Previous Article | Next Article 
Journal of Virology, December 1999, p. 10224-10235, Vol. 73, No. 12
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mutations Abrogating the RNase Activity in
Glycoprotein Erns of the Pestivirus Classical Swine Fever
Virus Lead to Virus Attenuation
Gregor
Meyers,*
Armin
Saalmüller, and
Mathias
Büttner
Department of Immunology, Federal Research
Centre for Virus Diseases of Animals, D-72001 Tübingen, Germany
Received 1 June 1999/Accepted 31 August 1999
 |
ABSTRACT |
Classical swine fever (CSF) is a severe hemorrhagic disease of
swine caused by the pestivirus CSF virus (CSFV). Amino acid exchanges
or deletions introduced by site-directed mutagenesis into the putative
active site of the RNase residing in the glycoprotein Erns
of CSFV abolished the enzymatic activity of this protein, as demonstrated with an RNase test suitable for detection of the enzymatic
activity in crude cell extracts. Incorporation of the altered sequences
into an infectious CSFV clone resulted in recovery of viable viruses
upon RNA transfection, except for a variant displaying a deletion of
the histidine codon at position 297 of the long open reading frame.
These RNase-negative virus mutants displayed growth characteristics in
tissue culture that were undistinguishable from wild-type virus and
were stable for at least seven passages. In contrast to animals
inoculated with an RNase-positive control virus, infection of piglets
with an RNase-negative mutant containing a deletion of the histidine
codon 346 of the open reading frame did not lead to CSF. Neither fever
nor extended viremia could be detected. Animals infected with this
mutant did not show decrease of peripheral B cells, a characteristic
feature of CSF in swine. Animal experiments with four other mutants
with either exchanges of codons 297 or 346 or double exchanges of both
codons 297 and 346 showed that all these RNase-negative mutants were
attenuated. All viruses with mutations affecting codon 346 were
completely apathogenic, whereas those containing only changes of codon
297 consistently induced clinical symptoms for several days, followed by sudden recovery. Analyses of reisolated viruses gave no indication for the presence of revertants in the infected animals.
| |
INTRODUCTION |
Pestiviruses are the etiologic
agents of economically important diseases of animals in many countries
worldwide. According to the host animals from which the viruses
originate, presently known pestivirus isolates have been grouped into
three different species which together form one genus within the family
Flaviviridae. A new taxonomy with four virus species has
been proposed that is based on the results of sequence comparison
studies and takes into account that pestiviruses infect different host
species. Pestiviruses predominantly found in ruminants are two types of bovine viral diarrhea virus and border disease virus. These viruses are
responsible for a variety of syndromes characterized by different clinical symptoms (1, 18, 32). Classical swine fever virus (CSFV), formerly named hog cholera virus, represents the fourth species
and is causative for classical swine fever (CSF), a severe disease that
results in high morbidity and mortality of infected swine (18,
32). Acute CSF is characterized by pyrexia and leukopenia.
Diseased animals show anorexia and diarrhea and in late stage central
nervous disorders, hemorrhages in the skin, mucosa, and inner organs.
Like all pestiviruses, CSFV is immunosuppressive during acute
infection. A characteristic feature detected early after infection of
swine is a dramatic decrease of peripheral B cells (30).
Infection with CSFV variants of high virulence mostly leads to death of
the affected animal. However, recent CSFV outbreaks in Europe resulted
predominantly from viruses apparently inducing milder and chronic forms
of the disease (18, 32).
Like other members of the family Flaviviridae, pestiviruses
are small enveloped viruses with a single-stranded RNA genome of
positive polarity. The pestivirus RNA lacks both 5' cap and 3' poly(A)
sequences and contains one long open reading frame (ORF) coding for a
polyprotein of about 4,000 amino acids, which encompasses all viral
proteins arranged in the order
NH2-Npro-C-Erns-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B-COOH.
The polyprotein gives rise to 11 to 12 final cleavage products by co-
and posttranslational processing involving cellular and viral proteases
(21). Protein C and the glycoproteins Erns, E1,
and E2 represent structural components of the pestivirus virion
(33). E2 and, to a lesser extent, Erns were
found to be targets for antibody neutralization (7, 19, 36, 37,
38). Erns lacks a typical membrane anchor and is
secreted in considerable amounts from the infected cells
(23). A highly unusual feature of this protein is its RNase
activity that was first identified by characteristic sequence motifs
and then proven by enzymatic tests with the purified protein (9,
28, 40). The function of this enzymatic activity for the viral
life cycle is presently unknown. Experimental destruction of the RNase
by site-directed mutagenesis of the respective sequence in the genome
of a CSFV vaccine strain has been reported to result in a
cytopathogenic virus that has growth characteristics in cell culture
equivalent to wild-type virus (10). We report here on the
establishment of mutants of the virulent CSFV strain
Alfort/Tübingen and the effects of the introduced mutations with
regard to the pathogenicity of the virus in its natural host.
| |
MATERIALS AND METHODS |
Cells and viruses.
PK15 cells were obtained from the
American Type Culture Collection (Rockville, Md.). CSFV strain
Alfort/Tübingen was reisolated from organs of an experimentally
infected moribund animal (22). CSFV Eystrup originated from
Behring, where it served as a challenge virus; the virus was obtained
from the CSFV reference strain collection of the Federal Research
Centre for Virus Diseases of Animals (kindly provided by R. Ahl). Cells
were grown in Dulbecco modified Eagle medium (DMEM) supplemented with
10% fetal calf serum (FCS; tested for the absence of pestiviruses and
antibodies against pestiviruses) and nonessential amino acids. Cells
and virus stocks were tested regularly for the absence of mycoplasma contamination.
The BSR clone of BHK-21 cells was kindly provided by J. Cox (Department
of Immunology, Federal Research Centre for Virus Diseases of Animals,
Tübingen, Germany).
Infection of cells and immunofluorescence assay.
Since
pestiviruses are known to be associated with the host cells, lysates of
infected cells were used for reinfection of culture cells. Lysates were
prepared by freezing and thawing cells at 48 h postinfection and
were stored at 
70°C. If not indicated differently in the text, a
multiplicity of infection (MOI) of about 0.01 was used for infections.
For detection of infected cells in immunofluorescence assays, cells
were fixed with ice-cold methanol-acetone (1:1) for 15
min, air dried,
rehydrated with phosphate-buffered saline (PBS)
and then incubated with
a mixture of anti-CSFV monoclonal antibodies
(MAbs) a18 and 24/16
(
38,
39). Bound antibodies were detected
with a fluorescein
isothiocyanate (FITC)-conjugated goat anti-mouse
serum (Dianova,
Hamburg,
Germany).
Generation of cDNA clones with mutations in the Erns
gene.
Restriction, cloning, and other standard procedures were
done essentially as described previously (27). Restriction
and modifying enzymes were obtained from New England BioLabs
(Schwalbach, Germany), Pharmacia (Freiburg, Germany), Gibco-BRL
(Eggenstein, Germany), and Boehringer Mannheim GmbH (Mannheim, Germany).
Starting with the full-length cDNA clones pA/CSFV (
14), from
which infectious cRNA can be obtained by in vitro transcription,
subclones were generated. A
XhoI/
SspI fragment of
pA/CSFV was
cloned into pBluescript SK(+) and cut with
XhoI
and
SmaI, leading
to plasmid p666. Single-stranded plasmid
DNA was produced according
to the method of Kunkel et al.
(
13) by using
Escherichia coli CJ236 cells
(Bio-Rad, Munich, Germany) and the VCMS single-strand
phage
(Stratagene, Heidelberg, Germany). The single-stranded DNA
was
converted to double strands by using the Phagemid In Vitro
Mutagenesis
Kit (Bio-Rad) and the following synthetic oligonucleotides
as primers:
Ol/C-297-L, AGGAGCTTACTTGGGATCTG; Ol/C-346-L,
GGAACAAACTTGGATGGTGT;
Ol/C-297-K,
ACAGGAGCTTAAAAGGGATCTGGC; Ol/C-346-K,
ATGGAACAAAAAGGGATGGTGTAA;
Ol/C-297-d,
AACAGGAGCTTAGGGATCTGGCCC; and Ol/C-346-d,
GAATGGAACAAAGGATGGTGTAAC.
The double-stranded plasmid DNA was used for transformation of
E. coli XL1-Blue cells (Stratagene). Bacterial colonies harboring
plasmids were isolated via ampicillin selection, and plasmid DNA
was
prepared and further analyzed by nucleotide sequencing by
using the T7
polymerase sequencing kit (Pharmacia, Freiburg,
Germany).
Plasmids containing the desired mutations and no second site changes
were used for construction of full-length cDNA clones.
An
XhoI/
NdeI fragment from the mutagenized plasmid
was inserted
together with an
NdeI/
BglII fragment
derived from plasmid 578
(pCITE 2a, containing the
XhoI/
BglII fragment from pA/CSFV) into
pA/CSFV
cut with
XhoI and
BglII. To restore the wild-type
sequence
in full-length clones containing mutated E
rns
genes, a 1.7-kb
XhoI/
NdeI fragment was exchanged
for the corresponding
fragment from
p666.
A second series of constructs was established for expression in the
vaccinia virus-T7 system. To do so, plasmid p666 was mutagenized
with
oligonucleotide Cs/
NcoI as described above to yield a
construct
with an
NcoI site at the ATG of the CSFV ORF. The
plasmid with
the mutation (p666/Mut-
NcoI) was cut with
NcoI and
NdeI, and the
cDNA fragment was cloned
into pCITE 2a (AGS, Heidelberg, Germany),
restricted with the same
enzymes, leading to plasmid p704. Plasmid
p705 was constructed by
inserting an
NcoI/
HindIII fragment from
p704
together with a
HindIII/
NdeI fragment from
p666/297-L into
pCITE 2a, cut with
NcoI and
NdeI.
The presence of the desired
mutations in the resulting constructs was
verified by DNA sequencing.
To establish p706, a plasmid equivalent to
p704 with a deletion
covering the complete E
rns coding
region, plasmid p578 was cut with
BsaBI and
XbaI,
ligated
with a
BanI/
XbaI fragment of the same
plasmid together with oligonucleotides
Cs/C-E1+ and Cs/C
E1
. From
the resulting construct, a
HindIII/
NdeI
fragment was inserted together with an
NcoI/
HindIII fragment from
p666/Mut-NcoI into
pCITE 2a cut with
NcoI and
NdeI.
The oligonucleotides used were as follows: Cs/
NcoI,
TGTACATGGCCCATGGAGTTG; Cs/C
E1+,
CAATCTTGCTGTACCAGCCTGTAGCAGCCG; and Cs/C
E1
,
GCACCGGCTGCTACAGGCTGGTACAGCAAGATTG.
In vitro transcription and RNA transfection.
Amounts (2 µg) of the respective cDNA construct were linearized with the
restriction enzyme SrfI and purified by phenol extraction and ethanol precipitation. Transcription with T7 RNA polymerase (NEB,
Schwalbach, Germany) was carried out in a total volume of 50 µl of
transcription mix (40 mM Tris-HCl, pH 7.5; 6 mM MgCl2; 2 mM
spermidine; 10 mM NaCl; 0.5 mM concentrations of each ATP, GTP, CTP,
and UTP; 10 mM dithiothreitol; 100 µg of bovine serum albumin per ml)
with 50 U of T7 RNA polymerase in the presence of 15 U of RNAguard
(Pharmacia). After incubation at 37°C for 1 h the reaction
mixture was passed through a Sephadex G-50 spin column (27)
and further purified by phenol extraction and ethanol precipitation.
Transfection was done with a suspension of 3 × 10
6
PK15 cells and ca. 0.5 µg of in vitro-transcribed RNA bound to
DEAE-dextran
(Pharmacia). For positive controls, usually 5 µg of
total RNA
from PK15 cells infected with the respective CSFV isolate was
used for transfection. The RNA-DEAE-dextran complex was established
by
mixing RNA dissolved in 100 µl of Hanks balanced salt solution
(HBSS)
(
35) with 100 µl of DEAE-dextran (1 mg/ml in HBSS) and
incubation for 30 min on ice. Pelleted cells were washed once
with DMEM
without FCS, centrifuged, and then resuspended in the
RNA-DEAE-dextran
mixture. After 30 min of incubation at 37°C,
20 µl of dimethyl
sulfoxide was added, and the mixture was incubated
for 2 min at room
temperature. After the addition of 2 ml of HBSS,
cells were pelleted
and washed once with HBSS and once with medium
without FCS. Cells were
resuspended in DMEM with FCS and seeded
in a 10.0-cm-diameter dish. At
48 to 72 h posttransfection cells
were split and seeded as
appropriate for subsequent
analyses.
Northern (RNA) hybridization.
RNA was prepared 48 h
after infection by using either the Trizol reagent as recommended by
the supplier (Gibco-BRL) or cesium chloride density gradient
centrifugation as described before (22). Gel
electrophoresis, radioactive labeling of the probe, hybridization, and
posthybridization washes were done as described before (22). A 2.2-kb SalI fragment from CSFV Alfort cDNA clone 4.2 (14) was used as a probe.
RT-PCR.
Reverse transcription of 2 µg of heat-denatured
RNA (2 min at 92°C, 5 min on ice in 11.5 µl of water in the
presence of 30 pmol of reverse primer) was done after the addition of 8 µl of reverse transcriptase (RT) mix (125 mM Tris-HCl, pH 8.3; 182.5 mM KCl; 7.5 mM MgCl2; 25 mM dithiothreitol; 1.25 mM
concentrations of dATP, dTTP, dCTP, and dGTP), 15 U of RNAguard, and 50 U of Superscript (Gibco-BRL) for 45 min at 37°C. After addition of paraffin (Paraplast; melting point, 55°C) and 2 min at 80°C, the tubes were placed on ice and 30 µl of PCR mix (8.3 mM Tris-HCl, pH
8.3; 33.3 mM KCl; 2.2 mM MgCl2; 0.42 mM each of dATP, dTTP, dCTP, and dGTP; 0.17% Triton X-100; 0.03% bovine serum albumin; 5 U
of Taq polymerase [Appligene, Heidelberg, Germany]) was
added. Amplification was carried out in 30 cycles (30 s at 94°C,
30 s at 54°C, and 60 s at 72°C).
The primers for RT-PCR were as follows: upstream,
CATGCCATGGCCCTGTTGGCTTGGGCGGTGATA; and downstream,
GGAATTCTCAGGCATAGGCACCAAACCAGG.
The amplified cDNA fragments
were purified by preparative agarose
gel electrophoresis. Elution of
DNA from the agarose gel was done
with the Qiaex Kit (Qiagen, Hilden,
Germany). For sequencing with
the upstream primer, the Big Dye
Terminator Cycle Sequencing Kit
(Perkin-Elmer/Applied Biosystems,
Weiterstadt, Germany) was used.
Analysis of the sequencing products was
done with an ABI Prism
377 DNA Sequencer (Perkin-Elmer/Applied
Biosystems).
Transient expression, metabolic labeling,
radioimmunoprecipitation, and SDS-PAGE.
Transient expression of
transfected plasmids with vaccinia virus vTF7-3 (kindly provided by B. Moss) (8) was done as described before (31),
except that the labeling time was reduced to 5 h. CSFV-infected
PK15 cells (1.5 × 106 per 3.5-cm dish) were labeled
for 8 h with 0.5 mCi of
[35S]methionine-[35S]cysteine (Promix;
Amersham, Braunschweig, Germany) per ml. The labeling medium contained
no cysteine and no methionine. Cell extracts were prepared under
denaturing conditions. Extracts were incubated with 5 µl of undiluted
serum. Precipitates were formed with cross-linked Staphylococcus
aureus (11), analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and processed by
fluorography by using En3Hance (New England Nuclear,
Boston, Mass.).
Determination of RNase activity.
For analysis of RNase
activity after CSFV infection, PK15 cells were infected with the mutant
viruses at an MOI of 0.01. Infection with wild-type virus served as a
positive control, whereas noninfected cells were used as a negative
control. At 48 h postinfection cells were washed twice with PBS
and then lysed in 0.4 ml of lysis buffer (20 mM Tris-HCl, 100 mM NaCl,
1 mM EDTA, 2 mg of bovine serum albumin per ml, 1% Triton X-100, 0.1%
deoxycholic acid, 0.1% SDS). The lysate was added to 1.5-ml reaction
tubes, sonified (Branson sonifier B12; 120 W for 20 s in a cup
horn water bath), and cleared by centrifugation (5 min, 14,000 rpm,
Eppendorf centrifuge, 4°C), and the supernatant was subjected to
ultracentrifugation (Beckman tabletop ultracentifuge, 60 min at 4°C
and 45,000 rpm in a TLA 45 rotor).
To determine the RNase activity of transiently expressed proteins,
BHK21 cells (clone Bsr) were infected with vTF7-3 and transfected
with
the different constructs as described above. About 10 h
posttransfection,
the cells were lysed and further processed as
described for CSFV
infected cells. For these analyses, cells infected
with vTF7-3
but not transfected served as a
control.
Determination of RNase activity was done essentially as described
before (
28). If not otherwise specified, assays were
conducted
in a total volume of 200 µl containing 5 or 50 µl of
supernatant
of the second centrifugation step and 80 µg of Poly(U)
(Pharmacia)
in RNase assay buffer (40 mM Tris-acetate [pH 6.5], 0.5 mM EDTA,
5 mM dithiothreitol). After incubation of the reaction mixture
at 37°C for 1 h, 200 µl of 1.2 M perchloric acid-20 mM
lanthanum
sulfate was added. After 15 min of incubation on ice the
mixture
was centrifuged for 15 min at 4°C and 14,000 rpm in an
Eppendorf
centrifuge. To the supernatant, 3 volumes of water were added
and an aliquot of the mixture was analyzed by measuring the optical
density at 260 nm (OD
260) by using an Ultrospec 3000 spectrophotometer
(Pharmacia). As a positive control, RNase A from
bovine pancreas
(Serva, Heidelberg, Germany) with an activity of 85 Kunitz units
per mg of protein was used instead of the cell extract in
some
experiments.
For time course experiments, the assay was scaled up to a total volume
of 1.5 ml. At each time point, 160 µl of the reaction
mixture was
removed and mixed with 160 µl of the acid solution.
All further steps
were the same as those described
above.
To determine the influence of antibodies on the RNase activity
E
rns, 0.1 µl of cell extract was incubated in a total
volume of 160
µl containing 20 µl 10× RNase assay buffer and 5 µl of rabbit
antiserum against E
rns (kindly provided by
R. Stark and H.-J. Thiel, Institut für Virologie,
FB
Veterinärmedizin, Justus Liebig Universität Giessen) or a
rabbit preimmune serum for 1 h at 37°C, followed by further
incubation
for 16 h at 4°C. RNase activity was measured after
the addition
of 40 µl of Poly(U) solution (containing 80 µg of RNA)
and incubation
at 37°C for 45 min. Acid precipitation and further
analysis were
done as described
above.
Animal experiments.
For each mutant three piglets (German
Landrace; 20 to 25 kg) were used. If not specified, the infection dose
was 0.5 × 105 to 1 × 105 50%
tissue culture infective doses (TCID50) per animal,
depending on the size of the animals; two-thirds of the inoculate was
administered intranasally (one-third in each nostril), and one-third
was given intramuscularly. The different groups were housed in separate isolation units. Blood was taken from the vena jugularis at the time
points indicated in the Results section. Coagulation was inhibited with
heparin (20 IU/ml of blood) or sodium citrate (3.8% [wt/vol]).
In challenge experiments, the animals were inoculated with 2 × 10
5 TCID
50 of CSFV strain
Eystrup.
To test the animals for the presence of virus in the blood, PK15 cells
seeded in a 24-well plate were incubated with 100 µl
of
citrate-treated or heparinized blood and 100 µl of medium (animal
experiment 1 or 3, respectively) or with 50 µl of isolated peripheral
blood leukocytes (prepared as described previously
[
25]) and
150 µl of medium (animal experiment 2).
After 1 h at 37°C, the
mixture was removed and the cells were
washed twice with medium
and incubated for 48 to 72 h at 37°C.
Infection of cells was demonstrated
by immunofluorescence (see
above).
To look for virus-neutralizing antibodies in blood serum or plasma,
samples were diluted 1:2 and then in steps of 1:3 with
medium. Next, 50 µl of the diluted samples were mixed with 50
µl of medium
containing 30 TCID
50 of virus (CSFV Alfort/Tübingen).
After 90 min of incubation at 37°C, 100 µl of cell suspension
(1.5 × 10
4 cells) was added, and the mixture was
seeded in 96-well plates.
After 72 h the cells were fixed with
ice-cold acetone-methanol
and analyzed for infection by
immunofluorescence with MAb a18
(
38).
Isolation of PBMC and FCM.
PBMC were isolated from
heparinized blood samples by use of Ficoll-Hypaque (Pharmacia, Uppsala,
Sweden) centrifugation (1,100 × g, 30 min) as
described earlier (25).
Staining of PBMC for two-color flow cytometric (FCM) analyses was
performed in a two-step procedure: (i) incubation with MAb
B-ly4
[
human CD21, immunoglobulin G1 [IgG1]; Pharmingen, San
Diego,
Calif. [
4,
26,
29]) and MAb 74-22-15A [
SWC3,
IgG2b,
Dr. J. K. Lunney, USDA ARS, Beltsville, MD
(
20)] and (ii) incubation
with isotype-specific conjugates
(
IgG2b-FITC and
IgG1-PE; Southern
Biotechnology, Birmingham,
Ala.). Between each of the incubation
steps on ice, cells were washed
with PBS-2% FCS (vol/vol). The
analyses were performed on a
FACStarplus (Becton Dickinson, Mountain
View, Calif.) as described
earlier (
24).
The percentages of CD21-positive B lymphocytes and SWC3-positive
myeloid cells were calculated by using WinMDI or Cell Quest
software.
| |
RESULTS |
Introduction of mutations into Erns and RNase
test.
The pestivirus Erns sequence contains two short
stretches of amino acids that show limited but significant homology to
sequences found in different known RNases of plant and fungal origin.
The respective regions of the pestivirus proteins correspond to
residues 295 to 307 and residues 338 to 357 in the polyprotein of the
CSFV strain Alfort/Tübingen and are regarded as essential for
enzymatic activity (9, 28). Both of these stretches of amino
acids are conserved among pestiviruses and contain a histidine residue (positions 297 and 346, respectively); these two residues are believed
to be involved in the catalytic reaction (28). Substitution of each of these residues for lysine in the Erns protein of
a CSFV vaccine strain resulted in the destruction of RNase activity
(10). To be able to test the influence of mutations
affecting the RNase activity of Erns on the pathogenicity
of a virulent CSFV strain, such mutants were established on the basis
of the CSFV strain Alfort/Tübingen. An
XhoI/SspI fragment of the infectious clone
pA/CSFV was subcloned into pBluescript SK(+), and a variety of mutants
was established with the oligonucleotides Ol/C-297-L, Ol/C-346-L,
Ol/C-297-K, Ol/C-346-K, Ol/C-297-d, and Ol/C-346-d. Mutagenesis with
the first four oligonucleotides led to substitution of the histidine
residues at positions 297 or 346 of the polyprotein for lysine
(oligonucleotides with names ending with "-K") or leucine
(oligonucleotides with names ending with "-L"), respectively (Fig.
1). In addition to plasmids coding for
proteins with one of these mutations, double mutants were also
established with both of the histidine codons at positions 297 and 346 exchanged for triplets coding for leucine or lysine, respectively.
Another double mutant encoded a protein with lysine at position 297 and
leucine at position 346. Oligonucleotides Ol/C-297-d and Ol/C-346-d
were used to delete the histidine codons at positions 297 and 346, respectively (Fig. 1). Introduction of the desired mutations and the
absence of unwanted second site mutations was verified by nucleotide
sequencing.
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
Sequences encoded by CSFV Alfort/Tübingen (CSFV)
and the different Erns mutants. Only those parts of the
Erns sequence containing the conserved regions with the
putative active-site residues of the RNase are shown. Residues
conserved with regard to known RNases of fungal origin are indicated in
boldface. Residues 297 and 346 of the polyprotein are shaded and
underlined.
|
|
To analyze the effect of the introduced mutations on the RNase function
of E
rns, it was necessary to measure the enzymatic activity
of the altered
proteins. Published assay systems rely on the
purification of
E
rns with specific MAbs and determination
of the degradation of high-molecular-weight
RNA by measuring the
generation of acid-soluble nucleic acid (
9,
10,
28). As a
quick and easy alternative, we established an
assay to measure RNase
activity in crude cell extracts. Initial
tests were conducted with
proteins expressed in the vaccinia virus-T7
system (
8).
Different expression constructs were established
that start with the
original translational initiation codon of
the CSFV ORF and end with an
NdeI site located within the region
coding for glycoprotein
E1. Initially, three constructs were established
that contained either
the wild-type sequence, a mutant with leucine
replacing the histidine
codon at position 297 of the ORF, or a
mutant from which the complete
E
rns gene was deleted (plasmids p704, p705, or p706,
respectively).
After transient expression of these constructs, cell
extracts
were prepared and aliquots thereof were tested for the ability
to degrade Poly(U). As a control, the extract of nontransfected,
vTF7-3
infected cells was used. After 60 min of incubation, the
residual
high-molecular-weight RNA was precipitated with perchloric
acid and the
acid-soluble reaction products were quantified by
determination of the
OD
260. Extracts of cells transfected with
plasmid p704
showed significant RNase activity, whereas the values
determined after
transfection of p705 or p706 were in the same
range as the negative
control (Fig.
2). This result was not due
to major differences in the transfection or expression efficiencies
since accompanying analyses of radioactively labeled proteins
from
equivalently transfected dishes by using immunoprecipitation
and
phophorimager-based quantification showed similar expression
levels
(Fig.
2). To test the influence of protein concentration
on the
results, the assay with the extract of p704- or p705-transfected
cells
was repeated with different protein concentrations. The
undiluted
extracts or dilutions of 1:5 to 1:1,000 were used. For
p704,
OD
260 values of >2 were recorded for dilutions up to
1:100.
At higher dilutions, significantly reduced RNase activity was
observed. In contrast, no concentration dependency was detected
for the
assays with extract from p705-transfected cells (not shown).
These
analyses indicated that the amount of extract used for the
experiment
summarized in Fig.
2 resulted in saturation of the
assay with enzyme.
Thus, small differences in protein amounts
cannot be responsible for
our results.
View larger version (34K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of Erns in the vaccinia virus
vTF7-3 system. The different cDNA constructs were transfected into
BHK21 cells infected with vTF7-3. The cells in one set of dishes were
labeled with radioactive amino acids. The labeled proteins were
precipitated with antisera specific for Npro or
Erns, and equal volumes of the precipitates were separated
by PAGE. The gels were analyzed by fluorography (upper part) or by
measuring the amount of radioactivity contained in the specific bands
by using a phosphorimager (middle). The protein extracts of a second
set of dishes were used for the determination of RNase activity (lower
part). Cells infected with vTF7-3 but not transfected with a plasmid
were used as negative controls. For the RNase test, 100 ng of RNase A
from bovine pancreas (0.0085 Kunitz units) served as a positive
control. RNase activity was determined by measuring the
OD260 due to the release of acid-soluble RNA. OD values of
ca. 0.4 to 08 as measured for the negative control are not due to
enzymatic degradation of RNA, since no decrease was observed when less
of the cell extracts was used for the test.
|
|
In a further assay, the time course of the enzymatic degradation of the
RNA was determined. RNA degradation was induced by
the extract of
p704-transfected cells and stopped at eight different
time points
ranging from 0 to 55 min. Determination of the amount
of
acid-precipitable RNA showed a clear time dependency of the
reaction,
reaching its maximum between 35 and 45 min (not
shown).
It has been shown before that the RNase activity of E
rns
can be blocked by antibodies specific for this protein (
40).
To demonstrate
that the degradation of RNA observed in the
above-described assay
indeed is due to the enzymatic activity of
E
rns, an equivalent assay was conducted after incubation of
cell extracts
with either a monospecific antiserum against
E
rns or a preimmune serum. When extracts of a
nontransfected vaccinia
virus control or cells transfected with p705
were tested, similar
values were determined regardless of whether the
antiserum or
the preimmune serum was used (Fig.
3). However, the analysis with
extracts
of cells transfected with p704 showed a significantly
reduced OD value
after incubation with the antiserum in comparison
to that after
incubation with the preimmune serum. Taken together,
these results show
that the described assay allows the detection
of E
rns RNase
activity and the discrimination between wild-type E
rns and
mutants with changes abrogating the enzymatic activity of
the protein.
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Influence of antibodies on the RNase activity. Diluted
extracts of cells transfected with p704 or p705 were first incubated
with a polyclonal antiserum directed against Erns
(anti-Erns) or a rabbit preimmune serum (NS) and then
tested for RNase activity. An extract from cells infected with vTF7-3
(control) or 10 ng of RNase A from bovine pancreas (0.00085 Kunitz
units) served as controls.
|
|
In order to analyze the effect of the different mutations on the RNase
activity of E
rns, expression constructs equivalent to p704
were established for
all mutants. After expression in the vaccinia
virus vTF7-3 system,
the analysis of the enzymatic activity in the cell
extracts showed
that the RNase was inactivated in all mutants (not
shown). Thus,
as expected, all the exchanges and deletions affecting
the putative
active center of the RNase destroyed its enzymatic
activity.
Generation of RNase-negative mutants of CSFV
Alfort/Tübingen.
Substitution of histidine 297 or 346 in the
polyprotein of the CSFV vaccine strain for lysine did not influence
viral viability or growth properties (10). To test the
effects of the different mutations introduced into the sequence of CSFV
Alfort/Tübingen on virus viability, fragments containing the
altered sequences were inserted into the infectious cDNA clone pA/CSFV
replacing the wild-type sequence. RNA transcribed from the resulting
constructs, termed pC-297-L, pC-297-K, pC-297-d, pC-346-L, pC-346-K,
pC-346-d, pC-297-L/346-L, and pC-297-K/346-L, was used for transfection of porcine kidney (PK15) cells. The cells were analyzed 3 days posttransfection by immunofluorescence for the expression of CSFV proteins. For all constructs except for pC-297-d, positive signals were
obtained. Analysis of RNA prepared at 4 days posttransfection by
Northern blot with a CSFV-specific probe allowed the detection of viral
RNA for all these mutants, whereas RNA prepared from noninfected cells
or cells transfected with RNA transcribed from pC-297-d showed no
signal (not shown). Freeze-thaw extracts of the transfected cells found
positive in the first tests were prepared and used for infection of
fresh cells with an MOI of about 0.01. Again, the infected cells showed
positive immunofluorescence signals, proving that viable viruses had
been recovered after transfection of the RNAs with the mutations in
Erns. RNA was prepared 48 h postinfection and analyzed
by Northern blot. Virus genome could again be detected in all RNA
samples except for the noninfected control (Fig.
4). When analyzing RNA yields with a
phosphorimager we observed differences of up to a factor of 3 between
individual samples in one experiment (data not shown). These
differences seemed to be not significant when several independent
experiments were compared. Since, however, RNA yield was only analyzed
rather late after infection, an influence of the mutations on RNA
synthesis cannot be excluded completely and has to be analyzed in
further experiments.
View larger version (63K):
[in this window]
[in a new window]
|
FIG. 4.
Northern blot with RNA from cells infected with cell
extracts prepared from cells transfected with in vitro-transcribed RNA
containing the mutations resulting in the indicated changes in the
Erns sequence. Total RNA of the infected cells was
separated in an agarose gel under denaturing conditions, transferred to
a nylon membrane, and hybridized with a CSFV-specific probe. On the
left side of the gel, the bands of an RNA ladder are indicated.
|
|
In the plasmid pC-297-d, from which infectious virus could not be
recovered, the wild-type sequence was restored. The exchanged
cDNA
fragment was sequenced and found to be free of unwanted mutations.
From
the restored plasmid, infectious virus could be recovered,
showing that
the failure to obtain viable virus from pC-297-d
was indeed due to the
deletion of the histidine
codon.
To test whether the virus mutants showed an RNase-negative phenotype,
we tried to measure RNase activity in extracts of the
infected cells.
For all viruses, two dishes were infected with
an MOI of 0.01, and the
cell extracts were prepared 2 days postinfection,
a time point at which
all cells were found to be infected according
to immunofluorescence
analyses (not shown). To determine the amount
of E
rns
generated in the infected cells, a second set of two dishes with
infected cells was labeled with
35S-amino acids and
analyzed by immunoprecipitation and phosphorimager
quantification of
E
rns. The amount of E
rns protein present in the
different extracts was found to be very
similar (data not shown).
Noninfected cells and cells infected
with the virus recovered from an
infectious cDNA clone without
mutation served as negative and positive
controls, respectively.
Infection with the virus without mutation
resulted in measurable
RNase activity, whereas all mutants were in the
same range as
the negative control (Fig.
5). Thus, the different exchanges or
the
deletion of codon 346 in the E
rns gene did not interfere
with viability of the virus but resulted
in an RNase-negative
phenotype.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
Analysis of RNase activity in extracts of cells infected
with CSFV Alfort/Tübingen (Alfort), the virus recovered from the
infectious clone pA/CSFV [V(pA/CSFV)], or the indicated mutants
thereof at 1 passage postinfection. The given OD values represent the
averages of two independent experiments.
|
|
The growth characteristics of the recovered virus mutants were analyzed
by recording the growth curves. In different experiments
with samples
obtained from independent transfections no significant
differences were
observed between the mutants and the virus recovered
from pA/CSFV, the
construct containing the wild-type sequence
(data not shown). Since RNA
viruses are known to exhibit a high
rate of spontaneous mutation,
revertants or pseudorevertants might
arise during virus propagation.
Therefore, the virus mutants C-346-L,
C-346-d, C-297-L/346-L, and
C-297-K/346-L were passaged seven
times and then analyzed for RNase
activity. A virus recovered
from pA/CSFV, displaying no mutation in
E
rns, and noninfected cells served as controls. All mutants
still
showed an RNase-negative phenotype, indicating that at least no
significant portion of the virus population present after seven
passages had restored the enzymatic activity (not shown). As a
further
test, RNA was prepared from cells infected with the different
viruses
of the seventh passage, and the E
rns-coding region was
amplified by RT-PCR. The RT-PCR products were
isolated, and the region
harboring the mutations was sequenced.
No indication for reversion was
found (not shown). Thus, it can
be concluded that the mutations
abrogating RNase activity are
stable over several passages, indicating
that the loss of RNase
function does not represent a considerable
disadvantage for virus
replication in
vitro.
Animal experiments with RNase mutant C-346-d.
The function of
the RNase activity of Erns for pestiviruses is not known.
Our data, as well as those published by Hulst et al. (10),
show that this enzymatic activity is dispensable for growth of CSFV in
tissue culture cells. It therefore can be speculated that the RNase
plays a role during virus replication in the natural hosts of
pestiviruses. To analyze the effects of RNase mutations on CSFV
propagation in pigs, animal experiments were conducted. To minimize the
danger of the generation of revertants possibly leading to unclear
results, the deletion mutant C-346-d was used for the first experiment.
Three pigs of about 25 kg (body weight) were each infected with
105 TCID50 of virus. As a control, a second
group (n = 3) was inoculated with the same amount of
V(pA/CSFV), the virus recovered from the infectious clone without RNase
mutation. Each group of animals was housed separately in isolation
units, and the body temperatures of all animals were recorded daily
(Fig. 6). Blood was taken from the
animals two times before infection and on days 3, 5, 7, 10, 12, and 14 postinfection. The animals infected with the wild-type virus showed
typical symptoms of CSF, such as fever, ataxia, anorexia, diarrhea,
central nervous disorders, and hemorrhages in the skin. Virus could be
recovered from the blood on days 3 (animal 68), 5, 7, 10, and 14 (animals 68, 78, and 121) postinfection (Table 1). The animals were killed in a moribund
stage at day 14 postinfection. At this time, no virus-neutralizing
antibodies could be detected (data not shown).
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
Body temperature curves of animals infected with
V(pA/CSFV), the virus recovered from the infectious cDNA clone pA/CSFV
(solid lines), or C-346-d, the mutant thereof that contains a deletion
of codon 346 (broken lines).
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Detection of CSFV in the blood of animals infected with
V(pA/CSFV) (animals 68, 78, and 121) or C-346-d (animals 70, 72, and 74) determined at the indicated
time pointsa
|
|
In contrast, the animals infected with the mutant did not develop
clinical symptoms. The temperature remained normal over
the whole
experimental period (Fig.
6). Food consumption remained
normal, and no
reduction in average body weight gain was observed.
At no time could
virus be recovered from the blood. Nevertheless,
the animals became
infected, since all of them developed neutralizing
antibodies that were
already detectable by day 17 postinfection.
The neutralization titers
increased during the observation period
until day 69 postinfection
(Table
2).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Determination of neutralization titers of serum
samples obtained from animals infected with C-346-d at the
indicated time pointsa
|
|
To analyze whether the infection with the mutant virus had induced
protective immunity, a challenge experiment was conducted
10 weeks (day
69) after the infection with the CSFV mutant by
using the highly
pathogenic heterologous CSFV strain Eystrup.
A 2 × 10
5 TCID
50 of virus was used for the infection.
This amount of virus
had been found to be sufficient to induce lethal
disease in several
earlier studies (
12,
17). However, the
animals previously
infected with the CSFV RNase mutant did not show
symptoms of disease
after challenge infection. Neither fever nor
viremia could be
detected (not shown), but an increase in neutralizing
antibodies
indicated productive infection and replication of the
challenge
virus (Table
2, values for days 76, 79, and 87
postinfection).
To show that the observed attenuation of the mutant virus is indeed due
to the deletion of the histidine at position 346 of
the polyprotein and
not a consequence of an unidentified second
site mutation, the
wild-type sequence was restored by substitution
of a 1.7-kb
XhoI/
NdeI fragment of the full-length clone
pC-346-d
for the corresponding fragment of pA/CSFV displaying the
wild-type
sequence. The fragment excised from pC-346-d was analyzed by
nucleotide
sequencing for mutations; except for the deletion of the
triplet
coding for histidine 346 of the polyprotein no difference with
regard to the wild-type sequence was found. From the cDNA construct
with the rescued mutant, virus C-346-d/Rs could be recovered that
grew
as well as wild-type virus and showed equivalent RNase activity
(not
shown). In a second animal experiment, the rescued virus
was used for
the infection of pigs. As a control, the deletion
mutant C-346-d
recovered after an independent RNA transfection
experiment from the
cDNA construct isolated from a second bacterial
clone was used. Again,
two groups consisting of three animals
were used. Since the animals
were younger (ca. 20 kg [body weight])
than those in the first
experiment, 5 × 10
4 TCID
50 of virus were
used for infection this time. Again, the
animals infected with the
mutant showed no clinical signs. Two
animals had fever for one day
(pigs 43 and 47; Fig.
7). One of
these
animals also showed viremia after 1 day, whereas in the
blood of the
other two animals virus could not be detected (Table
3). Nevertheless, these animals developed
neutralizing antibodies
(Table
4) and
were protected against a lethal CSFV challenge.
Challenge was again
performed by infection with a 2 × 10
5
TCID
50 of challenge strain Eystrup. The animals did not
show
clinical signs after challenge, and the temperature remained
normal
(not shown). In contrast to the pigs infected with the deletion
mutant, the animals inoculated with the rescued wild-type virus
had
fever (Fig.
7) and developed fatal CSF. One animal had to
be killed 11 days after infection; the other two were killed 3
days later. All
animals showed typical pathological signs of CSF,
such as hemorrhages
in different organs (not shown). The blood
of the animals was found to
contain virus on all days tested (Table
3).
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7.
Body temperature curves of animals infected with
C-346-d/Rs, the virus recovered from the infectious cDNA clone in which
the deletion present in C-346-d had been removed (solid lines) or the
original mutant C-346-d (broken lines).
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Detection of CSFV in the blood of animals infected
with C-346-d/Rs (animals 27, 28, and 30) or C-346-d (animals 43, 47, and 87) at the indicated time pointsa
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Determination of neutralization titers of serum samples
obtained from animals infected with C-346-d/Rs (animals 27, 28, and 30)
or C-346-d (animals 43, 47, and 87) at the indicated
time pointsa
|
|
Animal experiments with viruses exhibiting point mutations.
The results of the animal experiments showed that the deletion of codon
346 in mutant C-346-d apparently does not prevent virus replication in
its natural host but has a major attenuating effect on CSFV. It was
tempting to speculate that the drastically reduced virulence of the
mutant could be due to the destruction of the RNase activity residing
in Erns. However, other effects of the mutation on
functions of Erns, i.e., by its probable influence on
protein structure, could not be excluded. We therefore performed
similar animal experiments with four other RNase-negative viruses,
namely, the point mutants C-297-L, C-297-K, and C-346-L and the double
mutant C-297-L/346-L. The animals infected with C-346-L or
C-297-L/346-L did not show clinical signs of CSF. They had no fever,
except for one animal of the group infected with the double mutant that
developed fever due to injury on the hind leg; the body temperature of
this animal returned to normal values after treatment with an
antibiotic (Fig. 8A and B). All animals
infected with the double mutant and one animal
inoculated with C-346-L showed transient viremia for 1 day. Productive
infection of all animals could be demonstrated by the development of
neutralizing antibodies (not shown).
View larger version (57K):
[in this window]
[in a new window]
|
FIG. 8.
Body temperature curves of animals infected with CSFV
mutants C-346-L (A), C-297-L/346-L (B), C-297-L (C), or C-297-K (D).
|
|
The members of the other two groups infected with viruses containing
only mutations in their genomes that affected codon 297
all developed
symptoms of disease. The pigs showed fever over
a period of up to 5 days (Fig.
8C and D) and also anorexia, apathia,
and diarrhea for 1 to
3 days. However, in contrast to the pathology
after wild-type virus
infection, these animals completely recovered.
Their body temperature
returned to normal values at around days
9 to 11, and also the other
clinical symptoms vanished during
the observation
period.
Immunological analyses.
The data presented above strongly
indicate that the RNase activity residing in glycoprotein
Erns of CSFV plays a central role in the pathogenesis of
CSF in swine. After identification of the enzymatic activity of
Erns, it has been speculated that the RNase might be
important for the virus in its interaction with the immune system of
the host (3, 9, 10, 28). A characteristic feature of CSF in
swine is a dramatic decrease of B cells early after infection
(30). To look at whether destruction of RNase activity has
an influence on the reduction of the number of B lymphocytes, the
percentage of B lymphocytes compared to the percentage of myeloid cells
in peripheral blood mononuclear cells (PBMC) was studied during the course of infection by using two-color FCM analyses.
Parallel to the increase of the body temperature (Fig.
7), animals
infected with the wild-type-like virus mutant C-346-d/Rs
(animals 27, 28, and 30) showed a severe decrease of CD21-positive
B lymphocytes.
For 7 days after infection the percentages of CD21-positive
B
lymphocytes dropped to less than 10% of the PBMC population
(pig 27;
34% prior infection to 8%; pig 28, 31 to 7%; pig 30,
20 to 5%)
(Fig.
9).
View larger version (12K):
[in this window]
[in a new window]
|
FIG. 9.
Percentage of CD21-positive B lymphocytes in the PBMC of
animals infected with virus mutants. Swine infected with the original
mutant (C-346-d) are indicated by broken lines. The group of animals
infected with the virus recovered from the infectious cDNA clone, in
which the deletion had been removed (C-346-d/Rs), is indicated by solid
lines. The percentage of CD21-positive B lymphocytes was determined as
described in Materials and Methods.
|
|
In contrast, animals infected with the RNase-inactivated virus mutant
C-346-d (animals 43, 47, and 87) showed no influence
of the virus
infection on the composition of their PBMC population
(Fig.
9). Neither
a reduction in the absolute number of PBMC (data
not shown) nor in the
percentage of CD21-positive B lymphocytes
could be detected for up to
46 days after
infection.
| |
DISCUSSION |
Among members of the family Flaviviridae, pestiviruses
are unique because of the expression of two peculiar proteins with enzymatic activity. One of these proteins is the protease
Npro. Although Npro is somewhat reminiscent of
the leader proteases found in several other viruses, there is still no
indication for a function of this polypeptide. Studies with an
infectious cDNA of CSFV Alfort187 showed that the Npro gene
can be deleted without major effects on virus viability (34). The second unique pestivirus protein is
Erns, a glycoprotein exhibiting RNase activity.
Erns is essential for virus propagation; attempts to grow a
CSFV mutant, from which the complete Erns gene had been
deleted, failed (17). This result was not surprising since
Erns represents a structural component of the pestivirus
particle and a target for virus-neutralizing antibodies. However,
destruction of the enzymatic activity of Erns in a CSFV
vaccine strain was found to have no impact on virus viability in tissue
culture (10). To analyze the effects of mutations abrogating
RNase activity after infection of the natural host, we introduced a
variety of mutations into the Erns gene of CSFV
Alfort/Tübingen. All of these mutations affected either codon 297 or codon 346 of the long ORF in the viral genome that both are
conserved between the pestivirus proteins and several other known
RNases and have been proposed to be involved in the catalytic reaction
(28). Analyses of the functional effects of the different
mutations are dependent on a test system for the enzymatic activity of
Erns. Such tests have either been conducted with
Erns purified after CSFV infection or baculovirus-based
expression or protein enriched by specific interaction with a MAb
directed against Erns (9, 10, 28, 40). We
present here a new test that allows determination of Erns
activity in crude cell extracts without further purification of the
protein. Since RNases are common cellular enzymes, such a test could
not be expected to work without any background problems. However, all
control experiments clearly proved the specificity of the assay. This
conclusion is based on the facts that RNA degradation occurs in a time-
and concentration-dependent manner, that positive results are dependent
on the presence of Erns within the cells, and that RNA
degradation can be specifically blocked with antibodies directed
against Erns. The observed specificity of the test may be
explained by the large quantity of Erns in comparison to
cellular RNases. However, time course experiments did not indicate the
presence of low levels of RNase activity in cell extracts that did not
contain functional Erns. It might be that the use of
Poly(U) as a substrate is at least in part responsible for the
specificity since this homopolymeric RNA could be an inappropriate
substrate for cellular RNases, even though bovine RNase A proved to be
able to degrade Poly(U) in the control experiments.
As expected, the RNase activity was completely destroyed by all the
changes tested in the present study. A critical question was whether
all mutations would allow the recovery of viable viruses after
introduction into the infectious CSFV cDNA clone. The sequences flanking the two histidine residues in Erns are conserved
among pestiviruses, and it is of course possible that this conservation
is not only due to the preservation of the active center of the RNase
but is also essential for other important functions of this protein.
Therefore, Hulst et al. (10) decided to substitute in their
experiments the histidine residues for lysine to conserve the basic
character at the respective positions in order to minimize putative
effects on the protein structure, and this resulted in viable viruses
growing as well as wild-type virus. We show here that both histidine
residues can also be replaced by the hydrophobic residue leucine
without obvious effects on virus propagation in tissue culture. Even
after deletion of codon 346, a virus was recovered that grew as well as
the wild-type virus. No indication for changes restoring the RNase
activity or altering the introduced mutations or flanking sequences
could be identified. Thus, the inactivation of the RNase and the
putative changes with regard to other hypothetical vital
Erns functions are obviously without significant effects on
virus replication in tissue culture.
In contrast, a viable virus could not be recovered after deletion of
codon 297 showing that residue 297 of the polyprotein is important for
an essential Erns function that is independent of the RNase activity.
It has been reported that after inactivation of the RNase of a CSFV
vaccine strain by exchanging one of the putative active-site histidine
residues against lysine the recovered virus mutants exhibited a
cytopathogenic phenotype in tissue culture (10). We did not
find any indication for cytopathogenicity after infection with one of
our CSFV mutants. Since we also analyzed mutants containing lysine
instead of histidine, the different results cannot be due to the nature
of the introduced mutations. However, both the parental viruses and the
cells used for virus propagation were different, and thus the observed
discrepancy can be due to either one of these parameters or the
cell/virus interaction as a complex system. Further analyses are
necessary to find out the reason(s) for these different observations.
The main purpose of our study was to investigate the effects of
mutations abrogating the RNase activity of Erns after
infection of the natural host. To get the most clearcut results, we
first analyzed the mutant with the deletion of codon 346, for which the
danger of obtaining revertants in the animals is low. This virus mutant
was found to be completely apathogenic, whereas the pigs infected with
the wild-type virus developed fatal CSF. Further experiments with
several other virus variants showed that all of the tested mutations
inactivating the RNase residing in Erns had an attenuating
effect. However, the degree of attenuation varied with the residue
affected by the mutations. All viruses showing changes at position 346 did not induce clinical symptoms. In contrast, piglets infected with
mutants with changes affecting only codon 297 showed typical symptoms
of disease. However, the animals recovered very quickly by around day 9 to 11, the time point at which animals infected with the wild-type
virus usually enter an irreversible critical stage of the disease. The
fact that the mutants with changes of codon 346 exhibit a higher degree of attenuation indicates that the respective changes do not only affect
the RNase activity of Erns but have additional effects on a
function of this protein that is important for pathogenesis but not for
replication in tissue culture. It is difficult to speculate about the
reason for this finding. There seems to be a tendency toward reduced
spread in the animals of viruses containing changes at codon 346 of the genome since for these mutants it was difficult or even impossible to
reisolate virus from the blood. This might simply point at less-effective replication in the animal, resulting in a lower virus
load in the circulation, or it could be the result of important differences such as an interference of the mutation with the ability to
infect specific cell types involved in virus distribution. It is,
however, very likely that infection of cells and virus replication have
occurred also with these mutants, since all of the infected animals
developed protective immunity, as demonstrated by the challenge
experiments. In conclusion, the results of the animal experiments
indicate that inactivation of the RNase activity of Erns
leads to attenuation of CSFV and, due to additional effects of mutations at position 346, the degree of attenuation is higher for
variants containing changes at this position. There is still a
theoretical chance that it is not the inactivation of the RNase but
unidentified side effects of the mutations that are responsible for the
attenuation of the tested virus mutants. The sequences flanking the
putative active side residues of the enzyme are highly conserved among
pestiviruses, and it is rather clear that this conservation is not only
necessary to preserve the RNase activity but also important for
additional functions of the structural protein Erns. It
therefore should be kept in mind that the causative relationship between inactivation of RNase activity and the observed attenuation of
the viruses has not been formally proven and will be very difficult to
prove. However, it seems very unlikely that a variety of different mutations at different positions of the Erns protein that
destroy the RNase activity all result in attenuation and that this
effect should be independent of the inactivation of the enzymatic activity.
The mutations introduced into the Erns gene seem to be
stable not only in tissue culture but also in animus. Analyses of
viruses reisolated from the blood of the infected animals did not
result in any indications for the presence of revertants. It therefore can be concluded that RNase-negative mutants of CSFV are able to
replicate and spread in the natural host. Based on these results, it
seems unlikely that the temporary symptoms of disease observed after
infection with mutants C-297-L or C-297-K are due to revertants. This
conclusion is also based on the fact that, in comparison to infections
with wild-type virus, there was no delay in the time point at which
fever and clinical symptoms were first observed. If these symptoms were
dependent on the generation of virus revertants, a delay would be
expected, since some time has to pass to allow the introduction of the
necessary mutations. The observation that fever and other clinical
symptoms start at the usual time point after infection with C-297-L or
C-297-K can also shed some light on the putative mechanism of
attenuation of these mutants. Attenuation is due to a faster recovery
of the animals rather than to a delayed or strongly ameliorated
development of pathological signs. The beginning of the recovery was
obvious by days 9 to 11. It has been reported that neutralizing
antibodies can first be demonstrated at this time point (days 10 to 12 [32]). It has already been speculated that the RNase
function of Erns could be involved in the strategy of
pestiviruses to interact with the host immune system (3, 9, 10,
28). Erns is secreted from the infected cells and can
be found in the serum of infected animals in considerable amounts. It
could be that this protein represents at least one of the factors
responsible for the severe reduction or even depletion of lymphocytes,
especially B cells, observed during CSFV infection, which hardly can be
solely due to the destruction of virus-infected cells. This putative role of Erns could be facilitated by its nature as a
secreted protein circulating in the blood of the infected animal. Other
RNases are known to exert cytotoxic activities and can have antitumor
and immunomodulatory effects (2, 4, 5, 41). Experiments with
purified Erns of CSFV indicated that it can induce
apoptosis upon addition to lymphocytes of different species
(3). Thus, it might be that the RNase activity of the
secreted Erns is responsible for the specific decrease of
B-cell numbers in the infected animals that probably represents one of
the factors leading to virus-induced immunosuppression. The proposed
attenuating effect resulting from inactivation of the RNase would then
be due to abrogation of B-cell decrease and a faster development of a
protective immune response. Our experiments with the mutant C-346-d
indeed show that the reduction of B-cell numbers does not occur in
animals infected with this variant. Of course, this result does not
prove that inactivation of the RNase caused the observed effect, but it
fits very well with the working hypothesis outlined above. Further
experiments with the other RNase-negative mutants will be conducted in
order to analyze this question in more detail.
| |
ACKNOWLEDGMENTS |
We thank Silke Esslinger, Petra Wulle, Angelika Braun, and Gaby
Kuebart for excellent technical assistance.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Federal Research
Centre for Virus Diseases of Animals, P.O. Box 1149, D-72001
Tübingen, Germany. Phone: 49-7071-967207. Fax:
49-7071-967303. E-mail:
gregor.meyers{at}tue.bfav.de.
| |
REFERENCES |
| 1.
|
Baker, J. C.
1987.
Bovine viral diarrhea virus: a review.
J. Am. Vet. Med. Assoc.
190:1449-1458[Medline].
|
| 2.
|
Benner, S. A., and R. K. Allemann.
1989.
The return of pancreatic ribonucleases.
Trends Biochem. Sci.
14:396-397[Medline].
|
| 3.
|
Bruschke, C. J. M.,
M. M. Hulst,
R. J. M. Moormann,
P. A. van Rijn, and J. T. van Oirschot.
1997.
Glycoprotein Erns of pestiviruses induces apoptosis in lymphocytes of several species.
J. Virol.
71:6692-6696[Abstract].
|
| 4.
|
D'Alessio, G.
1993.
New and cryptic biological messages from RNases.
Trends Cell Biol.
3:106-109.
[Medline] |
| 5.
|
D'Alessio, G.,
A. Di Donato,
A. Parente, and R. Picoli.
1991.
Seminal RNase: a unique member of the ribonuclease superfamily.
Trends Biochem. Sci.
16:104-106[Medline].
|
| 6.
|
Denham, S.,
R. J. Zwart,
J. T. D. Whittall,
M. Pambusch,
A. H. Ccorteyn,
A. T. J. Bianchi,
M. P. Murtaugh,
R. M. E. Parkhouse,
H. Tlaskalova,
J. Sinkora,
M. Sinkora, and Z. Rehakova.
1998.
Monoclonal antibodies putatively identifying porcine B cells.
Vet. Immunol. Immunopathol.
60:317-328[Medline].
|
| 7.
|
Donis, R. O.,
W. Corapi, and E. J. Dubovi.
1988.
Neutralizing monoclonal antibodies to bovine viral diarrhea virus bind to the 56K to 58K glycoprotein.
J. Gen. Virol.
69:77-86[Abstract/Free Full Text].
|
| 8.
|
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126[Abstract/Free Full Text].
|
| 9.
|
Hulst, M. M.,
G. Himes,
E. Newbigin, and R. J. M. Moormann.
1994.
Glycoprotein E2 of classical swine fever virus: expression in insect cells and identification as a ribonuclease.
Virology
200:558-565[Medline].
|
| 10.
|
Hulst, M. M.,
F. E. Panoto,
A. Hooekmann,
H. G. P. van Gennip, and R. J. M. Moormann.
1998.
Inactivation of the RNase activity of glycoprotein Erns of classical swine fever virus results in a cytopathogenic virus.
J. Virol.
72:151-157[Abstract/Free Full Text].
|
| 11.
|
Kessler, S. W.
1981.
Use of protein A-bearing staphylococci for the immunoprecipitation and isolation of antigens from cells.
Methods Enzymol.
73:442-459[Medline].
|
| 12.
|
König, M.
1994.
Virus der klassischen Schweinepest: Untersuchungen zur Pathogenese und zur Induktion einer protektiven Immunantwort. Ph.D. thesis.
Veterinary School of Hannover, Hannover, Germany
|
| 13.
|
Kunkel, T. A.,
J. D. Roberts, and R. A. Zakour.
1987.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Methods Enzymol.
154:367-392[Medline].
|
| 14.
|
Meyers, G.,
T. Rümenapf, and H.-J. Thiel.
1989.
Molecular cloning and nucleotide sequence of the genome of hog cholera virus.
Virology
171:555-567[Medline].
|
| 15.
|
Meyers, G.,
N. Tautz,
P. Becher,
H.-J. Thiel, and B. M. Kümmerer.
1996.
Recovery of cytopathogenic and noncytopathogenic bovine viral diarrhea viruses from cDNA constructs.
J. Virol.
70:8606-8613[Abstract].
|
| 16.
|
Meyers, G.,
H.-J. Thiel, and T. Rümenapf.
1996.
Classical swine fever virus: recovery of infectious viruses from cDNA constructs and generation of recombinant cytopathogenic swine fever virus.
J. Virol.
67:7088-7095[Abstract/Free Full Text].
|
| 17.
| Meyers, G. Unpublished results.
|
| 18.
|
Moennig, V., and J. Plagemann.
1992.
The pestiviruses.
Adv. Virus Res.
41:53-91[Medline].
|
| 19.
|
Paton, D. J.,
J. P. Lowings, and A. D. Barrett.
1992.
Epitope mapping of the gp53 envelope protein of bovine viral diarrhea virus.
Virology
190:763-772[Medline].
|
| 20.
|
Pesvovitz, M. D.,
J. K. Lunney, and D. H. Sachs.
1984.
Preparation and characterization of monoclonal antibodies reactive with porcine PBL.
J. Immunol.
133:368-375[Abstract].
|
| 21.
|
Rice, C. M.
1996.
Flaviviridae: the viruses and their replication, p. 931-959.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology. Lippincott-Raven, Philadelphia, Pa
|
| 22.
|
Rümenapf, T.,
G. Meyers,
R. Stark, and H.-J. Thiel.
1989.
Hog cholera virus characterization of specific antiserum and identification of cDNA clones.
Virology
171:18-27[Medline].
|
| 23.
|
Rümenapf, T.,
G. Unger,
J. H. Strauss, and H.-J. Thiel.
1993.
Processing of the envelope glycoproteins of pestiviruses.
J. Virol.
67:3288-3294[Abstract/Free Full Text].
|
| 24.
|
Saalmüller, A.,
W. Hirt,
S. Maurer, and E. Weiland.
1994.
Discrimination between two subsets of porcine CD8+ cytolytic T lymphocytes by the expression of CD5 antigen.
Immunology
81:578-583[Medline].
|
| 25.
|
Saalmüller, A.,
M. J. Reddehase,
H.-J. Bühring,
S. Jonjic, and U. H. Kozinowski.
1987.
Simultaneous expression of CD4 and CD8 antigens by a substantial proportion of resting porcine T lymphocytes.
Eur. J. Immunol.
17:1297-1301[Medline].
|
| 26.
| Saalmüller, A. Unpublished results.
|
| 27.
|
Sambrook, S.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 28.
|
Schneider, R.,
G. Unger,
R. Stark,
E. Schneider-Scherzer, and H.-J. Thiel.
1993.
Identification of a structural glycoprotein of an RNA virus as a ribonuclease.
Science
261:1169-1171[Abstract/Free Full Text].
|
| 29.
|
Sopp, P.,
L. Redknap, and C. Howard.
1998.
Cross-reactivity of human leucocyte differentiation antigen monoclonal antibodies on porcine cells.
Vet. Immunol. Immunopathol.
60:403-408[Medline].
|
| 30.
|
Susa, M.,
M. König,
A. Saalmüller,
M. J. Reddehase, and H. J. Thiel.
1992.
Pathogenesis of classical swine fever: B-lymphocyte deficiency caused by hog cholera virus.
J. Virol.
66:1171-1175[Abstract/Free Full Text].
|
| 31.
|
Tautz, N.,
H.-J. Thiel,
E. Dubovi, and G. Meyers.
1994.
Pathogenesis of mucosal disease: a cytopathogenic pestivirus generated by an internal deletion.
J. Virol.
68:3289-3297[Abstract/Free Full Text].
|
| 32.
|
Thiel, H.-J.,
G. W. Plagemann, and V. Moennig.
1996.
The pestiviruses, p. 1059-1073.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology. Lippincott-Raven, Philadelphia, Pa
|
| 33.
|
Thiel, H.-J.,
R. Stark,
E. Weiland,
T. Rümenapf, and G. Meyers.
1991.
Hog cholera virus: molecular composition of virions from a pestivirus.
J. Virol.
65:4705-4712[Abstract/Free Full Text].
|
| 34.
|
Tratschin, J. D.,
C. Moser,
N. Ruggli, and M. A. Hofmann.
1998.
Classical swine fever virus leader proteinase Npro is not required for viral replication in cell culture.
J. Virol.
72:7681-7684[Abstract/Free Full Text].
|
| 35.
|
Van der Werf, S.,
J. Bradley,
E. Wimmer,
F. W. Studier, and J. J. Dunn.
1986.
Synthesis of infectious poliovirus RNA by purified T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:2330-2334[Abstract/Free Full Text].
|
| 36.
|
van Rijn, P. A.,
H. G. van Gennip,
E. J. de Meijer, and R. J. Moormann.
1993.
Epitope mapping of envelope glycoprotein E1 of hog cholera virus strain Brescia.
J. Gen. Virol.
74:2053-2060[Abstract/Free Full Text].
|
| 37.
|
Weiland, E.,
R. Ahl,
R. Stark,
F. Weiland, and H.-J. Thiel.
1992.
A second envelope glycoprotein mediates neutralization of a pestivirus, hog cholera virus.
J. Virol.
66:3677-3682[Abstract/Free Full Text].
|
| 38.
|
Weiland, E.,
R. Stark,
B. Haas,
T. Rümenapf,
G. Meyers, and H.-J. Thiel.
1990.
Pestivirus glycoprotein which induces neutralizing antibodies forms part of a disulfide-linked heterodimer.
J. Virol.
64:3563-3569[Abstract/Free Full Text].
|
| 39.
|
Weiland, E.,
H.-J. Thiel,
G. Hess, and F. Weiland.
1989.
Development of monoclonal neutralizing antibodies against bovine viral diarrhea virus after pretreatment of mice with normal bovine cells and cyclophosphamide.
J. Virol. Methods
24:237-244[Medline].
|
| 40.
|
Windisch, J. M.,
R. Schneider,
R. Stark,
E. Weiland,
G. Meyers, and H.-J. Thiel.
1996.
RNase of classical swine fever virus: biochemical characterization and inhibition by virus-neutralizing monoclonal antibodies.
J. Virol.
70:352-358[Abstract].
|
| 41.
|
Wu, Y. N.,
S. M. Mikulski,
W. Ardelt,
S. M. Rybak, and R. J. Youle.
1993.
A cytotoxic ribonuclease.
J. Biol. Chem.
268:10686-10693[Abstract/Free Full Text].
|
Journal of Virology, December 1999, p. 10224-10235, Vol. 73, No. 12
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shi, Z., Sun, J., Guo, H., Tu, C.
(2009). Genomic expression profiling of peripheral blood leukocytes of pigs infected with highly virulent classical swine fever virus strain Shimen. J. Gen. Virol.
90: 1670-1680
[Abstract]
[Full Text]
-
Tews, B. A., Schurmann, E.-M., Meyers, G.
(2009). Mutation of Cysteine 171 of Pestivirus Erns RNase Prevents Homodimer Formation and Leads to Attenuation of Classical Swine Fever Virus. J. Virol.
83: 4823-4834
[Abstract]
[Full Text]
-
Gallei, A., Blome, S., Gilgenbach, S., Tautz, N., Moennig, V., Becher, P.
(2008). Cytopathogenicity of Classical Swine Fever Virus Correlates with Attenuation in the Natural Host. J. Virol.
82: 9717-9729
[Abstract]
[Full Text]
-
Tews, B. A., Meyers, G.
(2007). The Pestivirus Glycoprotein Erns Is Anchored in Plane in the Membrane via an Amphipathic Helix. J. Biol. Chem.
282: 32730-32741
[Abstract]
[Full Text]
-
Meyers, G., Ege, A., Fetzer, C., von Freyburg, M., Elbers, K., Carr, V., Prentice, H., Charleston, B., Schurmann, E.-M.
(2007). Bovine Viral Diarrhea Virus: Prevention of Persistent Fetal Infection by a Combination of Two Mutations Affecting Erns RNase and Npro Protease. J. Virol.
81: 3327-3338
[Abstract]
[Full Text]
-
Risatti, G. R., Holinka, L. G., Fernandez Sainz, I., Carrillo, C., Lu, Z., Borca, M. V.
(2007). N-Linked Glycosylation Status of Classical Swine Fever Virus Strain Brescia E2 Glycoprotein Influences Virulence in Swine. J. Virol.
81: 924-933
[Abstract]
[Full Text]
-
Graham, R. L., Sims, A. C., Brockway, S. M., Baric, R. S., Denison, M. R.
(2005). The nsp2 Replicase Proteins of Murine Hepatitis Virus and Severe Acute Respiratory Syndrome Coronavirus Are Dispensable for Viral Replication. J. Virol.
79: 13399-13411
[Abstract]
[Full Text]
-
Fetzer, C., Tews, B. A., Meyers, G.
(2005). The Carboxy-Terminal Sequence of the Pestivirus Glycoprotein Erns Represents an Unusual Type of Membrane Anchor. J. Virol.
79: 11901-11913
[Abstract]
[Full Text]
-
Risatti, G. R., Borca, M. V., Kutish, G. F., Lu, Z., Holinka, L. G., French, R. A., Tulman, E. R., Rock, D. L.
(2005). The E2 Glycoprotein of Classical Swine Fever Virus Is a Virulence Determinant in Swine. J. Virol.
79: 3787-3796
[Abstract]
[Full Text]
-
Gallei, A., Rumenapf, T., Thiel, H.-J., Becher, P.
(2005). Characterization of Helper Virus-Independent Cytopathogenic Classical Swine Fever Virus Generated by an In Vivo RNA Recombination System. J. Virol.
79: 2440-2448
[Abstract]
[Full Text]
-
Lin, M., Trottier, E., Pasick, J.
(2005). Antibody Responses of Pigs to Defined Erns Fragments after Infection with Classical Swine Fever Virus. CVI
12: 180-186
[Abstract]
[Full Text]
-
Lin, M., Trottier, E., Pasick, J., Sabara, M.
(2004). Identification of Antigenic Regions of the Erns Protein for Pig Antibodies Elicited during Classical Swine Fever Virus Infection. J Biochem
136: 795-804
[Abstract]
[Full Text]
-
van Gennip, H. G. P., Vlot, A. C., Hulst, M. M., de Smit, A. J., Moormann, R. J. M.
(2004). Determinants of Virulence of Classical Swine Fever Virus Strain Brescia. J. Virol.
78: 8812-8823
[Abstract]
[Full Text]
-
von Freyburg, M., Ege, A., Saalmuller, A., Meyers, G.
(2004). Comparison of the effects of RNase-negative and wild-type classical swine fever virus on peripheral blood cells of infected pigs. J. Gen. Virol.
85: 1899-1908
[Abstract]
[Full Text]
-
Hausmann, Y., Roman-Sosa, G., Thiel, H.-J., Rumenapf, T.
(2004). Classical Swine Fever Virus Glycoprotein Erns Is an Endoribonuclease with an Unusual Base Specificity. J. Virol.
78: 5507-5512
[Abstract]
[Full Text]
-
Iqbal, M., Poole, E., Goodbourn, S., McCauley, J. W.
(2004). Role for Bovine Viral Diarrhea Virus Erns Glycoprotein in the Control of Activation of Beta Interferon by Double-Stranded RNA. J. Virol.
78: 136-145
[Abstract]
[Full Text]
-
Langedijk, J. P. M., van Veelen, P. A., Schaaper, W. M. M., de Ru, A. H., Meloen, R. H., Hulst, M. M.
(2002). A Structural Model of Pestivirus Erns Based on Disulfide Bond Connectivity and Homology Modeling Reveals an Extremely Rare Vicinal Disulfide. J. Virol.
76: 10383-10392
[Abstract]
[Full Text]
-
Iqbal, M., McCauley, J. W.
(2002). Identification of the glycosaminoglycan-binding site on the glycoprotein Erns of bovine viral diarrhoea virus by site-directed mutagenesis. J. Gen. Virol.
83: 2153-2159
[Abstract]
[Full Text]
-
Meyer, C., von Freyburg, M., Elbers, K., Meyers, G.
(2002). Recovery of Virulent and RNase-Negative Attenuated Type 2 Bovine Viral Diarrhea Viruses from Infectious cDNA Clones. J. Virol.
76: 8494-8503
[Abstract]
[Full Text]
-
Hay, S., Kannourakis, G.
(2002). A time to kill: viral manipulation of the cell death program. J. Gen. Virol.
83: 1547-1564
[Abstract]
[Full Text]
-
Hulst, M. M., van Gennip, H. G. P., Vlot, A. C., Schooten, E., de Smit, A. J., Moormann, R. J. M.
(2001). Interaction of Classical Swine Fever Virus with Membrane-Associated Heparan Sulfate: Role for Virus Replication In Vivo and Virulence. J. Virol.
75: 9585-9595
[Abstract]
[Full Text]
-
Hulst, M. M., van Gennip, H. G. P., Moormann, R. J. M.
(2000). Passage of Classical Swine Fever Virus in Cultured Swine Kidney Cells Selects Virus Variants That Bind to Heparan Sulfate due to a Single Amino Acid Change in Envelope Protein Erns. J. Virol.
74: 9553-9561
[Abstract]
[Full Text]
Top
Abstract
Introduction
