Previous Article | Next Article 
Journal of Virology, February 1999, p. 1092-1098, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Two-Helper RNA System for Production of Recombinant
Semliki Forest Virus Particles
C.
Smerdou1 and
P.
Liljeström1,2,*
Microbiology and Tumor Biology Center,
Karolinska Institute, S-17177 Stockholm,1
and
Department of Vaccine Research, Swedish Institute for
Infectious Disease Control, S-17182 Solna,2
Sweden
Received 18 September 1998/Accepted 30 October 1998
 |
ABSTRACT |
Alphavirus expression systems based on suicidal virus particles
carrying recombinant replicons have proven to be a very efficient way
to deliver genes for heterologous protein expression. However, present
strategies for production of such particles have biosafety limitations
due to the generation, by RNA recombination, of replication-proficient viruses (RPVs). Here we describe a new packaging system for Semliki Forest virus (SFV) based on a the use of a two-helper system in which
the capsid and spike proteins of the C-p62-6K-E1 polyprotein are
expressed from two independent RNA molecules. The capsid gene contains
a translational enhancer and therefore that sequence was also
engineered in front of the spike sequence p62-6K-E1. A sequence coding
for the foot-and-mouth disease virus 2A autoprotease was inserted in
frame between the capsid translational enhancer and the spike genes.
This allows production of the spike proteins at high levels with
cotranslational removal of the enhancer sequence and normal
biosynthesis of the spike complex. The autoprotease activity of the
capsid protein was abolished by mutation, further increasing the
biosafety of the system. Cotransfection of cells with both helper RNAs
and an SFV vector replicon carrying the LacZ gene led to production
of recombinant particles with titers of up to 8 × 108 particles per 106 cells. Extensive analysis
failed to demonstrate the presence of any RPVs, emphasizing the high
biosafety of the system based on two-helper RNAs.
 |
INTRODUCTION |
In recent years, much progress has
been made in the development of expression systems for the delivery of
foreign genes for vaccination or gene therapy. These systems include
the use of viral vectors and the direct delivery of naked nucleic acids
(for reviews, see references 8, 33, 35, 37-39, 48,
and 52). Viral vectors are superior in terms of
efficiency of entry into the target cells, which is usually mediated
through specific receptor binding at the cell surface. However, one of
the main problems present in many viral systems is the generation of
replication-proficient viruses (RPVs) during the production process.
This is usually the consequence of recombination taking place between
the recombinant genome to be encapsidated into particles and the helper
systems used to provide all of the elements necessary for the
production of the particles. Contamination with RPVs can be a major
problem in the case of vectors based on pathogenic viruses, such
as retroviruses (4, 5, 29). Other problems associated
with the production of viral vectors are related to low packaging
efficiencies and difficulties in the generation of high titers of
recombinant particles (20).
Alphaviruses, which are enveloped positive-strand RNA viruses, have
recently been exploited as expression vectors (for reviews, see
references 11 and 23).
Alphaviruses offer several advantageous features, such as a broad host
range (including cells of avian, insect, and mammalian origin), high
levels of protein expression, and a small genome that is easy to
manipulate. Alphaviral vectors have been based on Semliki Forest virus
(SFV), Sindbis virus, and Venezuelan equine encephalitis virus (VEE)
(26, 36, 51). The genome of alphaviruses is a capped and
polyadenylated positive-strand RNA molecule of 11 to 12 kb
(45). Productive infection can be initiated either by
infection or by transfection of a cell with the viral RNA. The 5'
two-thirds of this RNA can be directly translated to produce the viral
replicase. This enzyme will copy the genome into negative strands,
which serve as the template for the production of new positive-strand
genomes. The replicase also utilizes an internal promoter on the minus
strand to produce a subgenomic RNA which corresponds to the last third
of the virus genome. This subgenomic RNA encodes the structural
proteins of the virus. These proteins are synthesized as a polyprotein
precursor (NH2-C-p62-6K-E1-COOH) which is cotranslationally
cleaved by the capsid protease and signal peptidase to produce the
capsid protein (C) and the envelope proteins p62, 6K, and E1 (13,
19, 25, 31, 32). In SFV and Sindbis virus sequences at the 5' end
of the capsid gene function as a translational enhancer, providing a
high expression level of the structural proteins (12, 43).
The C protein complexes with new viral genomes to form cytoplasmic
nucleocapsid structures, while the spike proteins are translocated to
the endoplasmic reticulum (ER), where p62 and E1 dimerize and are
routed to the cell surface, where budding occurs (14, 16,
46). During transport to the cell surface p62 is cleaved to its
mature form E2 by a host cell protease. This cleavage is necessary for
the infectivity of the particles (28, 42).
In the SFV vector system, the production of recombinant particles is
based on the cotransfection of cells with two independent RNAs. The
first one is the vector replicon, which contains the replicase gene,
the subgenomic promoter followed by the heterologous gene, and the 5'
and 3' ends of the genome required for replication. The second one is
the helper RNA, which also contains the 5' and 3' replication signals
and a subgenomic promoter followed by the genes coding for the
structural proteins (helper-1) (23, 26). Both RNAs can
be synthesized in vitro from plasmids which contain these
sequences under the SP6 promoter or produced within the cell by
transcription from a eukaryotic promoter (2, 7, 9). The
replicase encoded by the vector molecule will amplify both RNA species.
However, only the replicase containing RNA is packaged into viral
particles, since the capsid packaging signal is located within the
replicase gene, a region which is absent from the helper RNA (22,
50). The particles generated in this way contain a defective
genome that while able to replicate cannot result in a productive
infection. When such particles are used to infect animal cells, only
the replicase and the heterologous gene products are expressed, and
since no structural proteins can be produced no new particles are
generated. However, a potential problem arises if wild-type virus is
formed during packaging reactions due to recombination between the two
RNA species. The generation of such wild-type virus occurs with a
relatively high frequency in this type of SFV packaging system
(SFV-helper-1) (1). In order to circumvent this problem a
new SFV helper system was developed in which a mutation abolishing
intracellular cleavage of p62 was introduced, rendering the particles
conditionally infectious (helper-2) (1). The noninfectious
particles can be artificially "activated" by incubation with
chymotrypsin in vitro. With this packaging strategy, RPVs have not been
detected, increasing considerably the biosafety of the SFV expression
system. However, the helper-2 system presents some drawbacks, such as
the necessity of activating the particles with chymotrypsin, which
makes their possible use in vaccination less convenient and more
costly. In addition, recombination between the SFV replicon and the
helper-2 RNAs is not prohibited, although the generation of RPVs would
also require reversions or suppressor mutations to regenerate a
functional p62 cleavage site. Such mutations have been found which
either regenerated the p62 cleavage site or restored infectivity
without cleavage of p62, probably through conformational changes of the
protein (47). When additional nucleotide changes were made
to reduce the frequency of reversion, new suppressors were found in a
different domain of the protein (47). Although the
probability of simultaneously having recombination and suppressor
mutations is very low, it cannot be completely excluded. In this study
we present an alternative strategy for packaging of SFV recombinant
RNAs. By splitting the capsid and spike helper regions into two
independent RNAs, recombination becomes negligible. An additional
mutation that abolishes the capsid self-cleaving activity (19,
32) has also been introduced into the helper, further increasing
the biosafety of the system.
 |
MATERIALS AND METHODS |
Plasmid constructs.
The replicon encoding plasmids pSFV-lacZ
(26) and pSFV-Camber (originally designated as
pSFV-c) (46) have been previously described. pSFV-helper-S1,
-S2, and -S3 were constructed as follows. Two complementary synthetic
oligonucleotides,
5'-gttgcaggccactccggtggctcccgtcgtcaattttgaccttcttaagcttgcgggagacgtcgagtccaaccctgggccctccgccccgctgattactgcc-3' and
5'-ggagggcccagggttggactcgacgtctcccgcaagcttaagaaggtcaaaattgacgacgggagccaccggagtggcctgcaac-3', containing the sequence of foot-and-mouth disease virus (FMDV) 2A
protease (40) preceded by a few nucleotides of the 3' end of
the SFV capsid translation enhancer (43), were hybridized and cloned into the unique StuI site of pSFV-helper-1. The
small BstXI/BstXI fragment was removed to delete
extra capsid sequences. Finally, the small
ApaI/XhoI fragment was substituted by PCR
products S1, S2, and S3 (synthesized as described below), yielding
plasmids pSFV-helper-S1, -S2, and -S3, respectively. PCR products S1,
S2, and S3 were synthesized by using pSFV-helper-1 as a template; primer 5'-gaccggacggcattctcaatg-3' (nucleotides 442 to 420 of p62) as downstream primer; and
5'-cctgggccctccgccccgctgattactgcc-3', 5'-aaccctgggcccgccccgctgattactgcc-3', and
5'-aaccctggg cccctgattactgccatgtgtgtcc-3', which
contain the different 2A-p62 fusion sequences, as upstream primers, respectively. pSFV-helper-E was constructed by digesting pSFV-spike (46) with AccI to remove most of the
open reading frame (ORF) coding for the replicase. pSFV-helper-C was
derived from pSFV-Camber by deletion of both the replicase
sequences flanked by AccI and the small
NdeI/XhoI fragment within the p62 ORF. In order
to generate pSFV-helper-C-S219A and pSFV-helper-1-S219A, a PCR fragment
was synthesized by using pSFV-helper-C as a template, and primers
5'-gattgaaaatgactgtatcttcgaagtc-3' and
5'-ttgtcaaagatgggccggccggcgtctcccggtttgcccgc-3' as upstream and downstream primers, respectively. The
latter contains three mutated nucleotides (underlined sequence), which
give rise to a change of serine to alanine in position 219 of the
capsid. The PCR fragment obtained in this way was digested with
BstBI and FseI and cloned into both pSFV-helper-C
and pSFV-helper-1 digested with the same enzymes.
Transfection of cells and in vivo packaging of recombinant
RNA.
RNA synthesis was performed as described previously
(26), but omitting the bovine serum albumin from the
reaction and using 45 U of SP6 polymerase (Pharmacia Biotech, Uppsala,
Sweden) per reaction. RNA was transfected into BHK-21 cells by
electroporation as described previously (24, 27). To package
recombinant RNAs into SFV particles with a single helper, 25 µl of
the recombinant and the helper RNA transcription reactions were mixed
and added to the cells for electroporation. When recombinant SFV RNA
was packaged with the two-helper RNA system, 50 µl of each RNA
transcription reaction was used.
Analysis of gene expression.
Metabolic labelling of SFV
infected-transfected cells (27), immunofluorescence
(42), immunoprecipitation (49), and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (25) were done essentially as described previously.
Monoclonal antibodies (MAbs) specific for E1 (E1-1) and E2 (E2-3) were
kindly provided by M. Kielian (21). For detection of the
capsid protein, specific MAb 36-1-9 was used (17). For
detection of
-galactosidase (
-Gal) expression, a commercial MAb
was used (Boehringer Mannheim). The MAb specific for the nsp2 subunit
of the replicase was kindly provided by W. Bodemer. Supernatants from
metabolically labeled transfected cells were clarified three times by
low-speed centrifugation and then ultracentrifuged at
100,000 × g through a 20% sucrose cushion in order to
selectively pellet the viral particles.
Infection of BHK-21 cells with SFV recombinant particles.
BHK-21 cells were infected with SFV particles as described previously
(27). To determine the number of PFU, confluent monolayers of BHK-21 cells were infected with different dilutions of the virus,
after 1 h of adsorption medium was removed and overlay medium was
added (BHK-21 complete medium and minimal essential medium-1.9%
agarose, [1:1]). Cells were incubated for 48 to 72 h at 37°C,
fixed with 10% formaldehyde in phosphate-buffered saline, and stained
with 0.1% crystal violet in methanol-H2O (20:80).
 |
RESULTS |
Expression of capsid and spike proteins from separate helpers.
The two-helper system placed the capsid and spike protein encoding
genes of helper-1 on separate molecules. Translation termination of the
capsid was achieved by placing a stop codon (amber) at the end of the
ORF (Fig. 1A). The 5' end of the capsid
gene coding for the first 34 amino acid residues has been shown to
contain a translational enhancer (12, 43). Therefore, to
express the spike proteins of SFV independently from the capsid at a
level similar to that of the wild-type virus, a fragment coding for those residues was placed in front of p62-6K-E1. The sequence of FMDV
2A autoprotease, encoding only 17 amino acids (40), was
inserted in frame between the capsid translational enhancer and p62 in
order to provide cleavage between the two proteins (Fig. 1A). As the 2A
protease requires a proline at the COOH-terminal side of the cleavage
site (41), this amino acid will be the first residue of p62.
Because the effect of this extra amino acid in p62 was unknown, three
different constructs were made. The first one contained an extra
proline at the NH2-terminal sequence of p62 (helper-S1). In
the second one, the extra proline was substituted for the first serine
of p62 (helper-S2), and in the third construct the first two amino
acids of p62 were deleted, taking advantage of the fact that the third
residue in p62 is a proline (helper-S3) (Fig. 1B).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
SFV replicons and helpers used in the study. (A) The two
replicons SFV-lacZ and SFV-Camber, as well as helper
SFV-helper-1, have been described previously (26, 46). In
all cases the arrow indicates the position of the subgenomic promoter
26S from which the replicase starts the synthesis of the subgenomic
RNAs. The solid black circle to the left of each RNA represents the
CAP. Rep, SFV replicase; C, capsid; Cenh, capsid enhancer;
stop, termination codon UAG; 2A, FMDV 2A autoprotease;
An, poly(A). (B) Amino acid sequence of the FMDV 2A
protease-p62 fusion in the different SFV-helper-S. Boldface text
indicates the sequence from FMDV 2A protease. Text in italics indicates
the sequence from p62. The arrow indicates the putative 2A cleavage
site.
|
|
To compare the expression of the spike proteins from the three
different SFV-helper-S systems, RNAs were transcribed in vitro from
each of the plasmids with SP6 polymerase and used to cotransfect BHK-21
cells together with SFV-Camber RNA (46). This
latter RNA is an SFV genome in which the sequences coding for the spike proteins have been deleted and a stop codon has been placed at the end
of the capsid gene, providing both the replicase and the capsid protein
in trans (Fig. 1A). SFV-helper-E RNA, in which the spike
proteins are expressed directly from the SFV 26S promoter without the
capsid enhancer was also cotransfected with SFV-Camber RNA
to monitor the capsid enhancer activity. Cells were pulsed-labeled and
chased for different times (Fig. 2). When
the expression was analyzed after a 5-min chase, a band which had the
same apparent molecular weight as p62 expressed in cells cotransfected
with SFV-Camber plus helper-1 (used as a positive control)
could be detected with helper-S1, -S2, and -S3 in lysates of
transfected cells, indicating that the protein had been properly
cleaved off from the capsid enhancer by the 2A autoprotease. The
intensity of the p62 band and of a lower band of approximately 50 kDa
corresponding to E1+E2 is very similar in both helper-1- and the
helper-S-transfected cells, indicating that the capsid
NH2-terminal sequence placed in helper-S is providing the
expected translational enhancement. The bands corresponding to p62 and
E1+E2 had a much lower intensity when they are expressed from helper-E,
which does not contain the translation enhancer (Fig. 2A, lane E).
After a 3-h chase most of p62 had been processed to E2 (which
comigrates with E1) in all three helper-S systems and helper-1 (Fig.
2B). Moreover, similar amounts of spike proteins (E1+E2) and capsid
could be detected in the supernatant of cells transfected with helper-1 and the different helper-S RNAs after a 3-h chase, indicating that in
all cases viral particles had been formed with similar efficiency (Fig.
2D).

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 2.
SDS-PAGE analysis of SFV structural proteins in cells
cotransfected with SFV-Camber replicon and different
SFV-helper RNAs. At 12 h posttransfection, cells were
pulse-labeled for 15 min and chased for 5 min (A and C) or 3 h (B
and D). Cell lysates were loaded directly onto the gel (A and B). The
bands in gels A and B are specific for SFV, since the efficient shutoff
of host cell proteins induced by SFV replication only allows SFV-driven
genes to be expressed. Virus was sedimented from supernatants as
described in Materials and Methods (C and D). SFV-Camber RNA
was coelectroporated with the following RNAs: lane 1, SFV-helper-1;
lane S1, SFV-helper-S1; lane S2, SFV-helper-S2; lane S3, SFV-helper-S3;
lane E, SFV-helper-E.
|
|
Production of viral particles with different helpers.
BHK-21
cells were cotransfected with SFV-Camber RNA and helper-1,
-S1, -S2, -S3, or -E, respectively. Supernatants were collected 24 h later and titrated on BHK-21 monolayers. Only marginally higher
titers were obtained for helper-1 compared to the different helper-S
RNAs tested (Table 1), indicating that
the small modification in the NH2-terminal end of p62
expressed from the three different helper-S RNAs did not affect the
functionality of the protein. These titers also confirmed that the
spike proteins were expressed at a similar level from all helper-S RNAs
compared to that from helper-1. The titers obtained when the spikes
were expressed without the capsid enhancer (helper-E) were reduced 16 to 24 times, reflecting the much lower expression level of the spikes.
Packaging of SFV recombinant RNA with a two-helper
system.
In order to test the functionality of the SFV
two-helper system, BHK-21 cells were cotransfected with RNAs
transcribed from pSFV-lacZ, pSFV-helper-C, and each of the
pSFV-helper-S plasmids, or pSFV-helper-E. Cells were
pulsed-labeled and chased for different times (Fig.
3). After either a 5-min or a 3-h chase,
the same pattern of labeled proteins was observed in lysates of cells
cotransfected with SFV-lacZ plus SFV-helper-C plus SFV-helper-S RNAs as
in cells cotransfected with SFV-lacZ plus SFV-helper-1 RNAs
(Fig. 3A and B, six first lanes). When cells were cotransfected with
SFV-lacZ plus SFV-helper-C plus SFV-helper-E RNAs, the spike proteins
could not be detected, as was expected from previous results. In the supernatants, only the SFV structural proteins could be detected after
a 3-h chase, but not
-Gal (not shown) since this protein is not
incorporated into particles (Fig. 3C and D, six first lanes). The
relative intensity of the bands in the supernatants indicated a higher
production of particles in the cells electroporated with helper-1
compared to those cotransfected with helper-S plus helper-C. Very faint
bands could be detected with helper-E plus helper-C, indicating a very
poor production of particles (Fig. 3D, lane E). In a parallel
experiment the supernatants from similarly transfected cells were
collected after 24 h and titrated (Table 1). Cells transfected
with SFV-lacZ plus SFV-helper-C plus SFV-helper-S RNAs yielded titers
which were about 10 times lower than those obtained with SFV-lacZ plus
SFV-helper-1; this was probably due to the higher probability of
transfecting a cell with two RNAs versus three RNAs. However, in one
single experiment, a titer of 8 × 108
particles/106 cells was obtained with SFV-helper-S1 (not
included in Table 1), indicating that the system can be further
optimized. In general, the titers obtained with helper-S3 were slightly
lower than the ones obtained with helper-S1 and -S2. When cells were
cotransfected with SFV-lacZ plus SFV-helper-E plus SFV-helper-C RNAs,
the titers were reduced almost 1,000-fold with respect to helper-1, as
was expected from previous experiments involving two RNAs.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 3.
SDS-PAGE analysis of SFV structural proteins in cells
cotransfected with the SFV-lacZ replicon and different SFV-helper RNAs.
At 12 h posttransfection, cells were pulse-labeled for 15 min and
chased for 5 min (A and C) or 3 h (B and D). Cell lysates were
immunoprecipitated with a -Gal-specific MAb (A and B, upper panels)
or with a cocktail of MAbs specific for the SFV structural proteins
(capsid, E2 and E1) (A and B, lower panels). Virus was sedimented from
supernatants as described in Materials and Methods (C and D). SFV-lacZ
RNA was coelectroporated with the following: lane 1, SFV-helper-1; lane
S1, SFV-helper-S1 plus SFV-helper-C; lane S2, SFV-helper-S2 plus
SFV-helper-C; lane S3, SFV-helper-S3 plus SFV-helper-C; lane E,
SFV-helper-E plus SFV-helper-C; lane Z, no RNA; lane 1m,
SFV-helper-1-S219A; lane Cm, SFV-helper-S-1 plus SFV-helper-C-S219A.
The upper portions of panels A and B were exposed only one-third of the
time compared to the lower panels; in panel D, lane 1 was exposed
one-tenth of the time compared to the other lanes. The capsid protein
of SFV often smears in SDS-PAGE and is not a good indicator of
quantitation.
|
|
Frequency of RPVs in the stocks generated with the two-helper
system.
To determine whether any RPVs were generated with the
two-helper packaging strategy, a procedure involving three sequential steps was used. In the first step, SFV-lacZ RNA was packaged into particles by cotransfecting cells with SFV-lacZ plus SFV-helper-S1 plus
SFV-helper-C RNAs as described above. In the second step, these
particles were used to infect confluent monolayers of BHK-21 cells at a
multiplicity of infection (MOI) of 5 and incubated for 20 h to
amplify any RPV present in the stock. Finally, supernatants from the
infected cells were titrated in a PFU assay. With this protocol, no PFU
could be found in 4.6 × 109 particles from 13 independent SFV-lacZ recombinant stocks, indicating that the frequency
of recombination (recombinants) is lower than 4.6 × 10
9. The possibility that the presence of a few RPVs in
the stock could be masked by the great number of recombinant particles
present in the stock (superinfection exclusion) was ruled out by mixing a small number of wild-type SFV particles with a recombinant stock that
had previously been shown not to contain RPVs and then using the
mixture to infect BHK-21 cells at different multiplicities. Supernatants were titrated after a 20-h incubation. As shown in Table
2, a few PFUs added to the stock (three
or five) could be detected when an MOI of 6 was used to infect the
monolayer.
Introduction of a mutation in SFV-helper-C to increase the safety
of the system.
Although no RPVs were detected in SFV-lacZ
recombinant particles packaged with the two-helper system, the
possibility of generating wild-type genomes through two recombination
events still remains. To further improve the safety of the system, the
capsid gene encoded by pSFV-helper-C was mutated in order to abolish
its cleaving activity, which is dispensable in the two-helper system
but necessary if a full-length genome is reconstituted through
recombination. The mutation of serine-215 to alanine had earlier been
shown to abolish the self-cleaving activity of the capsid in Sindbis
virus without altering the structure of the protein (3, 19).
The equivalent position in the SFV capsid (Ser-219) (32) was
mutated to alanine in both pSFV-helper-C and pSFV-helper-1, generating plasmids pSFV-helper-C-S219A and pSFV-helper-1-S219A, respectively. To
test the functionality of the mutated helper, cells were
coelectroporated with SFV-lacZ, SFV-helper-S1, and SFV-helper-C-S219A
RNAs. Both the pattern of protein expression and the titers of SFV-lacZ
particles packaged with this new system were very similar to those
obtained with the original SFV-helper-C RNA (Fig. 3, lane Cm, and Table 1), indicating that the mutation in the capsid did not affect the
functionality of the protein. To check the effect of this mutation in a
system where capsid cleavage is necessary for the processing of the
spike proteins, cells were coelectroporated with SFV-lacZ and
SFV-helper-1-S219A RNAs. When the pattern of protein expression was
analyzed through a pulse-chase experiment, no mature capsid protein
could be detected in the cell extracts (Fig. 3A and B, lane 1m),
indicating that self-cleavage from the spikes did not occur. Several
high-molecular-weight products were detected after a 5-min chase; these
presumably corresponded to the polyprotein intermediates. A band of 50 kDa, most likely corresponding to E1, could also be detected; this
protein was the last fragment of the polyprotein which may have been
translocated to the ER and generated via signal peptidase cleavage.
After a 3-h chase, most of the polyprotein intermediates had been
degraded, and only the 50-kDa band remained. No viral protein could be
detected in the supernatants (Fig. 3D, lane 1m), and the titers after
24 h were about 104 times lower than those obtained
with SFV-helper-1 (Table 1), a result possibly reflecting the frequency
of reversion of the capsid mutation.
 |
DISCUSSION |
The present study shows that SFV recombinant RNA can be
efficiently packaged by using two independent helper RNAs which provide in trans the spike and capsid proteins, respectively. This
technology offers the following important advantages over previous SFV
packaging systems. (i) A high level of biosafety is obtained due to the requirement of at least two recombination events in order to generate full-length genomes. (ii) It does not require the self-cleaving activity of the capsid, which allows the introduction of mutations abolishing this activity, thus further enhancing the safety of the
system. (iii) It does not require the activation of particles with
chymotrypsin, making the system much easier to handle and less costly
than previous SFV helper systems (1, 47).
In order to construct the two-helper system, it was necessary to
express the spike proteins without the capsid at levels comparable to
those of the wild-type virus. Because the high level of expression of
structural proteins in SFV is dependent on the translation-enhancing effect of 5' sequences in the capsid gene, it was necessary to fuse
this enhancing sequence of the capsid with the spike genes. It had been
shown previously that as few as 102 nucleotides from the 5' end of the
capsid gene could provide an enhancer effect of about 80% of that
achieved with the whole gene when this sequence was fused to the
-Gal gene (43). This minimal enhancing sequence was able
to enhance the expression of the SFV spike proteins to levels similar
to those obtained with helper-1, as shown in pulse-chase and packaging
experiments in which the capsid was supplied in trans by the
SFV-Camber replicon. The lack of the capsid enhancer considerably decreased the production of the spikes, with a
corresponding decrease in particle titers of up to 102, in
experiments involving two or three RNAs. In the normal processing of
SFV structural proteins, the COOH-terminal domain of the capsid functions as a serine protease that is able to self-cleave from p62
(32). In order to remove the 34 amino acids encoded by the capsid enhancer from p62, it was necessary to use the 2A autoprotease from FMDV. This is a very short self-cleaving protease that can function with a sequence that is as short as 17 amino acids (40, 41). The protease has previously been used to fuse proteins of
different origin, being able to work independently of the sequences placed upstream and downstream of it (30, 34, 40). The
cleavage takes place between the two last residues, which means that
the last proline of the 2A sequence will remain at the
NH2-terminal end of the protein placed downstream. In our
study, the 2A protease showed a high cleavage efficiency in all of the
different capsid enhancer-p62-6K-E1 fusions that were tested. This
cleavage allowed a normal translocation of the p62-6K-E1 polyprotein to
the ER, as indicated by the normal signal peptidase processing of the polyprotein into its subunits, and the efficient production of SFV
particles. Three different variants of p62 were expressed that
contained one extra proline at the amino terminal end, a substitution
of the first amino acid by a proline, or a deletion of the two first
amino acids, respectively. All of them showed similar expression levels
and packaging efficiencies. This indicates that the
NH2-terminal end of p62, which upon processing by a host furin-like protease becomes E3 (a small glycosylated peptide of 66 amino acids that in SFV remains in the surface of the virus particles)
(6, 15), can be subjected to small modifications without
affecting the viability of the virion.
A different strategy to express the spike proteins of an alphavirus at
high levels in the context of two-helper RNAs has been used by Frolov
et al. (10). They constructed a helper in which the Sindbis
spike genes were fused to the capsid gene of Ross River virus
containing deletions in the RNA binding domain but which maintained
both the translation-enhancing and the self-cleaving activities.
Although no recombinants were detected with this system, the
heterologous mutated capsids were able to assemble into chimeric particles that were not completely devoid of viral RNA. A bipartite helper packaging system has also been described for VEE
(36), but in this case the spike proteins were expressed
without the capsid translation enhancer, which apparently is not needed
in the VEE context.
The cotransfection of cells with helper-S and helper-C RNAs in
combination with a recombinant SFV RNA carrying a foreign gene proved
to be a powerful method for the production of recombinant particles.
Titers of 2 × 108 SFV-lacZ particles per
106 cells were routinely obtained with the two-helper
system, and in some cases up to 8 × 108
particles/106 cells could be generated, indicating that the
system can be further optimized. The two-helper system proved to be
extremely safe in terms of RPV generation, given the fact that no RPVs
could be detected in 4.6 × 109 particles. This is due
to the fact that two different recombination events, plus the reversion
of the stop codon at the 3' end of the capsid gene, would be necessary
to generate a wild-type genome. There is also the possibility that only
two recombination events could be enough to generate a wild-type genome
if one of them took place exactly between the last codon of the capsid
and the beginning of p62, but in this case it would be essential that the last residue of the capsid, Trp 267, be maintained for retaining the self-cleaving activity of the protein (44). In order to further reduce the probability of generating RPVs, the mutation S219A
was introduced into the capsid gene in helper-C to abolish the
self-cleaving activity of this protein, an activity which is not
required in the two-helper expression system. The serine in position
215 of the capsid of the Sindbis virus had previously shown to be part
of a catalytic triad formed by His-141, Asp-147, and Ser-215 (18,
19). When this serine was mutated to isoleucine or alanine, the
cleaving activity was completely suppressed (19). Furthermore, crystallographic studies of the Sindbis virus capsid COOH-terminal domain containing either a serine or an alanine at
position 215 did not show any significant differences in structure (3). We showed that the SFV capsid containing a similar
mutation was incorporated normally in viral particles when expressed
from SFV-helper-C-S219A, indicating that the mutation in this position does not affect the functionality of the protein. The maximum frequency
of reversion of this mutation can be estimated from the number of
particles generated with the SFV-helper-1-S219A, since these can only
be generated through a reversion restoring the capsid self-cleaving
activity. This frequency can be calculated as follows:
SFV-helper-1-S219A titer/SFV-helper-1 titer = 4.2 × 10
5. The frequency of one single recombination event in
the SFV-helper-1 system had been previously determined to be less than
10
6 (1). If we assume a similar frequency for
each of the two recombination events necessary to generate wild-type
virus in the two-helper system, the theoretical frequency of RPV
generation with SFV-helper-C-S219A would be less than 10
6 × 10
6 × 4.2 × 10
5 = 4.2 × 10
17. This number is too small for testing
experimentally. The RPV generation frequency in the SFV two-helper
packaging system was determined to be <4.6 × 10
9
and thus an empirical RPV generation frequency in this system with the
S219A mutant would be <4.6 × 10
9 × 4.2 × 10
5 = <1.9 × 10
13. These results
indicate that the two-helper system constitutes an efficient and highly
safe method for packaging recombinant SFV particles carrying
heterologous antigens.
 |
ACKNOWLEDGMENTS |
We thank M. Kielian for providing the SFV spike specific MAbs and
W. Bodemer for providing the SFV replicase specific MAb. We also thank
Steven Brown and Tamarra Cadd for their critical reading of the manuscript.
This work was supported by the Swedish Medical Research Council, the
Swedish Council for Engineering Sciences, and the European Union
Biotechnology Program. C.S. was supported by an European Commission
Research Training Grant in the Biotechnology program.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Microbiology and
Tumor Biology Center, Karolinska Institute, Box 280, S-17177 Stockholm, Sweden. Phone: 46-8-457 2550. Fax: 46-8-310848. E-mail:
peter.liljestrom{at}mtc.ki.se.
 |
REFERENCES |
| 1.
|
Berglund, P.,
M. Sjöberg,
H. Garoff,
G. J. Atkins,
B. J. Sheahan, and P. Liljeström.
1993.
Semliki Forest virus expression system: production of conditionally infectious recombinant particles.
Bio/Technology
11:916-920[Medline].
|
| 2.
|
Berglund, P.,
C. Smerdou,
M. N. Fleeton,
I. Tubulekas, and P. Liljeström.
1998.
Enhancing immune responses using suicidal DNA vaccines.
Nat. Biotechnol.
16:562-565[Medline].
|
| 3.
|
Choi, H.-K.,
S. Lee,
Y.-P. Zhang,
B. R. McKinney,
G. Wengler,
M. G. Rossman, and R. J. Kuhn.
1996.
Structural analysis of Sindbis virus capsid mutants involving assembly and catalysis.
J. Mol. Biol.
262:151-167[Medline].
|
| 4.
|
Chong, H.,
W. Starkey, and R. G. Vile.
1998.
A replication-competent retrovirus arising from a split-function packaging cell line was generated by recombination events between the vector, one of the packaging constructs, and endogenous retroviral sequences.
J. Virol.
72:2663-2670[Abstract/Free Full Text].
|
| 5.
|
Chong, H., and R. G. Vile.
1996.
Replication-competent retrovirus produced by a `split-function' third generation amphotropic packaging cell line.
Gene Ther.
3:624-629[Medline].
|
| 6.
|
de Curtis, I., and K. Simons.
1988.
Dissection of Semliki Forest virus glycoprotein delivery from the trans-Golgi network to the cell surface in permeabilized BHK cells.
Proc. Natl. Acad. Sci. USA
85:8052-8056[Abstract/Free Full Text].
|
| 7.
|
DiCiommo, D. P., and R. Bremner.
1998.
Rapid, high level protein production using DNA-based Semliki Forest virus vectors.
J. Biol. Chem.
273:18060-18066[Abstract/Free Full Text].
|
| 8.
|
Donnelly, J. J.,
J. B. Ulmer, and M. A. Liu.
1997.
DNA vaccines.
Life Sci.
60:163-172[Medline].
|
| 9.
|
Dubensky, T. W., Jr.,
D. A. Driver,
J. M. Polo,
B. A. Belli,
E. M. Latham,
C. E. Ibanez,
S. Chada,
D. Brumm,
T. A. Banks,
S. J. Mento,
D. J. Jolly, and S. M. Chang.
1996.
Sindbis virus DNA-based expression vectors: utility for in vitro and in vivo gene transfer.
J. Virol.
70:508-519[Abstract].
|
| 10.
|
Frolov, I.,
E. Frolova, and S. Schlesinger.
1997.
Sindbis virus replicons and Sindbis virus: assembly of chimeras and of particles deficient in virus RNA.
J. Virol.
71:2819-2829[Abstract].
|
| 11.
|
Frolov, I.,
T. A. Hoffman,
B. M. Pragai,
S. A. Dryga,
H. V. Huang,
S. Schlesinger, and C. M. Rice.
1996.
Alphavirus-based expression vectors: strategies and applications.
Proc. Natl. Acad. Sci. USA
93:11371-11377[Abstract/Free Full Text].
|
| 12.
|
Frolov, I., and S. Schlesinger.
1994.
Translation of Sindbis virus mRNA: effects of sequences downstream of the initiating codon.
J. Virol.
68:8111-8117[Abstract/Free Full Text].
|
| 13.
|
Garoff, H.,
D. Huylebroeck,
A. Robinson,
U. Tillman, and P. Liljeström.
1990.
The signal sequence of the p62 protein of Semliki Forest virus is involved in initiation but not in completing chain translocation.
J. Cell Biol.
111:867-876[Abstract/Free Full Text].
|
| 14.
|
Garoff, H.,
P. Liljeström,
K. Metsikkö,
M. Lobigs, and J. Wahlberg.
1990.
Formation and function of the Semliki Forest virus membrane, p. 166-172.
In
M. A. Brinton, and F. X. Heinz (ed.), New aspects of positive-strand RNA viruses. American Society for Microbiology, Washington, D.C.
|
| 15.
|
Garoff, H.,
K. Simons, and O. Renkonen.
1974.
Isolation and characterization of the membrane proteins of Semliki Forest virus.
Virology
61:493-504[Medline].
|
| 16.
|
Garoff, H.,
J. Wilschut,
P. Liljeström,
J. M. Wahlberg,
R. Bron,
M. Suomalainen,
J. Smyth,
A. Salminen,
B. U. Barth,
H. Zhao, et al.
1994.
Assembly and entry mechanisms of Semliki Forest virus.
Arch. Virol.
9:329-338.
|
| 17.
|
Greiser-Wilke, I.,
V. Moenning,
O. R. Kaaden, and L. T. Figueiredo.
1989.
Most alphaviruses share a conserved epitopic region on their nucleocapsid protein.
J. Gen. Virol.
70:743-748[Abstract/Free Full Text].
|
| 18.
|
Hahn, C. S.,
E. G. Strauss, and J. H. Strauss.
1985.
Sequence analysis of three Sindbis virus mutants temperature-sensitive in the capsid protein autoprotease.
Proc. Natl. Acad. Sci. USA
82:4648-4652[Abstract/Free Full Text].
|
| 19.
|
Hahn, C. S., and J. H. Strauss.
1990.
Site-directed mutagenesis of the proposed catalytic amino acids of the Sindbis virus capsid protein autoprotease.
J. Virol.
64:3069-3073[Abstract/Free Full Text].
|
| 20.
|
Hodgson, C. P.
1995.
The vector void in gene therapy.
Bio/Technology
13:222-225[Medline].
|
| 21.
|
Kielian, M.,
S. Jungerwirth,
K. U. Sayad, and S. DeCandido.
1990.
Biosynthesis, maturation, and acid activation of the Semliki Forest virus fusion protein.
J. Virol.
64:4614-4624[Abstract/Free Full Text].
|
| 22.
|
Levis, R.,
B. G. Weiss,
M. Tsiang,
H. Huang, and S. Schlesinger.
1986.
Deletion mapping of Sindbis virus DI RNAs derived from cDNAs defines the sequences essential for replication and packaging.
Cell
44:137-145[Medline].
|
| 23.
|
Liljeström, P.
1994.
Alphavirus expression systems.
Curr. Opin. Biotechnol.
5:495-500[Medline].
|
| 24.
|
Liljeström, P., and H. Garoff.
1994.
Expression of proteins using Semliki Forest virus vectors, p. 16.20.11-16.20.16.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G. Seidman, and K. Struhl (ed.), Current protocols in molecular biology, vol. 2. Greene Publishing Associates and Wiley Interscience, New York, N.Y.
|
| 25.
|
Liljeström, P., and H. Garoff.
1991.
Internally located cleavable signal sequences direct the formation of Semliki Forest virus membrane proteins from a polyprotein precursor.
J. Virol.
65:147-154[Abstract/Free Full Text].
|
| 26.
|
Liljeström, P., and H. Garoff.
1991.
A new generation of animal cell expression vectors based on the Semliki Forest virus replicon.
Bio/Technology
9:1356-1361[Medline].
|
| 27.
|
Liljeström, P.,
S. Lusa,
D. Huylebroeck, and H. Garoff.
1991.
In vitro mutagenesis of a full-length cDNA clone of Semliki Forest virus: the 6,000-molecular-weight membrane protein modulates virus release.
J. Virol.
65:4107-4113[Abstract/Free Full Text].
|
| 28.
|
Lobigs, M., and H. Garoff.
1990.
Fusion function of the Semliki Forest virus spike is activated by proteolytic cleavage of the envelope glycoprotein p62.
J. Virol.
64:1233-1240[Abstract/Free Full Text].
|
| 29.
|
Martinez, I., and R. Dornburg.
1996.
Partial reconstitution of a replication-competent retrovirus in helper cells with partial overlaps between vector and helper cell genomes.
Hum. Gene Ther.
7:705-712[Medline].
|
| 30.
|
Mattion, N. M.,
E. C. Harnish,
J. C. Crowley, and P. A. Reilly.
1996.
Foot-and-mouth disease virus 2A protease mediates cleavage in attenuated Sabin 3 poliovirus vectors engineered for delivery of foreign antigens.
J. Virol.
70:8124-8127[Abstract].
|
| 31.
|
Melancon, P., and H. Garoff.
1986.
Reinitiation of translocation in the Semliki Forest virus structural polyprotein: identification of the signal for the E1 glycoprotein.
EMBO J.
5:1551-1560[Medline].
|
| 32.
|
Melancon, P., and H. Garoff.
1987.
Processing of the Semliki Forest virus structural polyprotein: role of the capsid protease.
J. Virol.
61:1301-1309[Abstract/Free Full Text].
|
| 33.
|
Moelling, K.
1997.
DNA for genetic vaccination and therapy.
Cytokines Cell. Mol. Ther.
3:127-135[Medline].
|
| 34.
|
Percy, N.,
W. S. Barclay,
A. Garcia-Sastre, and P. Palese.
1994.
Expression of a foreign protein by influenza A virus.
J. Virol.
68:4486-4492[Abstract/Free Full Text].
|
| 35.
|
Perkus, M. E.,
J. Tartaglia, and E. Paoletti.
1995.
Poxvirus-based vaccine candidates for cancer, AIDS, and other infectious diseases.
J. Leukoc. Biol.
58:1-13[Abstract].
|
| 36.
|
Pushko, P.,
M. Parker,
G. V. Ludwig,
N. L. Davis,
R. E. Johnston, and J. F. Smith.
1997.
Replicon-helper systems from attenuated Venezuelan equine encephalitis virus: expression of heterologous genes in vitro and immunization against heterologous pathogens in vivo.
Virology
239:389-401[Medline].
|
| 37.
|
Randrianarison-Jewtoukoff, V., and M. Perricaudet.
1995.
Recombinant adenoviruses as vaccines.
Biologicals
23:145-157[Medline].
|
| 38.
|
Robbins, P. D.,
H. Tahara, and S. C. Ghivizzani.
1998.
Viral vectors for gene therapy.
Trends Biotechnol.
16:35-40[Medline].
|
| 39.
|
Robinson, H. L.
1997.
Nucleic acid vaccines: an overview.
Vaccine
15:785-787[Medline].
|
| 40.
|
Ryan, M. D., and J. Drew.
1994.
Foot-and-mouth disease virus 2A oligopeptide mediated cleavage of an artificial polyprotein.
EMBO J.
13:928-933[Medline].
|
| 41.
|
Ryan, M. D.,
A. M. Q. King, and G. P. Thomas.
1991.
Cleavage of foot-and-mouth disease virus polyprotein is mediated by residues located within a 19 amino acid sequence.
J. Gen. Virol.
72:2727-2732[Abstract/Free Full Text].
|
| 42.
|
Salminen, A.,
J. M. Wahlberg,
M. Lobigs,
P. Liljeström, and H. Garoff.
1992.
Membrane fusion process of Semliki Forest virus. II. Cleavage-dependent reorganization of the spike protein complex controls virus entry.
J. Cell Biol.
116:349-357[Abstract/Free Full Text].
|
| 43.
|
Sjöberg, E. M.,
M. Suomalainen, and H. Garoff.
1994.
A significantly improved Semliki Forest virus expression system based on translation enhancer segments from the viral capsid gene.
Bio/Technology
12:1127-1131[Medline].
|
| 44.
|
Skoging, U., and P. Liljeström.
1998.
Role of the C-terminal tryptophan residue for the structure-function of alphavirus capsid protein.
J. Mol. Biol.
279:865-872[Medline].
|
| 45.
|
Strauss, J. H., and E. G. Strauss.
1994.
The alphaviruses: gene expression, replication, and evolution.
Microbiol. Rev.
58:491-562[Abstract/Free Full Text].
|
| 46.
|
Suomalainen, M.,
P. Liljeström, and H. Garoff.
1992.
Spike protein: nucleocapsid interactions drive the budding of alphaviruses.
J. Virol.
66:4737-4747[Abstract/Free Full Text].
|
| 47.
|
Tubulekas, I., and P. Liljeström.
1998.
Suppressors of cleavage-site mutations in the p62 envelope protein of Semliki Forest virus reveal dynamics in spike structure function.
J. Virol.
72:2825-2831[Abstract/Free Full Text].
|
| 48.
|
Vile, R. G.,
A. Tuszynski, and S. Castleden.
1996.
Retroviral vectors: from laboratory tools to molecular medicine.
Mol. Biotechnol.
5:139-158[Medline].
|
| 49.
|
Wahlberg, J. M., and H. Garoff.
1992.
Membrane fusion process of Semliki Forest virus. I. Low pH-induced rearrangement in spike protein quaternary structure precedes virus penetration into cells.
J. Cell Biol.
116:339-348[Abstract/Free Full Text].
|
| 50.
|
Weiss, B.,
H. Nitschko,
I. Ghattas,
R. Wright, and S. Schlesinger.
1989.
Evidence for specificity in the encapsidation of Sindbis virus RNAs.
J. Virol.
63:5310-5318[Abstract/Free Full Text].
|
| 51.
|
Xiong, C.,
R. Levis,
P. Shen,
S. Schlesinger,
C. M. Rice, and H. V. Huang.
1989.
Sindbis virus: an efficient, broad host range vector for gene expression in animal cells.
Science
243:1188-1191[Abstract/Free Full Text].
|
| 52.
|
Yeh, P., and M. Perricaudet.
1997.
Advances in adenoviral vectors: from genetic engineering to their biology.
FASEB J.
11:615-623[Abstract].
|
Journal of Virology, February 1999, p. 1092-1098, Vol. 73, No. 2
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tamm, K., Merits, A., Sarand, I.
(2008). Mutations in the nuclear localization signal of nsP2 influencing RNA synthesis, protein expression and cytotoxicity of Semliki Forest virus. J. Gen. Virol.
89: 676-686
[Abstract]
[Full Text]
-
Fragkoudis, R., Breakwell, L., McKimmie, C., Boyd, A., Barry, G., Kohl, A., Merits, A., Fazakerley, J. K.
(2007). The type I interferon system protects mice from Semliki Forest virus by preventing widespread virus dissemination in extraneural tissues, but does not mediate the restricted replication of avirulent virus in central nervous system neurons. J. Gen. Virol.
88: 3373-3384
[Abstract]
[Full Text]
-
Forsell, M. N. E., McInerney, G. M., Dosenovic, P., Hidmark, A. S., Eriksson, C., Liljestrom, P., Grundner, C., Karlsson Hedestam, G. B.
(2007). Increased human immunodeficiency virus type 1 Env expression and antibody induction using an enhanced alphavirus vector. J. Gen. Virol.
88: 2774-2779
[Abstract]
[Full Text]
-
Garcia, A. D., Meseda, C. A., Mayer, A. E., Kumar, A., Merchlinsky, M., Weir, J. P.
(2007). Characterization and Use of Mammalian-Expressed Vaccinia Virus Extracellular Membrane Proteins for Quantification of the Humoral Immune Response to Smallpox Vaccines. CVI
14: 1032-1044
[Abstract]
[Full Text]
-
Berglund, P., Finzi, D., Bennink, J. R., Yewdell, J. W.
(2007). Viral Alteration of Cellular Translational Machinery Increases Defective Ribosomal Products. J. Virol.
81: 7220-7229
[Abstract]
[Full Text]
-
Naslund, T. I., Uyttenhove, C., Nordstrom, E. K. L., Colau, D., Warnier, G., Jondal, M., Van den Eynde, B. J., Liljestrom, P.
(2007). Comparative Prime-Boost Vaccinations Using Semliki Forest Virus, Adenovirus, and ALVAC Vectors Demonstrate Differences in the Generation of a Protective Central Memory CTL Response against the P815 Tumor. J. Immunol.
178: 6761-6769
[Abstract]
[Full Text]
-
Douagi, I., McInerney, G. M., Hidmark, A. S., Miriallis, V., Johansen, K., Svensson, L., Karlsson Hedestam, G. B.
(2007). Role of Interferon Regulatory Factor 3 in Type I Interferon Responses in Rotavirus-Infected Dendritic Cells and Fibroblasts. J. Virol.
81: 2758-2768
[Abstract]
[Full Text]
-
Hidmark, A. S., Nordstrom, E. K. L., Dosenovic, P., Forsell, M. N. E., Liljestrom, P., Karlsson Hedestam, G. B.
(2006). Humoral Responses against Coimmunized Protein Antigen but Not against Alphavirus-Encoded Antigens Require Alpha/Beta Interferon Signaling. J. Virol.
80: 7100-7110
[Abstract]
[Full Text]
-
Guan, M., Rodriguez-Madoz, J. R., Alzuguren, P., Gomar, C., Kramer, M. G., Kochanek, S., Prieto, J., Smerdou, C., Qian, C.
(2006). Increased Efficacy and Safety in the Treatment of Experimental Liver Cancer with a Novel Adenovirus-Alphavirus Hybrid Vector. Cancer Res.
66: 1620-1629
[Abstract]
[Full Text]
-
Diatta, A., Piver, E., Collin, C., Vaudin, P., Pages, J.-C.
(2005). Semliki Forest virus-derived virus-like particles: characterization of their production and transduction pathways. J. Gen. Virol.
86: 3129-3136
[Abstract]
[Full Text]
-
Forsell, M. N. E., Li, Y., Sundback, M., Svehla, K., Liljestrom, P., Mascola, J. R., Wyatt, R., Hedestam, G. B. K.
(2005). Biochemical and Immunogenic Characterization of Soluble Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Trimers Expressed by Semliki Forest Virus. J. Virol.
79: 10902-10914
[Abstract]
[Full Text]
-
Hidmark, A. S., McInerney, G. M., Nordstrom, E. K. L., Douagi, I., Werner, K. M., Liljestrom, P., Hedestam, G. B. K.
(2005). Early Alpha/Beta Interferon Production by Myeloid Dendritic Cells in Response to UV-Inactivated Virus Requires Viral Entry and Interferon Regulatory Factor 3 but Not MyD88. J. Virol.
79: 10376-10385
[Abstract]
[Full Text]
-
McInerney, G. M., Kedersha, N. L., Kaufman, R. J., Anderson, P., Liljestrom, P.
(2005). Importance of eIF2{alpha} Phosphorylation and Stress Granule Assembly in Alphavirus Translation Regulation. Mol. Biol. Cell
16: 3753-3763
[Abstract]
[Full Text]
-
Garcia, S., Billecocq, A., Crance, J.-M., Munderloh, U., Garin, D., Bouloy, M.
(2005). Nairovirus RNA Sequences Expressed by a Semliki Forest Virus Replicon Induce RNA Interference in Tick Cells. J. Virol.
79: 8942-8947
[Abstract]
[Full Text]
-
Onate, A. A., Donoso, G., Moraga-Cid, G., Folch, H., Cespedes, S., Andrews, E.
(2005). An RNA Vaccine Based on Recombinant Semliki Forest Virus Particles Expressing the Cu,Zn Superoxide Dismutase Protein of Brucella abortus Induces Protective Immunity in BALB/c Mice. Infect. Immun.
73: 3294-3300
[Abstract]
[Full Text]
-
Chen, M., Barnfield, C., Naslund, T. I., Fleeton, M. N., Liljestrom, P.
(2005). MyD88 Expression Is Required for Efficient Cross-Presentation of Viral Antigens from Infected Cells. J. Virol.
79: 2964-2972
[Abstract]
[Full Text]
-
Rheme, C., Ehrengruber, M. U., Grandgirard, D.
(2005). Alphaviral cytotoxicity and its implication in vector development. Exp Physiol
90: 45-52
[Abstract]
[Full Text]
-
Gehrke, R., Ecker, M., Aberle, S. W., Allison, S. L., Heinz, F. X., Mandl, C. W.
(2003). Incorporation of Tick-Borne Encephalitis Virus Replicons into Virus-Like Particles by a Packaging Cell Line. J. Virol.
77: 8924-8933
[Abstract]
[Full Text]
-
Thomas, J. M., Klimstra, W. B., Ryman, K. D., Heidner, H. W.
(2003). Sindbis Virus Vectors Designed To Express a Foreign Protein as a Cleavable Component of the Viral Structural Polyprotein. J. Virol.
77: 5598-5606
[Abstract]
[Full Text]
-
Hanke, T., Barnfield, C., Wee, E. G.-T., Agren, L., Samuel, R. V., Larke, N., Liljestrom, P.
(2003). Construction and immunogenicity in a prime-boost regimen of a Semliki Forest virus-vectored experimental HIV clade A vaccine. J. Gen. Virol.
84: 361-368
[Abstract]
[Full Text]
-
Palmowski, M. J., Choi, E. M.-L., Hermans, I. F., Gilbert, S. C., Chen, J.-L., Gileadi, U., Salio, M., Van Pel, A., Man, S., Bonin, E., Liljestrom, P., Dunbar, P. R., Cerundolo, V.
(2002). Competition Between CTL Narrows the Immune Response Induced by Prime-Boost Vaccination Protocols. J. Immunol.
168: 4391-4398
[Abstract]
[Full Text]
-
Brinster, C., Chen, M., Boucreux, D., Paranhos-Baccala, G., Liljestrom, P., Lemmonier, F., Inchauspe, G.
(2002). Hepatitis C virus non-structural protein 3-specific cellular immune responses following single or combined immunization with DNA or recombinant Semliki Forest virus particles. J. Gen. Virol.
83: 369-381
[Abstract]
[Full Text]
-
Donnelly, M. L. L., Hughes, L. E., Luke, G., Mendoza, H., ten Dam, E., Gani, D., Ryan, M. D.
(2001). The 'cleavage' activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring '2A-like' sequences. J. Gen. Virol.
82: 1027-1041
[Abstract]
[Full Text]
-
Pugachev, K. V., Tzeng, W.-P., Frey, T. K.
(2000). Development of a Rubella Virus Vaccine Expression Vector: Use of a Picornavirus Internal Ribosome Entry Site Increases Stability of Expression. J. Virol.
74: 10811-10815
[Abstract]
[Full Text]
-
Heise, M. T., Simpson, D. A., Johnston, R. E.
(2000). Sindbis-Group Alphavirus Replication in Periosteum and Endosteum of Long Bones in Adult Mice. J. Virol.
74: 9294-9299
[Abstract]
[Full Text]
-
Fleeton, M. N., Liljeström, P., Sheahan, B. J., Atkins, G. J.
(2000). Recombinant Semliki Forest virus particles expressing louping ill virus antigens induce a better protective response than plasmid-based DNA vaccines or an inactivated whole particle vaccine. J. Gen. Virol.
81: 749-758
[Abstract]
[Full Text]
-
Atkins, G. J., Sheahan, B. J., Liljeström, P.
(1999). The molecular pathogenesis of Semliki Forest virus: a model virus made useful?. J. Gen. Virol.
80: 2287-2297
[Full Text]