Previous Article | Next Article ![]()
Journal of Virology, December 1999, p. 10551-10555, Vol. 73, No. 12
Institut für Klinische und Molekulare
Virologie der Universität Erlangen
Received 1 June 1999/Accepted 13 September 1999
The herpesvirus saimiri strain C488 genome contains five genes for
small nuclear RNAs, termed herpesvirus saimiri URNAs (or HSURs). Using
a cosmid-based approach, all HSURs were precisely deleted from the
genome. The mutant virus replicated at levels that were similar to
those of wild-type viruses in OMK cells. Although the HSURs are
expressed in wild-type virus-transformed human T-cell lines, the
deletion does not affect viral transformation in cell culture.
The rhadinovirus prototype,
herpesvirus saimiri strain A11 (2), contains seven genes for
virus-encoded small nuclear RNAs that have been termed herpesvirus
saimiri URNAs (or HSURs 1 to 7) (1, 16, 20, 25). The HSURs
assemble into ribonucleoprotein particles (17) and can
interact with cellular factors involved in mRNA destabilization
(11, 12, 22). These 32- or 70-kDa proteins physiologically
bind to AU-rich elements in the 3' untranslated regions of cellular
mRNAs, which leads to the rapid degradation of the respective mRNAs.
HSURs may also be involved in the regulation of cytokine transcription
in T cells, as cytokine mRNA levels for interleukin-4 but not
interleukin-2 were reduced in tumor cells (6). It was
conceived that the abundant HSURs bind and compete for the cellular
destabilization factors, thus increasing the half-life of cellular
mRNAs expressing growth factors or proto-oncogenes. This led to the
hypothesis that the viral URNAs might have a relevant function in the
transformation of T cells. The herpesvirus saimiri strain subgroup C
viruses, especially strain C488, are distinguished by the ability to
transform human T cells to permanent antigen-independent growth
(3). In the left terminal region of the coding low G+C content DNA (L-DNA), strain C488 contains five of the HSUR genes. According to their homology to strain A11 HSURs, they represent HSURs
1, 2, 5, 4, and 7 (Fig. 1a).
As in subgroup A strains, a gene with
strong homology to the family of dihydrofolate reductases (DHFR) is
located in the same region of the viral genome (24). The
herpesvirus saimiri transformation-associated protein StpC and a
tyrosine kinase interacting protein (Tip) (4) located at the
very left end of the L-DNA have been found to be essential for
transformation (7).
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The URNA Genes of Herpesvirus Saimiri (Strain C488)
Are Dispensable for Transformation of Human T Cells In Vitro
Nürnberg, 91054 Erlangen, Germany
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References




View larger version (177K):
[in a new window]
FIG. 1.
(a) Construction of the mutant virus C488
HSUR from
overlapping cosmids. The HSUR genes were precisely deleted from a
subcloned fragment by PCR mutagenesis with the indicated
oligonucleotide primers. The fragment was reinserted to generate cosmid
331
HSUR. StpC, herpesvirus saimiri subgroup C transforming protein;
Tip, tyrosine kinase interacting protein; HSURs are numbered H1, H2,
H4, H5, and H7, according to the most homologous HSURs of herpesvirus
saimiri A11; vFGARAT, herpesvirus saimiri open reading frame 3 with
homology to formylglycineamide-ribonucleotidyl-aminotransferase; D1 and
D2, oligonucleotides for the PCR-based deletion of HSURs; H1, H2, H5,
H4, and H7, oligonucleotides used for primer extension analysis
(results shown in panel c); T1, T2, H4, and D3, oligonucleotides used
for PCR (the results shown in panel b); 331, 331
HSUR, 261, 290, 336, and 40, overlapping subgenomic cosmid clones used to generate
recombinant virus. (b) Recombinant virus was generated by transfection
of NotI-linearized cosmids into permissive OMK cells. PCR TR
with oligonucleotides T1 and T2 was specific for the StpC-Tip
transformation-associated genomic region; the PCR TR product size was
685 bp; PCR
with oligonucleotides H4 and D3 was specific for the
deleted HSUR-DHFR region; PCR
product size, 335 bp. Lanes: 1 and 2, C488- and C488
HSUR-transformed T-cell lines from one donor,
respectively; 3 and 4, as in lanes 1 and 2, from a second donor.
H2O and TR H2O show negative control reactions
without template for PCR
and PCR TR, respectively. (c) Primer
extension analysis with 10 µg of total RNA from C488 (W)- and
C488
HSUR (
)-transformed human CBL (as in panel b, lanes 1 and 2).
A 1.2-kb kanamycin mRNA control (K) and suitable control primer (C)
supplied with the kit show the expected product of 82 bp. (d) Flow
cytometry analysis of transformed human T cells after 4 months of
continuous culture. The following antibodies (Becton Dickinson) were
used on 300,000 transformed cells/assay:
CD3 (Leu-4),
TCR-
-1,
CD4 (Leu-3a),
CD8 (Leu-2a), and
HLA-DR. A
typical pair of C488-and C488
HSUR-transformed T-cell lines
from the same donor are shown.
Previous deletion analysis of herpesvirus saimiri strains could not reveal the presumed transformation-associated function of the HSURs. There are published reports describing deletions in strain A11 where all HSURs are deleted, but the gene encoding the herpesvirus saimiri transforming protein of strain A11 (StpA) was deleted as well. For a herpesvirus saimiri subgroup C isolate that is less efficient in the sustained transformation of human T cells, strain C484-77, it was reported that HSURs 1 and 2 are not essential in short-term replication assays with human T cells (19). In these experiments, a C484 mutant (2RNA) with a deletion of HSURs 1 and 2 was still able to exert effects on the growth of human T cells similar to those of wild-type C484. HSURs 1 and 4 had been detected in those transient transformation assays with herpesvirus saimiri strain C484, but the homologs of HSURs 2 and 3 were absent or at very low abundance (19). However, these detected transcripts could also be ascribed to lytic viral replication that may occur in the early infection of human T cells. The authors (19) further showed that a large part of the left end of the viral genome, including all HSURs and DHFR, was dispensable for the viral replication of this strain. The putative function of the HSURs in transformation could not be addressed with this deletion virus (5RNA), as it had no transforming phenotype due to the absence of the StpC and Tip genes that are essential for T-cell transformation (7, 19). Thus, it could not be decided if the HSURs contribute to T-cell transformation by herpesvirus saimiri.
In this study, all HSURs and the interspersed DHFR were precisely
deleted from the strain C488 genome by a cosmid-based approach. First,
a 6.6-kb fragment from a partial BamHI-NdeI
digestion from the left terminal cosmid, 331, was subcloned into
pSL1180 (Pharmacia, Freiburg, Germany), and then the HSUR genes were
deleted by PCR with the indicated oligonucleotide primers (D1,
TACGTAGTAAACACGCAAATGCACAAG, and D2,
GCTGACTTCTTTATAAGTTATGGTG). After confirmatory sequencing, the fragment was reinserted into cosmid 331 via the BamHI
and NdeI sites to generate cosmid 331
HSUR (Fig. 1a). In
the cosmid vector pWE15, the cloned viral DNA fragments are flanked by
adjacent NotI restriction sites. Herpesvirus saimiri strain
C488 does not contain NotI restriction sites. Recombinant
virus C488
HSUR was generated by the transfection of
NotI-linearized cosmids into permissive OMK cells (ATCC
CRL1556) and characterized by PCR. Each 50-µl reaction mixture
contained 2 µl of template DNA, 0.2 µM deoxynucleoside
triphosphate, 10 µM of each primer, and 2.5 U of AmpliTaq-Gold in 1×
AmpliTaq buffer (PE Biosystems, Weiterstadt, Germany); the polymerase
was activated at 96°C for 10 min, followed by 40 cycles of 96°C for
10 s, 58°C for 20 s, and 70°C for 45 s, followed by
a final extension step of 70°C for 1 min. For template preparation,
virus was pelleted from 1 ml of a tissue culture supernatant of
lytically infected OMK cells and lysed in 100 µl of PCR buffer
containing 100 µg of proteinase K per ml for 1 h at 56°C
followed by 15 min at 96°C; alternatively, 0.5 million transformed
human T cells were lysed in 200 µl of the same buffer. Primer pairs
were specific for the StpC-Tip transformation-associated genomic region
(for PCR TR: the primers were T1, GTAGTAAACTAAGAGCAAAGCAAGC, and T2, GTACAAGCTGTTCAAGTTTGTTAGC; product size, 685 bp) and the deleted HSUR-DHFR region (for PCR
, the primers were H4,
TGGTTTGGGCTACCCCAGAG, and D3, GCAATGTCTTACAATTCTACCAGC;
product size, 335 bp) (Fig. 1b). The replication kinetics of
recombinant virus C488
HSUR were compared to those of wild-type
strain C488. Confluent OMK cells were infected in a 25-cm2
flask (105 cells) with 104 PFU of virus at day
0. Until lysis was complete, infectious particles in the supernatant
were titrated on subsequent days by limiting dilution on OMK cells in
48-well plates. Both the wild-type strain C488 and the mutant virus
C488
HSUR replicated with similar kinetics to an endpoint titer of
106 infectious particles per ml in OMK cells.
Transformation assays in vitro showed that the mutant virus C488
HSUR
transformed human umbilical cord blood lymphocytes (CBL) to permanently
growing T cell-lines as efficiently as did the wild-type strain C488. For the transformation assays, 3 × 106 to 5 × 106 cells were infected with 1 ml of virus-containing
supernatant from completely lysed OMK cells (equivalent to
106 infectious particles). Eight of eight attempts, each
with cells from different donors, were successful with both C488 and
C488
HSUR. None of the uninfected controls yielded a transformed
T-cell line.
The expression of viral genes in herpesvirus saimiri-transformed human
cells is highly restricted. The bicistronic mRNA carrying the StpC and
Tip genes which are essential for viral transformation and the mRNA
needed for a putative viral superantigen have been detected in strain
C488-transformed human T cells (10, 15). In contrast,
transcription of various viral genes is detectable from transformed
marmoset or rabbit cell lines, where limited viral replication occurs.
Primer extension analysis was performed on total RNA from C488- and
C488
HSUR-transformed human CBL with the Primer Extension System with
avian mycloblastosis virus reverse transcriptase (Promega) and the
oligonucleotide primers H1 (GGTTACTTTATATTTACACCC), H2
(TATATACACCCAGTGCTTTC), H5 (TAGCTGTTATTGAGCAACAC),
H4 (TGGTTTGGGCTACCCCAGAG), and H7
(CCTAAATTTGCCTAAGTACC). Briefly, 10 pM primers and 0.25 µg
of a size marker were labeled with T4 polynucleotide kinase and
[
-32P]ATP. Primer extension was performed with 100 fM
labeled primer and 20 µg of template RNA. Extension products were
separated on a denaturing 8% polyacrylamide gel containing 6 M urea.
Gels were dried on filter paper, exposed to phosphorimaging screens,
and scanned with a BAS2000 reader (Fuji). A 1.2-kb kanamycin mRNA control and a suitable primer supplied with the kit showed the expected
product of 82 bp. The primer extension analysis showed that significant
levels of HSURs 1, 2, 4, and 7 are detectable from human T cells
permanently transformed with strain C488 (Fig. 1c), whereas HSUR 5 transcripts were not detectable. This is in agreement with the
hypothesis that HSUR 5 is usually not expressed, as it lacks the proper
promoter sequences. HSUR transcripts were not detectable from the
C488
HSUR-transformed cells (Fig. 1c). This shows that although HSURs
are expressed in transformed human T-cell lines, the deletion does not
affect viral transformation. The C488
HSUR- and C488-transformed
pairs of T-cell lines were further compared by flow cytometry analysis.
Surface marker analysis showed no significant differences. The
phenotype was similar to those of mature activated T cells, with
similar expression levels of CD3, TCR
, CD4 or CD8, and CD25 and a
strong expression level of major histocompatibility complex class II
(Fig. 1d).
These results are not compatible with the previous assumption that
HSURs may act as cofactors for lymphocyte transformation. Although
expressed in C488 wild-type virus-transformed human T cells, the
absence of all HSURs in the deletion virus did not result in any
significant loss of transforming capacity. No phenotypical differences
were apparent between human T cells transformed by the C488 wild-type
virus and those transformed by the C488
HSUR mutant virus. Small RNAs
are also carried by other gammaherpesviruses, namely the Epstein-Barr
virus (EBV)-encoded small RNAs (EBERs) (e.g., EBV and human herpesvirus
4) (18) and the related herpesvirus papio (13),
and the viral tRNAs of murine herpesvirus 68 (MHV-68) (5).
Although they have been shown to interact with cellular ribonucleoproteins and are useful for the detection of latent infection, no specific function has been assigned to the EBERs. The
MHV-68 tRNAs are not a substrate of aminoacyl tRNA synthases (5) and are dispensable for viral replication and infection (23). In conclusion, a biological function remains to be
assigned for the HSURs, as it does for the EBV-encoded EBERs and
MHV-68-encoded tRNAs. It may be speculated that HUSRs can induce some
modulation of transcription or translation in infected cells. The
ubiquitously expressed HuR protein was shown to be a 32-kDa nuclear
shuttle protein with homology to the Drosophila ELAV
protein. It is important in the nucleocytoplasmatic transport of
AU-rich elements containing mRNAs that carry a subset of early response
genes (8, 9, 14, 21). The presumed interaction of HSURs and
HuR may change the subcellular distribution of HuR and could result in
an altered translation or degradation of mRNAs encoding
proto-oncoproteins or cytokines. Changes in early-response protein
expression may be favorable for the establishment of a persistent viral
infection in the natural host. Thus, the HSURs are not required for in
vitro transformation of T cells or presumably for oncogenesis but may be relevant in the persistently infected animal host.
| |
FOOTNOTES |
|---|
*
Corresponding author. Mailing address: Institut
für Klinische und Molekulare Virologie der Universität
Erlangen
Nürnberg, Schlossgarten 4, 91054 Erlangen, Germany.
Phone: 49-9131-85-23786. Fax: 49-9131-85-1002. E-mail:
ensser{at}viro.med.uni-erlangen.de.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Albrecht, J. C., and B. Fleckenstein.
1992.
Nucleotide sequence of HSUR 6 and HSUR 7, two small RNAs of herpesvirus saimiri.
Nucleic Acids Res.
20:1810 |
| 2. |
Albrecht, J. C.,
J. Nicholas,
D. Biller,
K. R. Cameron,
B. Biesinger,
C. Newman,
S. Wittmann,
M. A. Craxton,
H. Coleman,
B. Fleckenstein, and R. W. Honess.
1992.
Primary structure of the herpesvirus saimiri genome.
J. Virol.
66:5047-5058 |
| 3. |
Biesinger, B.,
I. Müller-Fleckenstein,
B. Simmer,
G. Lang,
S. Wittmann,
E. Platzer,
R. C. Desrosiers, and B. Fleckenstein.
1992.
Stable growth transformation of human T lymphocytes by herpesvirus saimiri.
Proc. Natl. Acad. Sci. USA
89:3116-3119 |
| 4. |
Biesinger, B.,
A. Y. Tsygankov,
H. Fickenscher,
F. Emmrich,
B. Fleckenstein,
J. B. Bolen, and B. M. Bröker.
1995.
The product of the herpesvirus saimiri open reading frame 1 (tip) interacts with T cell-specific kinase p561ck in transformed cells.
J. Biol. Chem.
270:4729-4734 |
| 5. | Bowden, R. J., J. P. Simas, A. J. Davis, and S. Efstathiou. 1997. Murine gammaherpesvirus 68 encodes tRNA-like sequences which are expressed during latency. J. Gen. Virol. 78:1675-1687[Abstract]. |
| 6. | Chou, C. S., M. M. Medveczky, P. Geck, D. Vercelli, and P. G. Medveczky. 1995. Expression of IL-2 and IL-4 in T lymphocytes transformed by herpesvirus saimiri. Virology 208:418-426[Medline]. |
| 7. |
Duboise, S. M.,
J. Guo,
S. Czajak,
R. C. Desrosiers, and J. U. Jung.
1998.
STP and Tip are essential for herpesvirus saimiri oncogenicity.
J. Virol.
72:1308-1313 |
| 8. |
Fan, X. C., and J. A. Steitz.
1998.
HNS, a nuclear-cytoplasmic shuttling sequence in HuR.
Proc. Natl. Acad. Sci. USA
95:15293-15298 |
| 9. | Fan, X. C., and J. A. Steitz. 1998. Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 17:3448-3460[Medline]. |
| 10. | Fickenscher, H., B. Biesinger, A. Knappe, S. Wittmann, and B. Fleckenstein. 1996. Regulation of the herpesvirus saimiri oncogene stpC, similar to that of T-cell activation genes, in growth-transformed human T lymphocytes. J. Virol. 70:6012-6019[Abstract]. |
| 11. |
Geck, P.,
M. M. Medveczky,
C. S. Chou,
A. Brown,
J. Cus, and P. G. Medveczky.
1994.
Herpesvirus saimiri small RNA and interleukin-4 mRNA AUUUA repeats compete for sequence-specific factors including a novel 70K protein.
J. Gen. Virol.
75:2293-2301 |
| 12. |
Geck, P.,
S. A. Whitaker,
M. M. Medveczky, and P. G. Medveczky.
1990.
Expression of collagenlike sequences by a tumor virus, herpesvirus saimiri.
J. Virol.
64:3509-3515 |
| 13. |
Howe, J. G., and M.-D. Shu.
1988.
Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.
J. Virol.
62:2790-2798 |
| 14. |
Keene, J. D.
1999.
Why is Hu where? Shuttling of early-response-gene messenger RNA subsets.
Proc. Natl. Acad. Sci. USA
96:5-7 |
| 15. | Knappe, A., C. Hiller, M. Thurau, S. Wittmann, H. Hofmann, B. Fleckenstein, and H. Fickenscher. 1997. The superantigen-homologous viral immediate-early gene ie14/vsag in herpesvirus saimiri-transformed human T cells. J. Virol. 71:9124-9133[Abstract]. |
| 16. | Lee, S. I., S. C. Murthy, J. J. Trimble, R. C. Desrosiers, and J. A. Steitz. 1988. Four novel U RNAs are encoded by a herpesvirus. Cell 54:599-607[Medline]. |
| 17. |
Lee, S. I., and J. A. Steitz.
1990.
Herpesvirus saimiri U RNAs are expressed and assembled into ribonucleoprotein particles in the absence of other viral genes.
J. Virol.
64:3905-3915 |
| 18. |
Lerner, M. R.,
N. C. Andrews,
G. Miller, and J. A. Steitz.
1981.
Two small RNAs encoded by Epstein-Barr virus and complexed with protein are precipitated by antibodies from patients with systemic lupus erythematosus.
Proc. Natl. Acad. Sci. USA
78:805-809 |
| 19. | Medveczky, M. M., P. Geck, J. L. Sullivan, D. Serbousek, J. Y. Djeu, and P. G. Medveczky. 1993. IL-2 independent growth and cytotoxicity of herpesvirus saimiri-infected human CD8 cells and involvement of two open reading frame sequences of the virus. Virology 196:402-412[Medline]. |
| 20. | Murthy, S., J. Kamine, and R. C. Desrosiers. 1986. Viral-encoded small RNAs in herpes virus saimiri induced tumors. EMBO J. 5:1625-1632[Medline]. |
| 21. | Myer, V. E., X. C. Fan, and J. A. Steitz. 1997. Identification of HuR as a protein implicated in AUUUA-mediated mRNA decay. EMBO J. 16:2130-2139[Medline]. |
| 22. |
Myer, V. E.,
S. I. Lee, and J. A. Steitz.
1992.
Viral small nuclear ribonucleoproteins bind a protein implicated in messenger RNA destabilization.
Proc. Natl. Acad. Sci. USA
89:1296-1300 |
| 23. | Simas, J. P., R. J. Bowden, V. Paige, and S. Efstathiou. 1998. Four tRNA-like sequences and a serpin homologue encoded by murine gammaherpesvirus 68 are dispensable for lytic replication in vitro and latency in vivo. J. Gen. Virol. 79:149-153[Abstract]. |
| 24. |
Trimble, J. J.,
S. C. Murthy,
A. Bakker,
R. Grassmann, and R. C. Desrosiers.
1988.
A gene for dihydrofolate reductase in a herpesvirus.
Science
239:1145-1147 |
| 25. |
Wassarman, D. A.,
S. I. Lee, and J. A. Steitz.
1989.
Nucleotide sequence of HSUR 5 RNA from herpesvirus saimiri.
Nucleic Acids Res.
17:1258 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Mol. Cell. Biol. | Microbiol. Mol. Biol. Rev. |
|---|
| Clin. Vaccine Immunol. | ALL ASM JOURNALS |
|---|