construct pB60PL85HK10, the LTR
region from bp

16 through 84 (containing 16 bp of the pBluescript
polylinker 5' of the LTR, including a
ClaI site and a
HindIII
site) and the region from bp 61 through 350 (including a
SphI
site) were amplified by PCR from pBHK10LTR
with primers MK41 plus
MK39 and MK40 plus MK42, respectively. Both
overlapping PCR products
were used as templates in an assembly PCR with
primers MK41 and
MK42 to produce the 5'-terminal 350 bp of the LTR
containing the
mutant YY1 binding site. The
ClaI- and
SphI-restricted product
was used to substitute the
ClaI-
SphI fragment of the LTR in plasmid
pBHK10LTR to create a full-length LTR containing the mutated binding
site. The mutant LTR was isolated by
HindIII digestion
and cloned
into the
HindIII-cut luciferase vector pSVOAL
(
5).
EMSA and supershift assay.
Plasmid pBHK10, containing the
full-length HERV-K10 LTR cloned into the HindIII site of
pBluescript, was restricted with HindIII and
HincII to generate the LTR fragment bp 1 to 167. The other subfragments were excised from the subcloned constructs listed above by
HindIII digestion. The calf intestinal phosphatase
(Promega)-dephosphorylated DNA probes were separated by electrophoresis
in LMP agarose gels (Biozym) and visualized by ethidium bromide
staining. Probe bands were cut out, supplemented with 115 mM NaCl and
11.75 mM EDTA, extracted from melted gel slices with phenol (once),
phenol-chloroform (once), and chloroform (twice), and precipitated with
ethanol containing 10 mM MgCl2. A 50-ng portion of probe
DNA was end labeled with T4 polynucleotide kinase (Promega) by using 10 µCi of [
-32P]ATP (3,000 Ci/mmol; Amersham). Labeled
probes were purified from unincorporated nucleotides by chromatography
on a Sephadex G-50 column (Pharmacia). A specific activity of 2 × 107 to 8 × 107 cpm/µg was routinely obtained.
A protein binding reaction mixture consisting of 0.09 to 0.12 ng of
probe DNA (6,000 to 15,000 cpm), 10 mM Tris-HCl (pH 7.5),
50 mM NaCl, 1 mM MgCl
2, 0.5 mM EDTA, 0.5 mM dithiothreitol, 4%
glycerol,
1 µg of poly(dI-dC) and 2 to 3 µg of nuclear protein
extract in a
total volume of 20 µl was incubated for 30 min at
room temperature.
In competition EMSAs, the reaction mixture was
preincubated for 20 min
with a 400- to 500-fold excess of competitor
DNA before addition of
labeled probe. In supershift assays, the
binding-reaction mixture was
supplemented with 1.2 µg of anti-YY1
immunoglobulin G (Santa Cruz
Biotechnology) or 1 µl of cORF antiserum
(
20). The
reaction was stopped by adding 2 µl of 10× loading
buffer (250 mM Tris-HCl [pH 7.5], 0.2% bromphenolblue, 0.2% xylene
cyanol, 40%
glycerol), and the product was immediately loaded
on a native 5% (4%
for supershifts) polyacrylamide gel (5% acrylamide,
0.26%
bisacrylamide [Gel 40, 19:1; Roth], 0.5× Tris-borate-EDTA
[TBE],
2.5% glycerol). Electrophoresis was performed in a Protean
II xi
system (Bio-Rad) in 0.5× TBE buffer at 10 V/cm; the gel
was prerun at
15 V/cm for 20 min. The gel was blotted on filter
paper (3 MM;
Whatman), dried at 80°C, and exposed overnight at

70°C with a
Biomax MR film
(Kodak).
DNase I footprinting.
The full-length HERV-K10 LTR
(HindIII restriction fragment of pBHK10) was 5'-end
labeled as described above and restricted with HincII to
generate the LTR fragment from bp 1 to 167, which was radioactively
labeled only at one end (at bp 1). The probe was purified from LMP
agarose (see above). Less than 1 ng of probe DNA was incubated in EMSA
buffer with 6 to 8 µg of nuclear protein extract in a total volume of
25 µl for 30 min at room temperature. Free DNA was then degraded with
1 U of DNase I (Promega) for exactly 1 min. After addition of 25 µl
of 2× stop solution (200 mM NaCl, 200 mM KCl, 20 mM EDTA, 1% sodium
dodecyl sulfate, 100 µg of tRNA per ml), the DNA was extracted with
phenol-chloroform and chloroform (once each) and ethanol precipitated.
The DNA fragments were resuspended in 95% formamide-20 mM
EDTA-0.05% xylene cyanol-0.05% bromphenol blue and separated on an
8% polyacrylamide sequencing gel, together with a chemically sequenced
probe (24) to identify the positions of the DNase I fragments.
Luciferase assay.
Cells (1.2 × 106) were
seeded into 25-ml flasks (Greiner) and transfected after 24 h with
3 µg of the promoterless pSVOAL plasmid containing the luciferase
gene (5) into which the different LTR constructs were cloned
as promoters, using the DOTAP liposomal transfection reagent as
specified by the manufacturer (Boehringer Mannheim). Transfected cells
were incubated in medium without fetal calf serum for 5 h and then
transferred to medium supplemented with 10% fetal calf serum. At
24 h later, the cells were washed twice with phosphate-buffered
saline and lysed in 250 µl of luciferase lysis buffer [1 M
Tricine, 100 mM (MgCO3)4Mg(OH)2,
100 mM MgSO4, 10 mM ATP, 10 mM coenzyme A, 0.5 M
EDTA, 1 M dithiothreitol (DTT), (pH 7.8) (Promega)] for 5 min. The
cell debris was pelleted, and the supernatant was stored at
70°C.
Background light emission of 20 µl of cell lysate was measured
for 3 min in a luminometer (LB9505; Berthold). Then 100 µl
of luciferin solution [71 µg of luciferin in 20 mM
Tricine, 1.07 mM
(MgCO3)4Mg(OH)2, 2.67 mM
MgSO4, 0.1 mM EDTA, 33.3 mM DTT, 0.53 mM ATP, and 0.27 mM
coenzyme A (Promega)] was added to measure the luciferase activity for
another 3 min.
 |
RESULTS |
HERV-K enhancer complex: binding site and composition.
Three
regions within the HTDV/HERV-K LTR mainly control expression of the
provirus: the 5' enhancer, the promoter, and the R region. Among these,
we started to analyze the regulatory potential of the 5' enhancer,
which roughly comprises the first 170 bp of the U3 region (Fig.
1). The regulatory control exerted by the 5' enhancer in different cell types should be reflected in a different subset of proteins which bind to the 5' enhancer depending on whether
the cell expresses HERV-K. To test this, EMSAs were performed, with the
HERV-K10 (27) LTR 1 to 167 restriction fragment (Fig. 1) as
a probe and nuclear protein extracts of the HERV-K-expressing teratocarcinoma cell lines GH and Tera2 as well as of the weakly expressing cervicalcarcinoma HeLa and the nonexpressing hepatocarcinoma HepG2 cell lines (Fig. 2;
HERV-K-expressing and weakly or nonexpressing cell lines will be
referred to as two different cell types throughout this paper). In
addition to three intense common bands (C1, C2, and C3) one
high-mobility teratocarcinoma-specific protein complex, T1, and two
low-mobility hepatocarcinoma specific complexes, H1 and H2, were
observed (Fig. 2). Tera2 extracts always showed a strong T1 band,
whereas GH extracts formed only a very weak one. In some HepG2 nuclear
extract preparations, the H1 complex resolves into two bands. The HeLa
extract, on the other hand, resulted only in bands with identical
mobility but different intensities from bands observed with the other
cell extracts. The cell-type-specific band shift pattern observed
strongly suggested that the 5' enhancer of HERV-K actively is involved
in regulation of the expression of the provirus.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of HERV-K LTR and LTR
subfragments used for competition EMSAs. U3, R, and U5 regions are
represented by different shadings; numbers delineate nucleotide
positions in the LTR.
|
|

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 2.
EMSA of the HERV-K LTR subfragment from bp 1 to 167 as a
probe with nuclear extracts of the cell lines indicated. Lanes: O: no
protein extract added; N, no competitor added; S, unlabeled LTR
fragment from bp 1 to 167 as specific competitor; U, unlabeled
oligonucleotide containing the Sp1 binding site as a nonspecific
competitor. All bands are competed specifically. One
teratocarcinoma-specific (T1) and two hepatocarcinoma-specific (H1 and
H2) complexes are discernible; C1, C2, and C3 are common to all cell
lines.
|
|
We next were interested in identifying the binding site or sites of the
5'-enhancer protein complexes. For this purpose, overlapping
subfragments of the K10 LTR 5' enhancer were cloned (Fig.
1, 1
to 54, 55 to 167, 30 to 134, 78 to 170, 30 to 103, 78 to 134,
123 to 170) and
used as competitors in EMSAs with fragment 1 to
167 as the DNA probe.
Competition, i.e., disappearance of bands,
indicates that the
respective competitor DNA contains the identical
protein binding site
to the probe. Of these competitors, only
subfragments containing HERV-K
LTR sequences between bp 55 through
77 (i.e. subfragments 55 to 167, 30 to 134, and 30 to 170) were
able to compete all complexes completely
(Fig.
3 and data not
shown). However,
both low-mobility hepatocarcinoma complexes could
also be competed with
subfragments containing LTR sequences either
upstream (H1; 30 to 134)
or downstream (H1, H2; 78 to 170) or
bp 55 to 77. In addition, when the
subfragments 55 to 167, 30
to 134, and 30 to 170 were used as probes,
band shift patterns
very similar to those obtained with fragment 1 to
167 as the probe
emerged, with only minor deviations. Again, all the
complexes
could be competed only with subfragments containing bp 55 to
77
(data not shown).

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 3.
EMSA of the HERV-K LTR fragment from bp 1 to 167 as a
probe with nuclear cell extracts and different LTR subfragments as
competitors. Lanes: O, no protein extract added; N, no competitor
added. Other lanes contain LTR subfragments as specific competitors;
the nucleotide positions are indicated (Fig. 1). Complexes are competed
with LTR subfragments containing bp 55 to 77. H1 and H2 complexes are
also competed with subfragments containing LTR regions upstream of bp
55 (H1) and downstream of bp 77 (H1 and H2).
|
|
This competition behavior raised the possibility that with the
exception of the low-mobility hepatocarcinoma complexes H1
and H2, all
other 5'-enhancer complexes assemble at only one or
two DNA binding
protein(s), which bind within the region between
bp 50 and 80. We
therefore generated a second set of five smaller
HERV-K enhancer
subfragments, each about 20 to 25 bp long and
overlapping each adjacent
one roughly by half (Fig.
1; 40 to 64,
54 to 73, 60 to 86, 72 to 93, and 85 to 109). Using these as competitors
in EMSAs with 1 to 167 as a
probe, only subfragment 60 to 86 was
able to completely compete all
complexes of GH, Tera2, and HeLa
nuclear extracts (Fig.
4a and
b; HeLa not shown). The fact that
fragment 54 to 73 already showed a slight competition effect,
especially with Tera2 nuclear extracts, indicates that the 3'
part of
this fragment harbors sequences relevant but not sufficient
for the
formation of the complexes. With HepG2 nuclear extracts,
however, the
H1 complex could not be competed with subfragments
60 to 86; rather,
the H1 band became more intense in the presence
of this competitor. The
other four subfragments competed H1 and
H2 only to an extent (Fig.
4c).
With the subfragments as a probe,
only fragment 60 to 86 generated
bands which could be competed
specifically, regardless which cell
extracts were used (data not
shown). GH, Tera2, and HeLa extracts gave
the same number of bands
with similar relative intensities with both 1 to 167 and 60 to
86 as probes. Both probes also gave the same
high-mobility complexes
with HepG2 extracts. The HepG2 low-mobility
complexes H1 and H2,
on the other hand, could not be generated with
probe 60 to 86
but could be generated only with longer probes,
containing additional
LTR sequences adjacent to this 27-bp region
(compare Fig.
2,
3,
and
4). Moreover, probes 54 to 73, 72 to 93, and 85 to 109 gave
specifically competable bands of low mobility only when
hepatocarcinoma
extracts were used (data not shown), further indicating
the importance
of LTR sequences abutting the sequence from 60 to 86 for
assembly
of these HepG2 complexes.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 4.
EMSA of the HERV-K LTR fragment from bp 1 to 167 as a
probe with GH (a), Tera2 (b), and HepG2 (c) nuclear cell extracts and
smaller LTR subfragments as competitors. Lanes: O, no protein extract
added; N, no competitor added. Other lanes contain specific
competitors; the nucleotide positions are indicated (Fig. 1). All
complexes of teratocarcinoma cells (a and b) are competed with the LTR
subfragment from bp 60 to 86. Most HepG2 complexes are competed by the
subfragment containing bp 60 to 86; the intensity of one of the
complexes is increased. Some low-mobility complexes of HepG2 cells are
competed with LTR sequences adjacent to bp 60 to 86.
|
|
To exactly map the binding site of the HERV-K enhancer complex, we
applied the DNase I footprinting technique. Both teratocarcinoma
and
hepatocarcinoma nuclear extracts resulted in a clear footprint
between
bp 62 and 83 (GGAGACTCCATTTTGTTATGTG) (Fig.
5).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
DNase I footprint of HERV-K LTR bp 1 to 167. Lanes: 1, no protein extract added; 2 to 4, nuclear extracts of GH, Tera2, and
HepG2 cells added, respectively. The vertical bar earmarks the
protected region between bp 62 and 83.
|
|
In summary, three lines of evidence indicate that the 22-bp element
between bp 62 and 83 is the major HERV-K 5'-enhancer complex
binding
site. First, all protein complexes could be competed with
competitor
DNA containing contiguous sequences either between
bp 55 and 77 or
between bp 60 and 86. Second, all teratocarcinoma
cell and HeLa cell
complexes, as well as the high-mobility HepG2
cell complexes, could be
generated on DNA probes containing these
sequences. Third, a DNase I
footprint was obtained with nuclear
extracts between bp 62 and 83. Taken together, these results show
that all HERV-K 5'-enhancer
complexes bind to and assemble at
the site between bp 62 and 83 in both
cell types. The EMSA data
clearly indicated that in HepG2 cells,
although not detectable
by DNase I footprinting, sequences adjacent to
this binding site,
presumably covering the region from bp 50 to 110, contribute important
determinants the assembly of the whole enhancer
complex in this
cell line. Furthermore, the enhancer complexes of
HERV-K-expressing
and nonexpressing cell types do contain at least
partly different
protein
components.
YY1 is the HERV-K enhancer binding protein.
Having mapped the
binding site of the HERV-K enhancer complex, we were interested in
identifying the enhancer binding protein(s). The enhancer sequence was
checked for putative transcription factor binding sites in the TRANSFAC
database with the search routine TFSEARCH (42), and a
consensus sequence for the cellular transcription factor YY1 was found
between bp 64 and 80 (AGACTCCATTTTGTTAT) with a homology
score of 88.9%. In addition, high scoring consensus sequences were
found for C/EBP (CAAT enhancer binding protein; 87.7%) between bp 78 and 90 and for SRY (sex region Y protein; 85.9%) between bp 70 and 81. Among these, the C/EBP consensus sequences does not lie completely
within the mapped binding site. Since the subfragment from 72 to 93, containing both C/EBP and SRY binding sites, was not effective as a
competitor and did not generate specific EMSA bands with any of the
cell extracts tested (see above), we assumed that YY1 was the most
likely candidate for being a major HERV-K enhancer binding protein.
To identify the binding protein, supershift assays were used. In an
EMSA with bp 1 to 167 as a probe and nuclear extracts
of both cell
types, an anti-YY1 antiserum produced at least five
supershifted bands
with identical mobilities but different intensities
depending on the
cell type (Fig.
6). With only the binding
site
from bp 60 to 86 as a probe, the same EMSA bands could be
supershifted
by anti-YY1 antiserum but resulted in only two
supershifted bands
(data not shown). The supershifted bands were not
caused simply
by the addition of serum proteins, as demonstrated by the
inclusion
in some reaction mixtures of an unrelated antiserum against
the
HERV-K cORF protein, which did not change the mobility or the
intensity of any of the complexes. In addition, no supershift
was
obtained with an anti-C/EBP antiserum, supporting the exclusion
of this
transcription factor as a HERV-K enhancer protein (data
not shown).
Furthermore, all anti-YY1 supershifted bands could
be competed
specifically with the YY1 binding site containing
subfragment 30 to
103. Importantly, the teratocarcinoma-specific
T1 complex was the only
complex that did not supershift with either
probe (Fig.
6). The
transcription factor YY1 is present in all
cell lines used in this
study, as tested by Western blotting (data
not shown).

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 6.
Supershift with the HERV-K LTR fragment from bp 1 to 167 protein complexes with an anti-YY1-antibody. Lane 1, no protein extract
added; other lanes, anti-YY1-antibody, anti-cORF-antiserum, and
subfragment from bp 30 to 103 as a specific competitor were added to
individual binding reactions as indicated. Except for complex T1 of
both teratocarcinoma cells, all protein complexes are retarded by the
anti-YY1-antibody.
|
|
Both observations, i.e., the presence of a highly conserved YY1
consensus sequence within the borders of the enhancer binding
site and
the positive result of the YY1 supershift, strongly suggest
that YY1 is
the main HERV-K enhancer binding protein. As inferred
from the
supershift experiments, YY1 is present in all enhancer
complexes in
HepG2 and HeLa cells, whereas in teratocarcinoma
cells an additional
and as yet unidentified DNA binding protein,
which also binds to the 62 to 83 region of the HERV-K LTR, is
present.
YY1 enhances HERV-K expression.
We next wanted to know whether
binding of YY1 to the HERV-K enhancer has any effect on the expression
of HERV-K. To test this, we completely replaced the YY1 binding site
containing the region from bp 61 to 84 with the unrelated sequence from
bp 718 to 695 of the pBluescript plasmid polylinker and cloned this
otherwise unaltered full-length (988-bp) HERV-K LTR in sense
orientation upstream of the luciferase gene as a reporter. This
construct, 60PL85, along with the wild-type HERV-K LTR as a control,
was transiently transfected in GH, Tera2, HepG2, and HeLa cells. The luciferase activity obtained was determined relative to the activity evoked by the wild-type LTR and taken as a measure of the promoter activity of the mutant LTR. However, since the luciferase counts of
both wild-type and mutant LTR measured with HepG2 cell lysates were in
the background range of the luminometer (
104 counts),
presumably due to strong repression of the LTR, the HeLa cell line was
chosen to represent HERV-K-nonexpressing cells. Figure
7 shows the relative luciferase activity
for GH, Tera2, and HeLa cells. The mutant LTR construct resulted in a
strong reduction of activity compared to the wild-type LTR activity. The decrease in activity was statistically significant on the basis of
t-test analysis. With this mutated enhancer as a probe in an
EMSA, the nuclear extracts of the cell lines used in the luciferase
assay resulted in only a few weak and nonspecific bands; furthermore,
no YY1 supershift could be obtained (data not shown). Hence, the loss
of specific EMSA bands correlates well with a decrease in luciferase
activity. These results demonstrate that YY1 acts as an activator of
HERV-K expression in both HERV-K-expressing and nonexpressing cell
types.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 7.
Relative luciferase activity of HERV-K LTR constructs
carrying wild-type and mutant YY1 binding sites. Each column represents
the mean relative luciferase activity of the LTR constructs indicated.
Luciferase counts were measured in triplicate in four independent
transfections into Tera2 and HeLa cells. The activity of the wild-type
HERV-K LTR was set as 1. The standard deviation is indicated by the
error bars. The decrease in luciferase activity is statistically
significant according to the t test.
|
|
 |
DISCUSSION |
HERV-K is expressed in a cell-type-specific manner: whereas
most human tissues show only basal expression, detectable by a sensitive reverse transcriptase PCR approach (28a),
teratocarcinoma cell lines display high levels of expression in a
complex pattern of four distinct mRNA species, as can be seen in
Northern blots (19). Luciferase reporter gene assays
identified three regions within the 5' LTR of HERV-K with a
profound influence on the promoter activity: the 5' terminus of the LTR
(termed the 5' enhancer), the promoter region, and the R region
(11). Among these, we started to investigate the 5'
enhancer. We identified a YY1 binding site between bp 62 and 83 of
the HERV-K LTR and showed that YY1 is the major HERV-K enhancer binding
protein in human teratocarcinoma (GH and Tera2), hepatocarcinoma
(HepG2), and cervical carcinoma (HeLa) cells. Furthermore, in
functional reporter gene assays, we showed that the YY1 enhancer
complexes activate HERV-K expression irrespective of the cell type.
The cellular protein YY1 is a 414-amino-acid zinc finger-type
transcription factor with four C-terminally located
C2-H2-type fingers (32). YY1 is
highly conserved from frogs to humans (29) and is
ubiquitously expressed in pluripotent as well as differentiated cells,
including the mouse teratocarcinoma cell line F9 and HeLa cells
(2, 32). The range of YY1-expressing cells has been expanded
here to the human teratocarcinoma cell lines GH and Tera2 and the
hepatocarcinoma cell line HepG2. It is well established that YY1,
together with different cofactors, mediates activation, repression, or
initiation of transcription depending on the genes regulated by YY1
(see reference 33 for a compilation). Besides its
effect on expression of cellular genes, it regulates viral systems as
well. Human immunodeficiency virus type 1, for example, is repressed by
YY1 (23). In addition, several retroelements are regulated
(activated in this case) by YY1; these include the human long
interspersed element LINE-1 (3, 34) and the mouse IAP
(31). Regulatory sequences of LINE-1 elements, which do not
contain LTRs, are located within the 5' untranslated region of the
transcription unit, i.e., at the 5' end of the element itself
(38). It is from within the first 20 bp of these elements that YY1 activates LINE-1 expression (3). Mouse IAPs do
carry LTRs, which contain an IAP upstream enhancer element, located 180 bp upstream of the transcription start site, i.e., within the U3
region. YY1 binds to this enhancer element to stimulate IAP
transcription (31). YY1, most notably, is even able to act as both an activator and repressor on the very same gene. The adeno-associated virus P5 promoter normally is repressed by YY1; however, after association with the adenovirus transactivator E1A, it
acts as an activator on the P5 promoter (15).
For HTDV/HERV-K, the EMSA pattern obtained with nuclear extracts of
HERV-K-expressing GH and Tera2 cells, as opposed to poorly expressing
HeLa cells and nonexpressing HepG2 cells, showed that these cell types
do have a partly different set of protein factors constituting the
enhancer complexes. Teratocarcinoma cells strongly express HERV-K and
form an additional, teratocarcinoma-specific complex in EMSAs (T1)
(Fig. 1). However, expression is more elevated in GH cells than in
Tera2 cells, but the T1 complex is more intense with Tera2 extracts.
Two specific complexes (H1 and H2) are seen with HepG2 nuclear
extracts, the cell line not expressing HERV-K at all. HeLa cells
display an intermediate level of HERV-K expression and have only
enhancer complexes common to all cell lines tested (C1, C2, and C3). It
thus appears that the presence or absence of certain protein complexes,
i.e., the protein composition of the 5' enhancer complexes, roughly
correlates with the magnitude of HERV-K expression in each cell line.
These different complexes might exert functionally different effects
upon the HERV-K LTR promoter activity. However, to verify this
hypothesis, more cell lines must be examined. The enhancer complexes in
GH, Tera2, and HeLa cells all seem to bind only between bp 62 and 83, since there is a complete competition of these complexes with the
subfragment from bp 60 to 86 (Fig. 4). Furthermore, when used as a
probe, this subfragment generates the same bands as the fragment
containing the complete enhancer (bp 1 to 167 [data not shown]). The
behavior of both HepG2-specific complexes (H1 and H2) is more complex, and neither can be generated in EMSAs with probe bp 60 to 86. This
indicates that sequences adjacent to the YY1 binding site may contain
important determinants for assembly of the complete enhancer complex in
HepG2 cells. However, besides YY1, no further components of the
enhancer complexes have been identified. Furthermore, preliminary
experiments indicated that the C3 complex consists of the full-length
YY1 protein bound to the enhancer. In this case, the C1 and C2
complexes are likely to consist of YY1 degradation products. The H2
complex may contain YY1 and a second protein component, and the H1
complex may consist of a YY1 degradation product and a second protein.
Retained DNA binding capacity has been observed with YY1 degradation
products in cellular protein extracts and with YY1 proteins containing
artificially introduced deletions (2, 25).
Recently, the region from bp 60 to 87 of the HERV-K enhancer has been
mapped by DNase I protection with Jurkat nuclear extracts (1). This region is slightly larger than the footprint we
obtained. In UV cross-linking experiments, three proteins of 81, 91, and 98 kDa, tentatively designated ERF1, ERF2, and ERF3, respectively, have been found to constitute the most intense band found in EMSAs with
Jurkat extracts. However, none of these proteins has been identified,
and all are significantly larger than YY1 (68 kDa). Furthermore, the
effect of these ERFs on HERV-K expression is also not known. It thus
remains to be determined whether expression of HERV-K is subject to a
different mode of regulation in T-cell lines from that in
teratocarcinoma cell lines.
The YY1 binding site between bp 62 and 83 overlaps with highly
conserved consensus binding sites for C/EBP and SRY. Binding of these
transcription factors to the HERV-K enhancer, as discussed above, is
rather unlikely. Furthermore, a sequence which also overlaps the YY1
binding site has been described as a putative glucocorticoid responsive
element (GRE) located between bp 75 and 80 (27). As with
many other retroviruses, HERV-K expression can be stimulated by steroid
hormones, suggesting steroid receptor binding to the HERV-K LTR
(28). However, bp 75 to 80 contains only half of a GRE and
thus is most probably not recognized by glucocorticoid receptors
(8). Accordingly, no EMSA band could be supershifted with an
anti-GR immunoglobulin G antibody (Santa Cruz) in preliminary
experiments. Furthermore, this half-site element was not identified in
our TRANSFAC database search, whereas three other complete GREs were
found at bp 18 to 33, bp 194 to 209, and bp 388 to 403, all of which
reside within the U3 region. We therefore suggest that one or more of
these GREs are responsible for the steroid hormone stimulation of expression.
Since the identity of the proteins of the HERV-K enhancer complexes,
except for YY1 itself, is still elusive, the relative contributions of
each single component to the functional enhancer complexes could not be
determined. Luciferase assays, performed with the mutant YY1
binding-site construct (Fig. 7), suggested that the YY1 enhancer
complexes act as activators irrespective of the cell type. The
competition behavior of some EMSA bands obtained with nuclear extracts
of HepG2 cells indicated that sequences outside bp 62 to 83 provide
determinants for complete assembly of the protein complex in HepG2
cells. However, in the constructs tested in the luciferase assay, only
the YY1 binding site itself has been mutated. We therefore cannot rule
out the possibility that some HepG2 enhancer complexes are repressive.
On the YY1 binding-site construct, 60PL85, neither the YY1 complexes
nor the T1 complex assembled, as tested by EMSA (data not shown). Since
the luciferase activity was reduced by 60PL85 to approximately the same
extent in GH, Tera2, and HeLa cell lines (Fig. 7) and T1 is not present
in HeLa cells, YY1 alone appears to be the main stimulating protein of
the HERV-K enhancer. In all four cell lines tested, the 60PL85
construct never resulted in an elevated level of luciferase activity
above the reference activity of the wild-type LTR. This suggests that
YY1 is an activator even in cell lines with only basal HERV-K
expression. However, the luciferase assays also support the notion that
the YY1 enhancer complex alone cannot be responsible for the
cell-type-specific nature of HERV-K expression. The difference in LTR
activity between HERV-K-expressing and nonexpressing cell types is not
evident from Fig. 7, which gives only the relative luciferase
activities of the mutant constructs relative to the activity of the
wild-type LTR in the same cell line. However, the absolute luciferase
counts measured clearly reflect the cell-type-specific influence
integrated over the full-length LTR: in teratocarcinoma cells, the
wild-type HERV-K LTR evoked a luciferase activity on the order of
107 to 108 counts as opposed to
106 counts in HeLa cells and only
104
counts in HepG2 cells (which is within the background range of the
luminometer). Using a luciferase construct with a Rous sarcoma virus
LTR promoter as the internal control, we could show that these
differences are not due to differences in transfection efficiencies.
In addition, we have cloned many full-length HERV-K LTRs
differing in sequence from the human genome and tested them for
promoter activity by the luciferase assay (unpublished data). Some of
them were active as promoters, whereas others resulted in no luciferase activity even in teratocarcinoma cell lines (unpublished data). Within
the YY1 binding site, as determined by DNase I footprinting, the
sequences of all LTRs differed in only one or three positions with respect to the HERV-K10 LTR sequence. The YY1 core
consensus sequence (CCATNTT) (33), however, is
identical in all HERV-K LTRs. Moreover, the EMSA pattern, the
competition behavior, and the YY1 supershift pattern of different
active and inactive LTRs were identical to the ones observed with the
K10 enhancer sequence (data not shown [Fig. 2, 3, and 6 give results
for K10]). This also indicates that the YY1 enhancer complex is not
involved in transcriptional repression of HERV-K. We therefore believe
that repression is mediated by other regions of the LTR, e.g., the promoter region, which outweigh the activating effect of the enhancer region in cell lines which do not express HERV-K.
In this report, we have shown that the human endogenous retrovirus
HERV-K is activated by an YY1-enhancer complex which assembles at the
very 5' end of the U3 region. To gain further insight into the complex
regulation of HERV-K expression, it will be necessary to identify the
additional components of the 5'-enhancer complexes present in
expressing versus nonexpressing cell lines and to functionally characterize their contribution to the enhancing effect of the complexes.
 |
ACKNOWLEDGMENTS |
We are indebted to A. Hornung, H. Bartel, and H. Rahmouni for
excellent technical assistance. We thank B. Kaiser, C. Magin, M. Marschall, R. Kurth, R. Tönjes, and J. Denner for stimulating discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Virology
Department, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, D-63225
Langen, Germany. Phone: 49-6103-77-2000. Fax: 49-6103-77-1252. E-mail: loejo{at}pei.de.
 |
REFERENCES |
| 1.
|
Akopov, S. B.,
L. G. Nikolaev,
P. P. Khil,
Y. B. Lebedev, and E. D. Sverdlov.
1998.
Long terminal repeats of human endogenous retrovirus K family (HERV-K) specifically bind host cell nuclear proteins.
FEBS Lett.
421:229-233[Medline].
|
| 2.
|
Austen, M.,
B. Lüscher, and J. M. Lüscher-Firzlaff.
1997.
Characterization of the transcriptional regulator YY1.
J. Biol. Chem.
272:1709-1717[Abstract/Free Full Text].
|
| 3.
|
Becker, K. G.,
G. D. Swergold,
K. Ozato, and R. E. Thayer.
1993.
Binding of the ubiquitous nuclear transcription factor YY1 to a cis regulatory sequence in the human LINE-1 transposable element.
Hum. Mol. Genet.
2:1697-1702[Abstract/Free Full Text].
|
| 4.
|
Boller, K.,
H. König,
M. Sauter,
N. Müller-Lantzsch,
R. Löwer, and R. Kurth.
1993.
Evidence that HERV-K is the endogenous retrovirus sequence that codes for the human teratocarcinoma-derived retrovirus HTDV.
Virology
196:349-353[Medline].
|
| 5.
|
DeWet, J. R.,
K. V. Wood,
M. DeLuca,
D. R. Helinski, and S. Subramani.
1987.
Firefly luciferase gene: structure and expression in mammalian cells.
Mol. Cell. Biol.
7:725-737[Abstract/Free Full Text].
|
| 6.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 7.
|
Feuchter-Murthy, A. E.,
J. D. Freeman, and D. L. Mager.
1993.
Splicing of a human endogenous retrovirus to a novel phospholipase A2 related gene.
Nucleic Acids Res.
21:135-143[Abstract/Free Full Text].
|
| 8.
|
Hard, T.,
E. Kellenbach,
R. Boelens,
B. A. Maler,
K. Dahlman,
L. P. Freedman,
J. Carlstedt-Duke,
K. R. Yamamoto,
J. A. Gustafsson, and R. Kaptein.
1990.
Solution structure of the glucocorticoid receptor DNA-binding domain.
Science
249:157-160[Abstract/Free Full Text].
|
| 9.
|
Kato, N.,
S. Pfeiffer-Ohlsson,
M. Kato,
E. Larsson,
J. Rydnert,
R. Ohlsson, and M. Cohen.
1987.
Tissue-specific expression of human provirus ERV3 mRNA in human placenta: two of the three ERV3 mRNAs contain cellular sequences.
J. Virol.
61:2182-2191[Abstract/Free Full Text].
|
| 10.
|
Kingsman, S. M., and A. J. Kingsman.
1996.
The regulation of human immunodeficiency virus type-1 gene expression.
Eur. J. Biochem.
240:491-507[Medline].
|
| 11.
| Knössl, M., K. Thelen, R. Löwer, and J. Löwer. Unpublished data.
|
| 12.
|
Kongsuwan, K.,
J. Allen, and J. M. Adams.
1989.
Expression of Hox-2.4 homeobox gene directed by proviral insertion in a myeloid leukemia.
Nucleic Acids Res.
17:1881-1892[Abstract/Free Full Text].
|
| 13.
|
La Mantia, G.,
B. Majello,
A. Di Cristofano,
M. Strazzullo,
G. Minchiotti, and L. Lania.
1992.
Identification of regulatory elements within the minimal promoter region of the human endogenous ERV9 provirus: accurate transcription initiation is controlled by an Inr-like element.
Nucleic Acids Res.
20:4129-4139[Abstract/Free Full Text].
|
| 14.
|
Larsson, E.,
N. Kato, and M. Cohen.
1989.
Human endogenous proviruses.
Curr. Top. Microbiol. Immunol.
148:115-132[Medline].
|
| 15.
|
Lee, J. S.,
K. M. Galvin,
R. H. See,
R. Eckner,
D. Livingston,
E. Moran, and Y. Shi.
1995.
Relief of YY1 transcriptional repression by adenovirus E1A is mediated by E1A-associated protein p300.
Genes Dev.
9:1188-1198[Abstract/Free Full Text].
|
| 16.
|
Leib-Mösch, C.,
M. Haltmeier,
T. Werner,
E. M. Geigl,
W. R. Brack,
U. Francke,
V. Erfle, and R. Hehlmann.
1993.
Genomic distribution and transcription of solitary HERV-K LTRs.
Genomics
18:261-269[Medline].
|
| 17.
|
Löwer, R.,
J. Löwer,
H. Frank,
R. Harzmann, and R. Kurth.
1984.
Human teratocarcinomas cultured in vitro produce unique retrovirus-like viruses.
J. Gen. Virol.
65:887-898[Abstract/Free Full Text].
|
| 18.
|
Löwer, R.,
J. Löwer,
C. Tondera-Koch, and R. Kurth.
1993.
A general method for the identification of transcribed retrovirus sequences (R-U5 PCR) reveals the expression of the human endogenous retrovirus loci HERV-H and HERV-K in teratocarcinoma cells.
Virology
192:501-511[Medline].
|
| 19.
|
Löwer, R.,
K. Boller,
B. Hasenmaier,
C. Korbmacher,
N. Müller-Lantzsch,
J. Löwer, and R. Kurth.
1993.
Identification of human endogenous retroviruses with complex mRNA expression and particle formation.
Proc. Natl. Acad. Sci. USA
90:4480-4484[Abstract/Free Full Text].
|
| 20.
|
Löwer, R.,
R. R. Tönjes,
C. Korbmacher,
R. Kurth, and J. Löwer.
1995.
Identification of a Rev-related protein by analysis of spliced transcripts of the human endogenous retroviruses HTDV/HERV-K.
J. Virol.
69:141-149[Abstract].
|
| 21.
|
Löwer, R.,
J. Löwer, and R. Kurth.
1996.
The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences.
Proc. Natl. Acad. Sci. USA
93:5177-5184[Abstract/Free Full Text].
|
| 22.
|
Luciw, P. A., and N. J. Leung.
1992.
Mechanisms of retrovirus replication, p. 159-298.
In
J. A. Levy (ed.), The Retroviridae, vol. 1. Plenum Press, New York, N.Y.
|
| 23.
|
Margolis, D. M.,
M. Somasundaran, and M. R. Green.
1994.
Human transcription factor YY1 represses human immunodeficiency virus type 1 transcription and virion production.
J. Virol.
68:905-910[Abstract/Free Full Text].
|
| 24.
|
Maxam, A. M., and W. Gilbert.
1980.
Sequencing end-labeled DNA with base-specific chemical cleavages.
Methods Enzymol.
65:499-560[Medline].
|
| 25.
|
Mills, L. K.,
Y. Shi, and R. L. Millette.
1994.
YY1 is the cellular factor shown previously to bind to regulatory regions of several leaky-late (bc, c1) genes of herpes simplex virus type 1.
J. Virol.
68:1234-1238[Abstract/Free Full Text].
|
| 26.
|
Ono, M.
1986.
Molecular Cloning and long terminal repeat sequences of human endogenous retrovirus genes related to types A and B retrovirus genes.
J. Virol.
58:937-944[Abstract/Free Full Text].
|
| 27.
|
Ono, M.,
T. Yasunaga,
T. Miyata, and H. Ushikubo.
1986.
Nucleotide sequence of human endogenous retrovirus genome related to the mouse mammary tumor virus genome.
J. Virol.
60:589-598[Abstract/Free Full Text].
|
| 28.
|
Ono, M.,
M. Kawakami, and H. Ushikubo.
1987.
Stimulation of expression of the human endogenous retrovirus genome by female steroid hormones in human breast cancer cell line T47D.
J. Virol.
61:2059-2062[Abstract/Free Full Text].
|
| 28a.
| Phelps et al. Submitted for publication.
|
| 29.
|
Pisaneschi, G.,
S. Ceccotti,
M. L. Falchetti,
S. Fiumicino,
F. Carnevali, and E. Beccari.
1994.
Characterization of FIII/YY1, a Xenopus laevis conserved zinc-finger protein binding to the first exon of L1 and L14 ribosomal protein genes.
Biochem. Biophys. Res. Commun.
205:1236-1242[Medline].
|
| 30.
|
Ruddell, A.
1995.
Transcription regulatory elements of the avian retroviral long terminal repeat.
Virology
206:1-7[Medline].
|
| 31.
|
Satyamoorthy, K.,
K. Park,
M. L. Atchison, and C. C. Howe.
1993.
The intracisternal A-particle upstream element interacts with transcription factor YY1 to activate transcription: pleiotropic effects of YY1 on distinct DNA promoter elements.
Mol. Cell. Biol.
13:6621-6628[Abstract/Free Full Text].
|
| 32.
|
Shi, Y.,
E. Seto,
L. S. Chang, and T. Shenk.
1991.
Transcriptional repression by YY1, a human GLI-Krüppel-related protein, and relief of repression by adenovirus E1A protein.
Cell
67:377-388[Medline].
|
| 33.
|
Shrivastava, A., and K. Calame.
1994.
An analysis of genes regulated by the multi-functional transcriptional regulator Yin Yang-1.
Nucleic Acids Res.
22:5151-5155[Free Full Text].
|
| 34.
|
Singer, M. F.,
V. Krek,
J. P. McMillan,
G. D. Swergold, and R. E. Thayer.
1993.
LINE-1: a human transposable element.
Gene
135:183-188[Medline].
|
| 35.
|
Sjøttem, E.,
S. Anderssen, and T. Johansen.
1996.
The promoter activity of long terminal repeats of the HERV-H family of human retrovirus-like elements is critically dependent on Sp1 family proteins interacting with a GC/GT box located immediately 3' to the TATA box.
J. Virol.
70:188-198[Abstract].
|
| 36.
|
Steinhuber, S.,
M. Brack,
G. Hunsmann,
H. Schwelberger,
M. P. Dierich, and W. Vogetseder.
1995.
Distribution of human endogenous retrovirus HERV-K genomes in humans and different primates.
Hum. Genet.
96:188-192[Medline].
|
| 37.
|
Strazzullo, M.,
B. Majello,
L. Lania, and G. La Mantia.
1994.
Mutational analysis of the human endogenous ERV9 proviruses promoter region.
Virology
200:686-695[Medline].
|
| 38.
|
Swergold, G. D.
1990.
Identification, characterization and cell specificity of a human LINE-1 promoter.
Mol. Cell. Biol.
10:6718-6729[Abstract/Free Full Text].
|
| 39.
|
Ting, C.-N.,
M. P. Rosenberg,
C. M. Snow,
L. C. Samuelson, and M. H. Meisler.
1992.
Endogenous retroviral sequences are required for tissue-specific expression of a human salivary amylase gene.
Genes Dev.
6:1457-1465[Abstract/Free Full Text].
|
| 40.
| Tönjes, R. R., R. Löwer, K. Boller, J. Denner, B. Hasenmaier, H. Kirsch, H. König, C. Korbmacher, C. Limbach, R. Lugert, R. C. Phelps, J. Scherer, K. Thelen, J. Löwer, and R. Kurth. 1996. HERV-K: The biologically most
active human endogenous retrovirus family. J. Acquired Immune Defic.
Syndr. Hum. Retrovirol. 13(Suppl.
1):261-267.
|
| 41.
|
Wilkinson, D. A.,
D. L. Mager, and J. C. Leong.
1994.
Endogenous human retroviruses, p. 465-535.
In
J. A. Levy (ed.), The Retroviridae, vol. 3. Plenum Press, New York, N.Y.
|
| 42.
|
Wingender, E.
1994.
Recognition of regulatory regions in genomic sequences.
J. Biotechnol.
35:273-280[Medline].
|
Journal of Virology, February 1999, p. 1254-1261, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lavie, L., Kitova, M., Maldener, E., Meese, E., Mayer, J.
(2005). CpG Methylation Directly Regulates Transcriptional Activity of the Human Endogenous Retrovirus Family HERV-K(HML-2). J. Virol.
79: 876-883
[Abstract]
[Full Text]
-
Seifarth, W., Frank, O., Zeilfelder, U., Spiess, B., Greenwood, A. D., Hehlmann, R., Leib-Mosch, C.
(2005). Comprehensive Analysis of Human Endogenous Retrovirus Transcriptional Activity in Human Tissues with a Retrovirus-Specific Microarray. J. Virol.
79: 341-352
[Abstract]
[Full Text]
-
Zhong, L., Qing, K., Si, Y., Chen, L., Tan, M., Srivastava, A.
(2004). Heat-shock Treatment-mediated Increase in Transduction by Recombinant Adeno-associated Virus 2 Vectors Is Independent of the Cellular Heat-shock Protein 90. J. Biol. Chem.
279: 12714-12723
[Abstract]
[Full Text]
-
Lee, W. J., Kwun, H. J., Jang, K. L.
(2003). Analysis of transcriptional regulatory sequences in the human endogenous retrovirus W long terminal repeat. J. Gen. Virol.
84: 2229-2235
[Abstract]
[Full Text]
-
Qing, K., Hansen, J., Weigel-Kelley, K. A., Tan, M., Zhou, S., Srivastava, A.
(2001). Adeno-Associated Virus Type 2-Mediated Gene Transfer: Role of Cellular FKBP52 Protein in Transgene Expression. J. Virol.
75: 8968-8976
[Abstract]
[Full Text]
-
Broyles, S. S., Liu, X., Zhu, M., Kremer, M.
(1999). Transcription Factor YY1 Is a Vaccinia Virus Late Promoter Activator. J. Biol. Chem.
274: 35662-35667
[Abstract]
[Full Text]