JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Accola, M. A.
Right arrow Articles by Göttlinger, H. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Accola, M. A.
Right arrow Articles by Göttlinger, H. G.

 Previous Article  |  Next Article 

Journal of Virology, December 1999, p. 9992-9999, Vol. 73, No. 12
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

A Conserved Dileucine-Containing Motif in p6gag Governs the Particle Association of Vpx and Vpr of Simian Immunodeficiency Viruses SIVmac and SIVagm

Molly A. Accola,1 Anatoly A. Bukovsky,1 Morris S. Jones,1 and Heinrich G. Göttlinger1,2,*

Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute,1 and Department of Pathology, Harvard Medical School,2 Boston, Massachusetts 02115

Received 15 March 1999/Accepted 29 August 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Vpr is a small accessory protein of human and simian immunodeficiency viruses (HIV and SIV) that is specifically incorporated into virions. Members of the HIV-2/SIVsm/SIVmac lineage of primate lentiviruses also incorporate a related protein designated Vpx. We previously identified a highly conserved L-X-X-L-F sequence near the C terminus of the p6 domain of the Gag precursor as the major virion association motif for HIV-1 Vpr. In the present study, we show that a different leucine-containing motif (D-X-A-X-X-L-L) in the N-terminal half of p6gag is required for the incorporation of SIVmac Vpx. Similarly, the uptake of SIVmac Vpr depended primarily on the D-X-A-X-X-L-L motif. SIVmac Vpr was unstable when expressed alone, but its intracellular steady-state levels increased significantly in the presence of wild-type Gag or of the proteasome inhibitor lactacystin. Collectively, our results indicate that the interaction with the Gag precursor via the D-X-A-X-X-L-L motif diverts SIVmac Vpr away from the proteasome-degradative pathway. While absent from HIV-1 p6gag, the D-X-A-X-X-L-L motif is conserved in both the HIV-2/SIVsm/SIVmac and SIVagm lineages of primate lentiviruses. We found that the incorporation of SIVagm Vpr, like that of SIVmac Vpx, is absolutely dependent on the D-X-A-X-X-L-L motif, while the L-X-X-L-F motif used by HIV-1 Vpr is dispensable. The similar requirements for the incorporation of SIVmac Vpx and SIVagm Vpr provide support for their proposed common ancestry.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Human immunodeficiency virus type 1 (HIV-1) Vpr is a 14-kDa accessory protein that has homologs in all primate lentiviruses. In addition to Vpr, one subgroup of primate lentiviruses, formed by HIV-2 and simian immunodeficiency virus (SIV) strains isolated from sooty mangabeys (SIVsm) and macaques (SIVmac), encodes a related protein designated Vpx. Vpr and Vpx are the only regulatory proteins of primate lentiviruses that are specifically incorporated into virions in significant quantities, suggesting a role during early steps of virus transmission (7, 8, 17, 26, 61, 62).

HIV-1 and other lentiviruses can productively infect nondividing cells, and it has been shown that Vpr is one of the karyophilic components of the viral preintegration complex that mediate its transport across the nuclear membrane for integration into the host genome (25). Consistent with a role in nuclear import, a requirement for Vpr or Vpx for efficient virus replication is particularly evident in nondividing cells such as macrophages (2, 6, 10, 15, 23, 25, 58). HIV-1 Vpr expression in proliferating cells causes an accumulation in the G2 phase of the cell cycle (3, 24, 32, 48, 49, 51) and can also induce cell differentiation (39). It has been shown that incoming virion-associated Vpr is capable of inducing cell cycle arrest even in the absence of de novo expression (47). Although Vpx does not share this function, the ability to inhibit cell proliferation appears conserved among lentiviral Vpr proteins (12, 15, 46, 54).

A possible explanation for the conservation of the G2 arrest function among Vpr proteins is provided by the observation that virus production is optimal in the G2 stage of the cell cycle (21). It has long been known that HIV-1 Vpr can moderately transactivate the viral long terminal repeat and other promoters (9), and recent mutagenic analyses have provided a strong correlation between Vpr-mediated transactivation and cell cycle arrest (13, 16). Up-regulation of viral gene expression may involve binding of Vpr to the cellular transcription factors SP1 and TFIIB (1, 57), as well as modulation of the transcriptional coactivator p300 through regulation of cyclin B1/cdc2 activity (13). It has also been reported that Vpr interacts with the DNA repair enzyme uracil DNA glycosylase through a WXXF motif (4, 5) and that Vpr acts as a coactivator for nuclear receptors (34, 50), but the relevance of these observations for virus replication remains to be defined.

It is likely that the mechanism by which Vpr and Vpx enter the assembling virion also dictates their association with the viral preintegration complex. Several studies have shown that the packaging of Vpr and Vpx into viral particles depends on the C-terminal p6 domain of the Gag polyprotein (36, 41, 45, 59), the precursor of the internal structural proteins of the mature virion. While the Gag precursors of all primate lentiviruses possess a p6 domain, relatively little sequence homology can be discerned, except for a short proline-rich motif near the N terminus and an absolutely conserved motif (L-X-X-L-F) near the very C terminus of p6gag (36). Mutagenic analyses show that only a C-terminal region of p6gag which includes a (LXX)4 repeat is required for HIV-1 Vpr incorporation (40) and that the invariant L-X-X-L-F motif at the C terminus of the repeat is absolutely essential (35). Moreover, the transfer of a 7-amino-acid sequence which included the L-X-X-L-F motif to a heterologous Gag precursor was sufficient to confer the ability to incorporate HIV-1 Vpr (35).

Whether the L-X-X-L-F motif plays a similar role in the incorporation of Vpr proteins from other lentiviruses remains unknown. Interestingly, the L-X-X-L-F motif is dispensable for the packaging of Vpx (43, 59). The region required for HIV-2 Vpx incorporation has been mapped to residues 15 to 40 of HIV-2 p6gag, upstream of the leucine triplet repeat region which mediates HIV-1 Vpr incorporation (43). Very recently, it was reported that the p6gag domain, but not its C-terminal leucine triplet repeat region, is required for the ability of both SIVsm Vpx and SIVsm Vpr to interact with the autologous Gag precursor in the yeast two-hybrid system (52). Although virion incorporation was not analyzed in this study, the results indicate that the requirements for the packaging of divergent lentivirus Vpr proteins may differ substantially.

We now show that the uptake of SIVmac Vpx and SIVmac Vpr into virus-like particles (VLP) is governed by a dileucine-containing motif in the N-terminal half of p6gag. Interestingly, the novel particle association motif, which is absent from HIV-1, is also found in the p6gag domains of diverse substrains of SIVagm. Our results show that the dileucine-containing motif is absolutely essential for the incorporation of SIVagm Vpr into VLP while the L-X-X-L-F motif used by HIV-1 Vpr is dispensable. The similar requirements for the incorporation of SIVagm Vpr and SIVmac Vpx revealed by the present study support the proposal, based on phylogenetic analysis, that an ancestral member of the SIVagm lineage was the source of the HIV-2/SIVsm/SIVmac vpx gene (53, 56).


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Plasmids. HXBH10/SIVgag (55), which was used to express the SIVmac Gag polyprotein, harbors a fragment containing the gag gene of SIVmac239 (nucleotides [nt] 1080 to 3034) between nt 637 and 5228 of the vpr-deficient HIV-1 proviral construct HXBH10. A construct expressing the uncleaved SIVagm Gag polyprotein was obtained by inserting a fragment (nt 727 to 2503) of the SIVagm 155-4 clone (31) between nt 637 and 5228 of HXBH10. Mutations in the p6 coding regions of the SIVmac239 and SIVagm 155-4 gag genes were created by site-directed mutagenesis as previously described (38). The sequences of the oligonucleotides used to mutate the coding sequence for SIVmac p6gag were as follows: Delta 1-10, GAAGCCCCGCAATTTCCCAACTGCTCCCCCAG; Delta 11-15, GCATCAGGGGCTGATGGAGGACCCAGCTGTGG; Delta 16-20, GCCAACTGCTCCCCCAGATCTGCTAAAGAAC; Delta 16-28, CCAACTGCTCCCCCATTGGGCAAGCAGCAG; Delta 18-63, CCCCCAGAGGACTAGTCTGTGGATCTGC; Delta 29-63, CTACATGCAGTAGGGCAAGCAGC; Delta 41-63, GCAGAGAGAAAGCTAGCAGAAGCCTTACA; Delta 52-63, GTGACAGAGGACTAGTTGCACCTCAAT; E16A, CAACTGCTCCCCCCGCGGACCCAGCTGTG; D17A, GCTCCCCCAGAGGCGCCAGCTGTGGATC; P18A, CCCCCAGAGGACGCGGCTGTGGATCTG; A19S, CCAGAGGACCCTAGCGTGGATCTGCTAAAG; V20A, GAGGACCCAGCTGCAGATCTGCTAAAG; D21A, GACCCAGCTGTGGCGCTGCTAAAGAAC; L22A, CCAGCTGTGGATGCGCTAAAGAACTAC; L23A, GCTGTGGATCTGGCCAAGAACTACATG; K24A, GTGGATCTGCTCGCGAACTACATGCAG; N25A, GATCTGCTAAAGGCCTACATGCAGTTG; Y26A, CTGCTAAAGAACGCGATGCAGTTGGGC; M27A, CTAAAGAACTACGCGCAGTTGGGCAAG; and Q28A, AAGAACTACATGGCGCTGGGCAAGCAG. The oligonucleotides used to mutate the coding sequence for SIVagm p6gag had the following sequences: D22A, CTACACCTTACGCGCCAGCAAAGAAGC; L28A, GCAAAGAAGCTCGCGCAGCAGTATGC; L61A, TCTTTGAACTCCGCGTTTGGAGAAGACC; and Delta 56-66, GATTGGAACGAGGGCTAGCCTTTGAACTCC.

To obtain a construct for the efficient expression of SIVmac Vpx in trans, a XbaI-NcoI fragment from SIVmac239 (nt 4729 to 6198), containing vpx but not vpr, was inserted into HXBH10 in place of gag-pol (between nt 810 and 5680). Similarly, a PCR-generated fragment (nt 6151 to 6462 of SIVmac239) which harbors only the SIVmac vpr gene was inserted between nt 810 and 2009 of HXBH10. An analogous construct encoding a hemagglutinin (HA) epitope-tagged version of SIVmac Vpr was generated by inserting 27 nt (TAC CCA TAC GAC GTC CCA GAT TAC GCT) between the initiation codon and codon 2 of the SIVmac239 vpr gene. To provide SIVagm Vpr in trans, a PCR-generated fragment harboring the SIVagm vpr gene (nt 5721 to 6118 of SIVagm 155-4) was inserted between nt 810 and 5785 of HXBH10.

Cell culture and transfections. HeLa cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Cells (106) were seeded into 80-cm2 tissue culture flasks 24 h prior to transfection. The cultures were cotransfected with 15 and 7.5 µg of plasmids expressing Gag and Vpr/Vpx, respectively, by a calcium phosphate precipitation technique (11).

Viral protein analysis. Cells were metabolically labeled with [35S]methionine or [35S]cysteine (50 mCi/ml) 12 h, starting at 48 h posttransfection, unless indicated otherwise. Labeled cells were lysed in radioimmunoprecipitation assay (RIPA) buffer (140 mM NaCl, 8 mM Na2HPO4, 2 mM NaH2PO4, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.05% sodium dodecyl sulfate [SDS]) and immunoprecipitated with various antisera. The culture supernatants of labeled cells were clarified by passage through 0.45-µm-pore-size filters followed by low-speed centrifugation, and VLP were then pelleted through 20% sucrose cushions (in phosphate-buffered saline) for 90 min at 4°C and 27,000 rpm in a Beckman SW28 rotor. Pelleted VLP were lysed in RIPA buffer, and viral proteins were either directly analyzed by electrophoresis through SDS-12.5% polyacrylamide gels or immunoprecipitated prior to electrophoresis.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

A region in the N-terminal half of p6gag is required for SIVmac Vpx incorporation. It has been previously reported that a region from the C terminus of the HIV-2 Gag polyprotein which includes most of the p6gag domain is sufficient for the incorporation of Vpx into heterologous VLP (59). To more precisely map the determinants which govern the incorporation of Vpx, we generated premature termination codons and in-frame deletions within the p6 coding region of the SIVmac gag gene (Fig. 1). Constructs capable of expressing the wild-type and mutant SIVmac Gag polyproteins, but not Vpx or Vpr, were transfected into HeLa cells together with a plasmid that provided SIVmac Vpx in trans. Following metabolic labeling, VLP produced by the transfected cultures were partially purified through sucrose, and aliquots were analyzed directly by SDS-polyacrylamide gel electrophoresis (PAGE) and by immunoprecipitation with a Vpx-specific serum (Fig. 2). SIVmac Vpx was also immunoprecipitated from the cell lysates to verify that intracellular steady-state levels were comparable (data not shown).


View larger version (28K):
[in this window]
[in a new window]
 
FIG. 1.   Locations of deletions in the p6 domain of the SIVmac239 Gag polyprotein. The positions of the P-(T/S)-A-P-P and L-X-X-L-F motifs, which are conserved among primate lentiviruses, are indicated. Also shown is the position of the D-X-A-X-X-L-L motif, which is conserved among members of the HIV-2/SIVsm/SIVmac and SIVagm lineages. Numbers refer to the positions of residues, counting from the N terminus of the p6gag domain. Mutants unable to incorporate SIVmac Vpx are indicated by shaded boxes.


View larger version (39K):
[in this window]
[in a new window]
 
FIG. 2.   Effects of deletions in p6gag on the incorporation of SIVmac Vpx into VLP. HeLa cells were cotransfected with constructs expressing wild-type (WT) or mutant SIVmac Gag polyproteins and a plasmid that provided SIVmac Vpx in trans, as indicated above each lane. The transfected cells were metabolically labeled with [35S]methionine, and VLP released during the labeling period were pelleted through 20% sucrose. Aliquots of the pelleted material were either analyzed directly by SDS-PAGE to compare the amounts of Gag protein in the samples (A) or immunoprecipitated (IP) with rabbit anti-Vpx serum prior to SDS-PAGE (B).

As expected, SIVmac Vpx was absent from the particulate fraction, unless the SIVmac Gag polyprotein was coexpressed (Fig. 2, lanes 2 and 3). Next, we analyzed the effects of deletions at the C terminus of p6gag. The Delta 52-63 mutation removes a highly conserved L-X-X-L-F motif, which is essential for the incorporation of HIV-1 Vpr (35). The Delta 52-63 mutation had no effect on the particle association of SIVmac Vpx (lane 8), confirming that, as in the case of HIV-2 (43, 59), the L-X-X-L-F motif is dispensable for Vpx incorporation. Similarly, the removal of 23 amino acids from the C terminus of p6gag did not reduce the incorporation of SIVmac Vpx (lane 9). Even a mutant SIVmac Gag polyprotein which lacked 35 C-terminal amino acids and retained less than half of p6gag produced particles capable of incorporating SIVmac Vpx, albeit with somewhat reduced efficiency (lane 10). In contrast, the removal of the 46 C-terminal amino acids of p6gag prevented the incorporation of SIVmac Vpx (lane 4).

To examine whether the N terminus of p6gag plays a role in SIVmac Vpx incorporation, we generated Gag mutants with in-frame deletions in p6gag. The Delta 1-10 mutation, which removed residues between the N terminus of p6gag and a highly conserved P-(T/S)-A-P-P motif, left particle production and SIVmac Vpx incorporation largely unaffected (Fig. 2, lane 5). The Delta 11-15 mutation precisely removed the P-(T/S)-A-P-P motif, which is found at the equivalent position in most lentiviruses. In HIV-1, mutations in the P-(T/S)-A-P-P motif affected a late step in the viral budding process (22); however, particle production could be restored by a second-site mutation that inactivated the viral protease (29). Consistent with the latter finding, a mutant SIVmac Gag precursor that lacked the P-(T/S)-A-P-P motif retained the ability to form VLP, although at a reduced level (Fig. 2, lane 11). Scanning densitometry indicated that Delta 11-15 mutant particles contained about half as much SIVmac Vpx as did particles formed by the wild-type SIVmac Gag precursor, demonstrating that the P-(T/S)-A-P-P motif is not required for SIVmac Vpx incorporation.

Essential role of a conserved dileucine-containing motif. Taken together, our deletion analysis indicated that essential determinants for the incorporation of SIVmac Vpx are located within residues 16 to 28 of p6gag. To verify the importance of this region, we precisely deleted SIVmac p6gag codons 16 to 28. As shown in Fig. 2A, the in-frame deletion did not affect VLP production (lane 6), but the VLP entirely lacked SIVmac Vpx (Fig. 2B). Similarly, the deletion of p6gag residues 16 to 20 abolished SIVmac Vpx incorporation (Fig. 3, lane 8), demonstrating that residues distal to the conserved P-(T/S)-A-P-P motif are absolutely essential.


View larger version (54K):
[in this window]
[in a new window]
 
FIG. 3.   Role of a dileucine-containing p6gag region in SIVmac Vpx incorporation. HeLa cells were cotransfected with a plasmid providing SIVmac Vpx and constructs which express either the wild-type (WT) SIVmac Gag polyprotein or mutant versions that harbor the indicated changes in p6gag. (A and B) [35S]methionine-labeled VLP material released into the culture medium was sedimented through 20% sucrose and either analyzed directly by SDS-PAGE (A) or immunoprecipitated (IP) with rabbit anti-Vpx serum (B). (C) In parallel, SIVmac Vpx was immunoprecipitated from the cell lysates.

To identify crucial amino acid side chains, residues 16 to 28 of SIVmac p6gag were individually replaced. The codon for Ala19 was changed to a codon specifying Ser; all other codons were individually changed to codons specifying Ala. The scanning mutagenesis revealed that a conserved dileucine-containing motif in p6gag plays an essential role in the incorporation of SIVmac Vpx. As shown in Fig. 3A and B, the L22A change substantially reduced and the L23A change abolished the particle association of SIVmac Vpx (lanes 10 and 11). SIVmac Vpx was also absent from the particulate fraction when Asp17 of p6gag was replaced by Ala and was barely detectable when Ala19 was replaced by Ser (lanes 3 and 5). Single-amino-acid changes at other positions of p6gag either had no effect on the amount of particle-associated SIVmac Vpx or caused only a relatively moderate reduction (for example, the P18A change) (Fig. 3A and B). Immunoprecipitation of SIVmac Vpx from the lysates of the transfected cells showed that expression levels were comparable in each case (Fig. 3C). We conclude that the incorporation of SIVmac Vpx depends on a D-X-A-X-X-L-L motif in p6gag. Interestingly, both the primary sequence of this motif and its location immediately distal to the P-(T/S)-A-P-P motif are conserved not only in the HIV-2/SIVsm/SIVmac group but also among different sublineages of SIVagm (42). In contrast, the motif is not present in HIV-1 p6gag, consistent with the inability of HIV-1 particles to incorporate HIV-2 or SIVmac Vpx (28, 45).

The particle association and intracellular stability of SIVmac Vpr depend on the D-X-A-X-X-L-L motif in p6gag. The incorporation of HIV-1 Vpr into viral particles depends on a conserved L-X-X-L-F motif near the C terminus of p6gag (35). Because all lentiviruses which contain a vpr gene have the L-X-X-L-F motif, we expected that SIVmac Vpr would also use this motif. However, coexpression of SIVmac Vpr with the Delta 41-63 mutant SIVmac Gag precursor revealed that the C-terminal 23 amino acids of p6gag, which include the L-X-X-L-F sequence, are dispensable for the particle association of SIVmac Vpr (data not shown). The uptake of SIVmac Vpr was reduced less than 3-fold in the absence of p6gag residues 29 through 40 but was lowered more than 10-fold if p6gag residues 16 through 20 were deleted (data not shown). Collectively, these results suggested that the incorporation of SIVmac Vpr is governed by the same general region of p6gag as that of SIVmac Vpx.

To examine whether the D-X-A-X-X-L-L motif used by SIVmac Vpx plays a role in the particle association of SIVmac Vpr, we coexpressed HA-tagged SIVmac Vpr together with a panel of mutant SIVmac Gag polyproteins with single-amino-acid substitutions at residues 16 through 28 of p6gag. This scanning analysis indicated that Asp17, Ala19, and especially Leu23 of the D-X-A-X-X-L-L motif are crucial for the incorporation of SIVmac Vpr into VLP whereas other residues in or adjacent to the motif are less important (Fig. 4A). Very similar results were obtained when wild-type rather than HA-tagged SIVmac Vpr was coexpressed with the SIVmac Gag mutants (data not shown).


View larger version (52K):
[in this window]
[in a new window]
 
FIG. 4.   Effects of substitutions in a dileucine-containing region of p6gag on the levels of VLP- and cell-associated SIVmac Vpr. HeLa cells were transfected with constructs expressing SIVmac Gag polyproteins with the indicated single-amino-acid substitutions in p6gag, together with a plasmid which provided HA-tagged SIVmac Vpr in trans. (A) [35S]methionine-labeled VLP released into the culture medium were sedimented through 20% sucrose and analyzed directly by SDS-PAGE. (B) The transfected cells were lysed, and tagged SIVmac Vpr was immunoprecipitated (IP) with anti-HA monoclonal antibody 16B12 (Babco, Richmond, Calif.).

To control for expression levels, HA-tagged SIVmac Vpr was immunoprecipitated from the lysates of the transfected cells. Unexpectedly, the levels of cell-associated SIVmac Vpr reproducibly depended on which of the p6gag mutants was expressed in trans (Fig. 4B and data not shown). Moreover, a close correlation between the effects of mutations in p6gag on the appearance of SIVmac Vpr in VLP and their effects on the intracellular steady-state levels of Vpr became apparent (Fig. 4A and B). Specifically, reduced amounts in the particulate fractions were paralleled by reductions in the intracellular levels of SIVmac Vpr.

The intracellular steady-state levels of SIVmac Vpr were lowered at least 10-fold by the L23A mutation in p6gag (Fig. 4B and 5A), and were similarly low when Vpr was expressed in the absence of Gag (Fig. 5A). SIVmac Vpr expressed in the absence of Gag accumulated in cells pretreated with lactacystin (Fig. 5B), which causes irreversible, highly specific inhibition of proteasomal degradation (14). To confirm that the effect of the L23A mutation on the steady-state levels of SIVmac Vpr was due to a reduced stability of Vpr, transfected HeLa cells were metabolically labeled for 30 min and chased for various times. As shown in Fig. 5C, the levels of cell-associated SIVmac Vpr dropped far more rapidly when it was coexpressed with L23A rather than with wild-type SIVmac Gag polyprotein, despite negligible export of SIVmac Vpr by L23A mutant Gag (Fig. 4). Although lactacystin led to similar Vpr steady-state levels in the presence of wild-type or mutant Gag, L23A mutant particles remained unable to incorporate significant quantities of SIVmac Vpr (Fig. 5D). Collectively, these results indicate that a D-X-A-X-X-L-L motif-dependent interaction with p6gag protects SIVmac Vpr from degradation by the proteasome and that this interaction is also required for the efficient incorporation of SIVmac Vpr into viral particles.


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 5.   Gag enhances the stability of cell-associated SIVmac Vpr. (A) HA-tagged SIVmac Vpr was expressed in the absence of Gag or coexpressed with wild-type (WT) or mutant SIVmac Gag polyproteins, as indicated above each lane. The cells were metabolically labeled for 12 h, starting at 48 h posttransfection, and lysed, and tagged SIVmac Vpr was immunoprecipitated to compare the intracellular steady-state levels. (B) HeLa cells expressing HA-tagged SIVmac Vpr in the absence of Gag were kept for 1 h without or with lactacystin (10 µM; Calbiochem, La Jolla, Calif.) and then subjected to 6 h of metabolic labeling and immunoprecipitation with anti-HA antibody. (C) Cells expressing HA-tagged SIVmac Vpr together with wild-type or L23A mutant SIVmac Gag polyprotein were pulse-labeled for 30 min and chased for the times indicated. Cell lysates were immunoprecipitated with anti-HA antibody. (D) HeLa cells expressing HA-tagged SIVmac Vpr together with wild-type or L23A mutant SIVmac Gag were kept for 1 h in the presence of 10 µM lactacystin and then subjected to 6 h of metabolic labeling. VLP released into the culture medium were sedimented through 20% sucrose and analyzed directly by SDS-PAGE. Cell-associated SIVmac Vpr was immunoprecipitated (IP) with anti-HA antibody.

The D-X-A-X-X-L-L motif is essential for the particle association of SIVagm Vpr. While the D-X-A-X-X-L-L motif is not present in HIV-1, it is conserved among the p6gag domains of different sublineages of the SIVagm group (42), despite the fact that these viruses are highly divergent from SIVmac as well as from each other (30, 31). SIVagm isolates have only one homolog of HIV-1 Vpr, which is most similar to SIVmac Vpx (53) but is usually termed Vpr. Because of the conservation of the D-X-A-X-X-L-L motif among viruses of the HIV-2/SIVsm/SIVmac and SIVagm lineages, we tested whether SIVagm Vpr can be incorporated into particles formed by the SIVmac Gag precursor. To this end, the SIVmac Gag polyprotein was coexpressed with SIVmac Vpx or SIVagm Vpr. As shown in Fig. 6A, VLP produced by the transfected cells contained comparable amounts of either SIVmac Vpx or SIVagm Vpr, demonstrating that the SIVmac Gag precursor harbors determinants that are sufficient for the efficient incorporation of SIVagm Vpr.


View larger version (66K):
[in this window]
[in a new window]
 
FIG. 6.   SIVagm Vpr incorporation into heterologous SIVmac particles and requirement for a dileucine-containing region in p6gag. HeLa cells were cotransfected with constructs expressing the wild-type (WT) SIVmac Gag polyprotein and either SIVmac Vpx or SIVagm Vpr (A) or with constructs expressing SIVmac Gag polyproteins with the indicated single-amino-acid substitutions in p6gag and a plasmid providing SIVagm Vpr (B). The transfected cells were labeled with [35S]cysteine, VLP were sedimented through sucrose, and their protein content was analyzed by SDS-PAGE.

A deletion which removed the highly conserved L-X-X-L-F motif from the C terminus of the SIVmac p6gag domain did not affect the incorporation of SIVagm Vpr; in contrast, SIVagm Vpr was not incorporated into SIVmac particles which lacked the D-X-A-X-X-L-L motif (data not shown). Coexpression with a panel of SIVmac Gag mutants with single-amino-acid substitutions revealed that p6gag residues Asp17 and Leu23, which occupy positions n and n + 6 of the D-X-A-X-X-L-L motif, are essential for the incorporation of SIVagm Vpr (Fig. 6B, lanes 2 and 8). The incorporation of SIVagm Vpr was also markedly impaired when SIVmac p6gag residue Ala19, Val20, or Leu22 was mutated (lanes 4, 5, and 7) but appeared enhanced upon replacement of Asp21 with Ala (lane 6).

SIVagm Vpr was also coexpressed with wild-type or mutant versions of the SIVagm Gag precursor to examine whether its uptake into autologous particles depends on the D-X-A-X-X-L-L motif in SIVagm p6gag. As expected, VLP produced by the wild-type SIVagm Gag polyprotein incorporated readily detectable amounts of SIVagm Vpr (Fig. 7A and C, lanes 1). However, single-amino-acid substitutions at positions n and n + 6 of the D-X-A-X-X-L-L motif totally abolished the incorporation of SIVagm Vpr (lanes 2 and 3). In contrast, a single-amino-acid substitution at position n + 3 of the conserved L-X-X-L-F motif near the C terminus of SIVagm p6gag had little effect on the incorporation of SIVagm Vpr (lanes 4). We previously reported that the equivalent change in HIV-1 p6gag abolished the incorporation of HIV-1 Vpr (35). A C-terminal truncation which removed the entire L-X-X-L-F motif from SIVagm p6gag confirmed that this conserved sequence is not required for the incorporation of SIVagm Vpr (Fig. 7A and C, lanes 5). Immunoprecipitation from the cell lysates showed that the steady-state levels of SIVagm Vpr, unlike those of SIVmac Vpr, are unaffected by changes in the D-X-A-X-X-L-L motif (Fig. 7B), indicating that SIVagm Vpr is not stabilized by the interaction with p6gag.


View larger version (42K):
[in this window]
[in a new window]
 
FIG. 7.   A conserved dileucine-containing region in p6gag governs the association of SIVagm Vpr with autologous VLP. HeLa cells were cotransfected with plasmids expressing SIVagm Vpr and either the wild-type (WT) SIVagm Gag polyprotein or mutant Gag precursors with the indicated changes in p6gag. (A) The protein content of [35S]cysteine-labeled, sucrose-purified VLP was directly analyzed by SDS-PAGE. (B and C) In parallel, cell lysates (B) and lysed VLP (C) were immunoprecipitated (IP) with rabbit anti-SIVagm Vpr serum (6). The Delta 56-66 mutant lacks the C-terminal 11 amino acids of SIVagm p6gag, which harbor the conserved L-X-X-L-F motif.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Previous studies have shown that the encapsidation of HIV-1 Vpr is mediated by a C-terminal region of p6gag (35, 36, 40). This region contains one of two sequence motifs which are highly conserved among the otherwise relatively variable p6gag domains of primate lentiviruses (35). A proline-rich motif near the N terminus of p6gag facilitates the release of assembled particles (22) but is dispensable for the incorporation of HIV-1 Vpr (35, 40). In contrast, the second conserved motif (L-X-X-L-F), near the C terminus of p6gag, plays no role in particle release but is absolutely required for HIV-1 Vpr incorporation (35, 36, 40). Moreover, the C-terminal motif by itself constitutes a transferable particle-association motif for HIV-1 Vpr (35).

Although the L-X-X-L-F motif is dispensable for the incorporation of HIV-2 Vpx (43, 59), its conservation among all lentiviruses that encode a Vpr protein appeared consistent with a universal role in Vpr packaging. However, the present study shows that neither Vpx nor Vpr of SIVmac depends on the L-X-X-L-F motif for uptake into VLP. Instead, both proteins use a novel dileucine-containing motif (D-X-A-X-X-L-L) in the N-terminal half of p6gag. The D-X-A-X-X-L-L motif is highly conserved in the HIV-2/SIVsm/SIVmac group and is located at the very N terminus of a region of p6gag that was previously identified as being necessary for Vpx incorporation into HIV-2 particles (43). In good agreement with our results, it was recently reported that SIVsm Vpx and Vpr both interact with the SIVsm p6gag domain in a yeast two-hybrid assay, even if a C-terminal region of p6gag which includes the L-X-X-L-F motif is deleted (52).

Consistent with the inability of HIV-1 particles to incorporate Vpx (28, 45), HIV-1 p6gag lacks the region occupied by the D-X-A-X-X-L-L motif. However, the motif is conserved in the p6gag domains of different substrains of the SIVagm lineage, which in general exhibit an unusually high degree of genetic diversity (30). SIVagm encodes only one accessory protein related to HIV-1 Vpr (18, 30) and thus is more similar to HIV-1 than to SIVmac in this respect. Nevertheless, we found that SIVagm resembles SIVmac in its use of the D-X-A-X-X-L-L motif for Vpr incorporation. Although the L-X-X-L-F motif used by HIV-1 Vpr is present at the equivalent position of SIVagm p6gag, our results indicate that it plays no role in the incorporation of SIVagm Vpr, suggesting that this remarkably conserved motif may mediate another important interaction. Perhaps HIV-1 Vpr has evolved to make use of this conserved interaction site, obviating the need for a separate particle-association motif in p6gag.

Recent phylogenetic analyses have provided evidence that the vpx gene of the HIV-2/SIVsm/SIVmac group was acquired from an ancestral member of the SIVagm group (53, 56). Our results support a close relationship between SIVmac Vpx and SIVagm Vpr by showing that the requirements for the uptake of these proteins into VLP are quite similar. SIVmac Vpx and SIVagm Vpr are both absolutely dependent on the D-X-A-X-X-L-L motif in p6gag; moreover, the first and last residues of the motif are essential for the incorporation of both proteins. In contrast, the incorporation of SIVmac Vpr, although substantially reduced, was not completely prevented through disruption of the D-X-A-X-X-L-L motif. Furthermore, we observed that fusion of the HIV-1 p6gag domain, which lacks a D-X-A-X-X-L-L motif, to the C terminus of the Moloney murine leukemia virus Gag polyprotein allowed the incorporation of small amounts of SIVmac Vpr, but only if the L-X-X-L-F motif was present (data not shown). Taken together, our results indicate that the incorporation of SIVmac Vpr is mediated primarily by the D-X-A-X-X-L-L motif but can also occur, albeit inefficiently, through the L-X-X-L-F motif.

Unexpectedly, mutations in p6gag which lowered the amounts of particle-associated SIVmac Vpr reduced the intracellular steady-state levels of SIVmac Vpr to a comparable extent. In a pulse-chase experiment, SIVmac Vpr was relatively stable in the presence of the wild-type SIVmac Gag precursor, but its intracellular levels declined rapidly when coexpressed with a Gag precursor that harbored a single-amino-acid substitution in the D-X-A-X-X-L-L motif. Moreover, when expressed without Gag, SIVmac Vpr appeared similarly unstable but accumulated in the presence of the specific proteasome inhibitor lactacystin. Collectively, our results suggest that the interaction with Gag, which requires the D-X-A-X-X-L-L motif in p6gag, sequesters SIVmac Vpr from the proteasome, where free SIVmac Vpr is rapidly degraded. This strategy could help to minimize the detrimental effects of Vpr on the host cell (60) while ensuring that adequate amounts are packaged into progeny virions. In contrast to SIVmac Vpr, neither SIVmac Vpx nor SIVagm Vpr appears to be regulated in this manner, because the presence or absence of Gag had no effect on their cellular steady-state levels.

In agreement with our results, it was previously noted that HIV-2 Vpr has a much shorter half-life than did HIV-2 Vpx or HIV-1 Vpr (33). Importantly, the stability of these proteins was examined in the absence of Gag expression. It was proposed that the relative instability of HIV-2 Vpr evolved to limit its effect on the cell cycle and that its rapid turnover may also be responsible for the low levels of HIV-2 Vpr in the virion compared to Vpx (33). Consistent with this view, expression of HIV-2 Vpr in trans considerably increased the amount of Vpr incorporated into virions produced by an intact HIV-2 provirus (33). Similarly, we found that SIVmac virions produced by an intact provirus contain only small amounts of Vpr, which can be substantially increased if additional SIVmac Vpr is provided in trans (data not shown). However, in light of the stabilizing effect of Gag observed in the present study, it appears that the low levels of Vpr in wild-type SIVmac virions cannot be explained solely on the basis of rapid Vpr turnover. It is perhaps noteworthy in this respect that the SIVmac Vpr initiation codon is in an unfavorable sequence context (37).

SIVmac Vpx and SIVagm Vpr have both been reported to be crucial for efficient virus replication in primary lymphocytes and macrophages (6, 20, 44, 63). In addition, SIVmac Vpx, although not absolutely essential for progression to AIDS (19), is required for efficient virus dissemination in a monkey model (27). The identification of p6gag residues that are absolutely required for the incorporation of SIVmac Vpx and SIVagm Vpr may help to elucidate whether these proteins must be present in the incoming virion to exert their function in virus replication and dissemination.


    ACKNOWLEDGMENTS

We thank Vanessa Hirsch for providing the SIVagm 155-4 clone and antiserum against SIVagm Vpr and Joseph Sodroski for providing antiserum against Vpx.

M.A.A. was supported by National Cancer Institute training grant T32 CA09141. M.S.J. was supported by National Science Foundation grant BIR9322334. This work was supported by National Institutes of Health grants AI29873 and AI28691 (Center for AIDS Research) and by a gift from the G. Harold and Leila Y. Mathers Charitable Foundation.


    FOOTNOTES

* Corresponding author. Mailing address: Dana-Farber Cancer Institute, 44 Binney St., Boston, MA 02115. Phone: (617) 632-3067. Fax: (617) 632-3113. E-mail: Heinrich_Gottlinger{at}DFCI.harvard.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Agostini, I., J.-M. Navarro, F. Rey, M. Bouhamdan, B. Spire, R. Vigne, and J. Sire. 1996. The human immunodeficiency virus type 1 Vpr transactivator: cooperation with promoter-bound activator domains and binding to TFIIB. J. Mol. Biol. 261:599-606[Medline].
2. Balliet, J. W., D. L. Kolson, G. Eiger, F. M. Kim, K. A. McGann, A. Srinivasan, and R. Collman. 1994. Distinct effects in primary macrophages and lymphocytes of the human immunodeficiency virus type 1 accessory genes vpr, vpu, and nef: mutational analysis of a primary HIV-1 isolate. Virology 200:623-631[Medline].
3. Bartz, S. R., M. E. Rogel, and M. Emerman. 1996. Human immunodeficiency virus type 1 cell cycle control: Vpr is cytostatic and mediates G2 accumulation by a mechanism which differs from DNA damage checkpoint control. J. Virol. 70:2324-2331[Abstract].
4. Bouhamadan, M., S. Benichou, F. Rey, J.-M. Navarro, I. Agostini, B. Spire, J. Camonis, G. Slupphaug, R. Vigne, R. Benarous, and J. Sire. 1996. Human immunodeficiency virus type 1 Vpr protein binds to the uracil DNA glycosylase DNA repair enzyme. J. Virol. 70:697-704[Abstract].
5. Bouhamadan, M., Y. N. Xue, Y. Baudat, B. Hu, J. Sire, R. J. Pomerantz, and L.-X. Duan. 1998. Diversity of HIV-1 Vpr interactions involves usage of the WXXF motif of host cell proteins. J. Biol. Chem. 273:8009-8016[Abstract/Free Full Text].
6. Campbell, B. J., and V. M. Hirsch. 1997. Vpr of simian immunodeficiency virus of African green monkeys is required for replication in macaque macrophages and lymphocytes. J. Virol. 71:5593-5602[Abstract].
7. Cohen, E. A., R. A. Subbramanian, and H. G. Göttlinger. 1996. Role of auxiliary proteins in retroviral morphogenesis. Curr. Top. Microbiol. Immunol. 214:219-235[Medline].
8. Cohen, E. A., G. Dehni, J. G. Sodroski, and W. A. Haseltine. 1990. Human immunodeficiency virus vpr product is a virion-associated regulatory protein. J. Virol. 64:3097-3099[Abstract/Free Full Text].
9. Cohen, E. A., E. F. Terwilliger, Y. Jalinoos, J. Proulx, J. G. Sodroski, and W. A. Haseltine. 1990. Identification of HIV-1 vpr product and function. J. Acquired Immune Defic. Syndr. 3:11-18.
10. Connor, R. I., B. K. Chen, S. Choe, and N. R. Landau. 1995. Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology 206:935-944[Medline].
11. Cullen, B. R. 1987. Use of eukaryotic expression technology in the functional analysis of cloned genes. Methods Enzymol. 152:684-704[Medline].
12. Di Marzio, P., S. Choe, M. Ebright, R. Knoblauch, and N. R. Landau. 1995. Mutational analysis of cell cycle arrest, nuclear localization, and virion packaging of human immunodeficiency virus type 1 Vpr. J. Virol. 69:7909-7916[Abstract].
13. Felzien, L. K., C. Woffendin, M. O. Hottiger, R. A. Subbramanian, E. A. Cohen, and G. J. Nabel. 1998. HIV transcriptional activation by the accessory protein, Vpr, is mediated by the p300 co-activator. Proc. Natl. Acad. Sci. USA 95:5281-5286[Abstract/Free Full Text].
14. Fenteany, G., and S. L. Schreiber. 1998. Lactacystin, proteasome function, and cell fate. J. Biol. Chem. 273:8545-8548[Free Full Text].
15. Fletcher, T. M., B. Brichacek, N. Sharova, M. A. Newman, G. Stivahtis, P. M. Sharp, M. Emerman, B. H. Hahn, and M. Stevenson. 1996. Nuclear import and cell cycle arrest functions of the HIV-1 Vpr protein are encoded by two separate genes in HIV-2/SIVSM. EMBO J. 15:6155-6165[Medline].
16. Forget, J., X.-J. Yao, J. Mercier, and E. A. Cohen. 1998. Human immunodeficiency virus type 1 Vpr protein transactivation function: mechanism and identification of domains involved. J. Mol. Biol. 284:915-923[Medline].
17. Franchini, G., J. R. Rusche, T. J. O'Keeffe, and F. Wong-Staal. 1988. The human immunodeficiency virus type 2 (HIV-2) contains a novel gene encoding a 16 kD protein associated with mature virions. AIDS Res. Hum. Retroviruses 4:243-250[Medline].
18. Fukasawa, M., T. Miura, A. Hasegawa, S. Morikawa, H. Tsujimoto, K. Miki, T. Kitamura, and M. Hayami. 1988. Sequence of simian immunodeficiency virus from African green monkey, a new member of the HIV/SIV group. Nature 333:457-461[Medline].
19. Gibbs, J. S., A. A. Lackner, S. M. Lang, M. A. Simon, P. K. Sehgal, M. D. Daniel, and R. C. Desrosiers. 1995. Progression to AIDS in the absence of a gene for vpr or vpx. J. Virol. 69:2378-2383[Abstract].
20. Gibbs, J. S., D. A. Regier, and R. C. Desrosiers. 1994. Construction and in vitro properties of SIVmac mutants with deletions in "nonessential" genes. AIDS Res. Hum. Retroviruses 10:333-342[Medline].
21. Goh, W. C., M. E. Rogel, C. M. Kinsey, S. F. Michael, P. N. Fultz, M. A. Nowak, B. H. Hahn, and M. Emerman. 1998. HIV-1 Vpr increases viral expression by manipulation of the cell cycle: a mechanism for selection of Vpr in vivo. Nature Med. 4:65-71[Medline].
22. Göttlinger, H. G., T. Dorfman, J. G. Sodroski, and W. A. Haseltine. 1991. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proc. Natl. Acad. Sci. USA 88:3195-3199[Abstract/Free Full Text].
23. Hattori, N., F. Michaels, K. Fargnoli, L. Marcon, R. C. Gallo, and G. Franchini. 1990. The human immunodeficiency virus type 2 vpr gene is essential for productive infection of human macrophages. Proc. Natl. Acad. Sci. USA 87:8080-8084[Abstract/Free Full Text].
24. He, J., S. Choe, R. Walker, P. Di Marzio, D. O. Morgan, and N. R. Landau. 1995. Human immunodeficiency virus type 1 viral protein R (Vpr) arrests cells in the G2 phase of the cell cycle by inhibiting p34cdc2 activity. J. Virol. 69:6705-6711[Abstract].
25. Heinzinger, N. K., M. I. Bukrinsky, S. A. Haggerty, A. M. Ragland, V. Kewalramani, M.-A. Lee, H. E. Gendelman, L. Ratner, M. Stevenson, and M. Emerman. 1994. The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in nondividing host cells. Proc. Natl. Acad. Sci. USA 91:7311-7315[Abstract/Free Full Text].
26. Henderson, L. E., R. C. Sowder, T. D. Copeland, R. E. Benveniste, and S. Oroszlan. 1988. Isolation and characterization of a novel protein (X-ORF product) from SIV and HIV-2. Science 241:199-201[Abstract/Free Full Text].
27. Hirsch, V. M., M. E. Sharkey, C. R. Brown, B. Brichacek, S. Goldstein, J. Wakefield, R. Byrum, W. R. Elkins, B. H. Hahn, J. D. Lifson, and M. Stevenson. 1998. Vpx is required for dissemination and pathogenesis of SIVsm PBj: evidence for macrophage-dependent viral amplification. Nat. Med. 4:1401-1408[Medline].
28. Horton, R., P. Spearman, and L. Ratner. 1994. HIV-2 viral protein X association with the Gag p27 capsid protein. Virology 199:453-457[Medline].
29. Huang, M., J. M. Orenstein, M. A. Martin, and E. O. Freed. 1995. p6Gag is required for particle production from full-length human immunodeficiency virus type 1 molecular clones expressing protease. J. Virol. 69:6810-6818[Abstract].
30. Johnson, P. R., A. Fomsgaard, J. Allan, M. Gravell, W. T. London, R. A. Olmsted, and V. M. Hirsch. 1990. Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity. J. Virol. 64:1086-1092[Abstract/Free Full Text].
31. Johnson, P. R., M. Gravell, J. Allan, S. Goldstein, R. A. Olmsted, G. Dapolito, C. McGann, W. T. London, R. H. Purcell, and V. M. Hirsch. 1989. Genetic diversity among simian immunodeficiency virus isolates from African green monkeys. J. Med. Primatol. 18:271-277[Medline].
32. Jowett, J. B. M., V. Planelles, B. Poon, N. P. Shah, M.-L. Chen, and I. S. Y. Chen. 1995. The human immunodeficiency virus type 1 vpr gene arrests infected T cells in the G2 + M phase of the cell cycle. J. Virol. 69:6304-6313[Abstract].
33. Kewalramani, V. N., C. S. Park, P. A. Gallombardo, and M. Emerman. 1996. Protein stability influences human immunodeficiency virus type 2 Vpr virion incorporation and cell cycle effect. Virology 218:326-334[Medline].
34. Kino, T., A. Gragerov, J. B. Kopp, R. H. Stauber, G. N. Pavlakis, and G. P. Chrousos. 1999. The HIV-1 virion-associated protein Vpr is a coactivator of the human glucocorticoid receptor. J. Exp. Med. 189:51-61[Abstract/Free Full Text].
35. Kondo, E., and H. G. Göttlinger. 1996. A conserved LXXLF sequence is the major determinant in p6gag required for the incorporation of human immunodeficiency virus type 1 Vpr. J. Virol. 70:159-164[Abstract].
36. Kondo, E., F. Mammano, E. A. Cohen, and H. G. Göttlinger. 1995. The p6gag domain of human immunodeficiency virus type 1 is sufficient for the incorporation of Vpr into heterologous viral particles. J. Virol. 69:2759-2764[Abstract].
37. Kozak, M. 1984. Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo. Nature 308:241-246[Medline].
38. Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154:367-382[Medline].
39. Levy, D. N., L. S. Fernades, W. V. Williams, and D. B. Weiner. 1993. Induction of cell differentiation by human immunodeficiency virus 1 vpr. Cell 72:541-550[Medline].
40. Lu, Y.-L., R. P. Bennett, J. W. Wills, R. Gorelick, and L. Ratner. 1995. A leucine triplet repeat sequence (LXX)4 in p6gag is important for Vpr incorporation into human immunodeficiency virus type 1 particles. J. Virol. 69:6873-6879[Abstract].
41. Lu, Y.-L., P. Spearman, and L. Ratner. 1993. Human immunodeficiency virus type 1 viral protein R localization in infected cells and virions. J. Virol. 67:6542-6550[Abstract/Free Full Text].
42. Myers, G., B. Korber, S. Wain-Hobson, R. F. Smith, and G. N. Pavlakis. 1993. Human retroviruses and AIDS 1993. A compilation and analysis of nucleic acid and amino acid sequences. Los Alamos National Laboratory, Los Alamos, N.M
43. Pancio, H. A., and L. Ratner. 1998. Human immunodeficiency virus type 2 Vpx-Gag interaction. J. Virol. 72:5271-5275[Abstract/Free Full Text].
44. Park, I.-W., and J. Sodroski. 1995. Functional analysis of the vpx, vpr, and nef genes of simian immunodeficiency virus. J. Acquired Immune Defic. Syndr. 8:335-344.
45. Paxton, W., R. I. Connor, and N. R. Landau. 1993. Incorporation of Vpr into human immunodeficiency virus type 1 virions: requirement for the p6 region of gag and mutational analysis. J. Virol. 67:7229-7237[Abstract/Free Full Text].
46. Planelles, V., J. B. M. Jowett, Q.-X. Li, Y. Xie, B. Hahn, and I. S. Y. Chen. 1996. Vpr-induced cell cycle arrest is conserved among primate lentiviruses. J. Virol. 70:2516-2524[Abstract].
47. Poon, B., K. Grovit-Ferbas, S. A. Stewart, and I. S. Y. Chen. 1998. Cell cycle arrest by Vpr in HIV-1 virions and insensitivity to antiretroviral agents. Science 281:266-269[Abstract/Free Full Text].
48. Poon, B., J. B. M. Jowett, S. A. Stewart, R. W. Armstrong, G. M. Rishton, and I. S. Y. Chen. 1997. Human immunodeficiency virus type 1 vpr gene induces phenotypic effects similar to those of the DNA alkylating agent, nitrogen mustard. J. Virol. 71:3961-3971[Abstract].
49. Re, F., D. Braaten, E. K. Franke, and J. Luban. 1995. Human immunodeficiency virus type 1 Vpr arrests the cell cycle in G2 by inhibiting the activation of p34cdc2-cyclin B. J. Virol. 69:6859-6864[Abstract].
50. Refaeli, Y., D. N. Levy, and D. B. Weiner. 1995. The glucocorticoid receptor type II complex is a target of the HIV-1 vpr gene product. Proc. Natl. Acad. Sci. USA 92:3621-3625[Abstract/Free Full Text].
51. Rogel, M. E., L. I. Wu, and M. Emerman. 1995. The human immunodeficiency virus type 1 vpr gene prevents cell proliferation during chronic infection. J. Virol. 69:882-888[Abstract].
52. Selig, L., J.-C. Pages, V. Tanchou, S. Preveral, C. Berlioz-Torrent, L. X. Liu, L. Erdtmann, J.-L. Darlix, R. Benarous, and S. Benichou. 1999. Interaction with the p6 domain of the Gag precursor mediates incorporation into virions of Vpr and Vpx proteins from primate lentiviruses. J. Virol. 73:592-600[Abstract/Free Full Text].
53. Sharp, P. M., E. Balles, M. Stevenson, M. Emerman, and B. H. Hahn. 1996. Gene acquisition in HIV and SIV. Nature 383:586-587[Medline].
54. Stivahtis, G. L., M. A. Soares, M. A. Vodicka, B. H. Hahn, and M. Emerman. 1997. Conservation and host specificity of Vpr-mediated cell cycle arrest suggest a fundamental role in primate lentivirus evolution and biology. J. Virol. 71:4331-4338[Abstract].
55. Thali, M., A. Bukovsky, E. Kondo, B. Rosenwirth, C. T. Walsh, J. Sodroski, and H. G. Göttlinger. 1994. Functional association of cyclophilin A with HIV-1 virions. Nature 372:363-365[Medline].
56. Tristem, M., A. Purvis, and D. L. J. Quicke. 1998. Complex evolutionary history of primate lentiviral vpr genes. Virology 240:232-237[Medline].
57. Wang, L., S. Mukherjee, F. Jia, O. Naraan, and L.-J. Zhao. 1995. Interaction of virion protein Vpr of human immunodeficiency virus type 1 with cellular transcription factor Sp1 and trans-activation of viral long terminal repeat. J. Biol. Chem. 270:25564-25569[Abstract/Free Full Text].
58. Westervelt, P., T. Henkel, D. B. Trowbridge, J. Orenstein, J. Heuser, H. E. Gendelman, and L. Ratner. 1992. Dual regulation of silent and productive infection in monocytes by distinct human immunodeficiency virus type 1 determinants. J. Virol. 66:3925-3931[Abstract/Free Full Text].
59. Wu, X., J. A. Conway, J. Kim, and J. C. Kappes. 1994. Localization of the Vpx packaging signal within the C terminus of the human immunodeficiency virus type 2 Gag precursor protein. J. Virol. 68:6161-6169[Abstract/Free Full Text].
60. Yao, X.-J., A. J. Mouland, R. A. Subbramanian, J. Forget, N. Rougeau, D. Bergeron, and E. A. Cohen. 1998. Vpr stimulates viral expression and induces cell killing in human immunodeficiency virus type 1-infected dividing Jurkat T cells. J. Virol. 72:4686-4693[Abstract/Free Full Text].
61. Yu, X. F., S. Ito, M. Essex, and T. H. Lee. 1988. A naturally immunogenic virion-associated protein specific for HIV-2 and SIV. Nature 335:262-265[Medline].
62. Yu, X.-F., M. Matsuda, M. Essex, and T.-H. Lee. 1990. Open reading frame vpr of simian immunodeficiency virus encodes a virion-associated protein. J. Virol. 64:5688-5693[Abstract/Free Full Text].
63. Yu, X.-F., Q.-C. Yu, M. Essex, and T.-H. Lee. 1991. The vpx gene of simian immunodeficiency virus facilitates efficient viral replication in fresh lymphocytes and macrophages. J. Virol. 65:5088-5091[Abstract/Free Full Text].


Journal of Virology, December 1999, p. 9992-9999, Vol. 73, No. 12
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Accola, M. A.
Right arrow Articles by Göttlinger, H. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Accola, M. A.