Previous Article | Next Article 
Journal of Virology, December 1999, p. 10183-10190, Vol. 73, No. 12
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Induction of Endogenous Genes following Infection
of Human Endothelial Cells with an E1
E4+
Adenovirus Gene Transfer Vector
Ramachandran
Ramalingam,1
Shahin
Rafii,2
Stefan
Worgall,1
Neil R.
Hackett,1 and
Ronald
G.
Crystal1,*
Division of Pulmonary and Critical Care
Medicine1 and Division of
Hematology-Oncology,2 Weill Medical College of
Cornell University
New York Presbyterian Hospital, New York, New York
10021
Received 25 May 1999/Accepted 27 August 1999
 |
ABSTRACT |
Recombinant adenovirus (Ad) gene transfer vectors are effective at
transferring exogenous genes to a variety of cells and tissue types
both in vitro and in vivo. However, in the process of gene transfer,
the Ad vectors induce the expression of target cell genes, some of
which may modify the function of the target cell and/or alter the local
milieu. To develop a broader understanding of Ad vector-mediated
induction of endogenous gene expression, genes induced by
first-generation E1
E4+ Ad vectors in primary
human umbilical vein endothelial cells were identified by cDNA
subtraction cloning. The identified cDNAs included signaling molecules
(lymphoid blast crisis [LBC], guanine nucleotide binding protein 
type S [G-S], and mitogen kinase [MEK5]),
calcium-regulated/cytoskeletal proteins (calpactin p11 and p36
subunits, vinculin, and spinocerebellar ataxia [SCA1]), growth
factors (insulin-like growth factor binding protein 4 and transforming
growth factor 
2), glyceraldehyde-6-phosphate dehydrogenase, an
expressed sequence tag, and a novel cDNA showing homology to a LIM
domain sequence. Two- to sevenfold induction of the endogenous gene
expression was observed at 24 h postinfection, and induction continued up to 72 h, although the timing of gene expression
varied among the identified genes. In contrast to that observed in
endothelial cells, the Ad vector-mediated induction of gene expression
was not found following Ad vector infection of primary human dermal fibroblasts or human alveolar macrophages. Empty Ad capsids did not
induce endogenous gene expression in endothelial cells. Interestingly, additional deletion of the E4 gene obviated the upregulation of genes
in endothelial cells by the E1 E3 Ad
vector, suggesting that genes carried by the E4 region play a central
role in modifying target cell gene expression. These findings are
consistent with the notion that efficient transfer of exogenous genes
to endothelial cells by first-generation Ad vectors comes with the
price that these vectors also induce the expression of a variety of
cellular genes.
| |
INTRODUCTION |
E1 subgroup C
adenovirus (Ad) gene transfer vectors are being used extensively to
transfer and express genes in a variety of in vitro and in vivo cell
targets (1, 15, 74, 78, 81). While these vectors are
remarkably efficient at transferring the exogenous gene to the target
cell nucleus, and while there is usually robust expression of the
transferred gene, the interaction of the vector with the cell may also
modify the gene expression of the target cell (12, 51, 55,
61); i.e., while the purpose of using E1 Ad vectors
is to modify the genetic repertoire of the target cell, the vector per
se may modify the expression of the endogenous genes of the target. In
this regard, in vitro studies with a variety of cell lines show that Ad
vectors can induce the target cell to express cytokine genes, prolong
or reduce cell survival, and activate intracellular signaling pathways
(8, 12, 51, 64, 82).
To begin to develop a broader understanding of the interaction of Ad
vectors with target cells, we have used cDNA subtraction analysis to
evaluate the cellular genes evoked by the interaction of an
E1 Ad vector with human umbilical vein endothelial cells
(HUVEC). We chose human endothelial cells as the target cells following studies demonstrating that infection of human endothelial cells with
E1 E4+ Ad vectors (deleted in E1 sequences
but retaining E4 sequences) markedly prolongs the survival of
endothelial cells in culture, even in the absence of serum
(64). The present study demonstrates that infection of
endothelial cells with an E1 E4+ AdNull
vector, containing an expression cassette with a cytomegalovirus (CMV)
early-intermediate promoter-enhancer but no transgene, induces the
expression of a variety of endogenous endothelial cell genes, including
those coding for intracellular signaling proteins, calcium-regulated and cytoskeletal proteins, growth-regulating proteins, a housekeeping protein, a known expressed sequenced tag (EST), and a novel cDNA. Interestingly, removal of E4 gene sequences from the Ad vector eliminates the Ad modulation of gene expression in endothelial cells,
suggesting that one or more E4 gene products play a role in how the Ad
vector modifies the expression of genes endogenous to the target cells.
| |
MATERIALS AND METHODS |
Cell culture.
Primary HUVEC were isolated from freshly
obtained umbilical cords by collagenase treatment (40) and
grown in endothelial cell growth medium (M199 medium containing 20%
fetal calf serum, 10 ng of vascular endothelial growth factor
[Peprotech, Piscataway, N.J.] per ml, 5 ng of basic fibroblast growth
factor [Peprotech] per ml, and 1 U of heparin sulfate [Sigma, St.
Louis, Mo.] per ml) at 37°C in a 5% CO2-humidified
incubator. Cells from passages 2 to 5 were used in all the experiments.
Primary human fibroblasts (HDF-1) were obtained from a skin biopsy
specimen from a normal volunteer and cultured in RPMI medium containing
10% fetal calf serum (76). Human alveolar macrophages (AM)
were obtained from normal volunteers by bronchoalveolar lavage
(68). The lavage fluid was filtered through gauze to remove
debris, and the cells were pelleted, washed with phosphate-buffered
saline (pH 7.4), and resuspended in RPMI 1640 medium containing 10%
fetal bovine serum, 2 mM glutamine, 100 U of penicillin per ml, and 10 µg of streptomycin per ml. The AM were then purified by adherence to plastic (2 h at 37°C).
Ad vectors.
The Ad vectors used in this study included
AdNull (E1 E3 E4+; CMV
early-immediate promoter-enhancer, no transgene in the expression cassette) (36), E4 Adgal (E1,
E3, E4; CMV promoter driving the
Escherichia coli -galactosidase (gal) gene) (7,
82), and E1 E4+ AdGFP (E1
E3 E4+; CMV promoter driving the modified
form of the Aeguora victoria green fluorescent protein
[GFP]) (28, 86). Ad vector stocks were purified by cesium
chloride centrifugation and dialysis and quantified by measurement of
PFU in 293 cells as previously described (32, 67). All Ad
vectors had a particle/PFU ratio of approximately 100, and all were
determined to be free of replication-competent Ad (16).
Clinical grade lipopolysaccharide- and endotoxin-free Ad stocks were
used for all the experiments. The optimal doses of Ad vector to express
genes in >90% of HUVEC, fibroblasts, and macrophages were determined
by using AdGFP vector and found to be a multiplicity of infection (MOI)
of 50 for HUVEC and fibroblasts and 200 for macrophages. These doses
were consistent with those in published reports (37, 42,
64).
Preparation of Ad empty capsids.
To prepare Ad devoid of the
Ad genome, crude viral lysate of E1 E4+
AdNull was prepared and purified by cesium chloride centrifugation as
described above (32, 67). The top band, containing empty capsids, was collected and purified once more by cesium chloride centrifugation, dialyzed, and stored at 
80°C. Spectrophotometric measurements (optical density at 280 nm) were used to calculate the
number of empty capsids in the preparation (32). A plaque assay on 293 cells demonstrated the preparation was not contaminated with the starting E1 E4+ AdNull vector.
cDNA subtraction library.
A suppressive subtraction
hybridization method was used (PCR-select cDNA subtraction [Clontech,
Palo Alto, Calif.]) (20) to isolate cDNAs that are
differentially expressed in HUVEC infected with the AdNull vector.
Briefly, HUVEC were infected with the AdNull vector at a MOI of 50 or
mock infected. After 48 h, poly(A) mRNA was isolated. Poly(A) mRNA
(2 µg) was converted to double-stranded cDNA, digested with
RsaI, and ligated to adapters. Control (driver) cDNAs and
AdNull-infected HUVEC (tester) cDNAs were hybridized at 68°C for
8 h. Fresh driver cDNA was added to the hybridization mixture to
enrich differentially expressed sequences. The subtracted cDNA library
was constructed by inserting PCR-amplified subtracted cDNA into the T/A
cloning vector (Invitrogen, San Diego, Calif.) and differentially
screened individually with [32P]dCTP-labeled tester and
driver cDNAs. Clones that hybridized strongly with the tester probe but
did not hybridize or weakly hybridized to driver probes were isolated
and sequenced. BLAST nucleotide homology searches of EST and GenBank
nonredundant nucleotide databases were used to help establish the
identity of the cDNAs.
Analysis of gene expression.
Gene expression of endothelial
cells induced by AdNull infection was analyzed by reverse
transcription-PCR (RT-PCR) and Northern analysis. Cultures of
endothelial cells were infected with AdNull (MOI of 50) for 90 min at
37°C or exposed to medium that did not contain Ad vector; they were
then washed to remove virus, and the culture was continued for 24 to
72 h. As controls, endothelial cells were exposed to Ad empty
capsids (5,000 particle units per cell) for 90 min at 37°C and
washed, and the incubation was continued for 48 h. For comparison
to the endothelial cells, fibroblasts and AM were infected with AdNull
(MOI of 50 and 200, respectively) for 90 min at 37°C, the cells were
washed, and the incubation was continued for 48 h.
RT-PCRs were used to screen gene expression pattern, and when induction
of gene expression was observed, it was confirmed by Northern analysis.
For RT-PCR, total RNA (200 ng/reaction) extracted from control or Ad
vector-infected cells (48 h postinfection) was reverse transcribed and
the resulting cDNA was amplified with gene-specific primers (9600 GeneAmp; Perkin-Elmer). The PCR conditions were 94°C for 30 s
(denaturing), 56°C for 1 min (annealing), and 68°C for 2 min
(elongation) for 30 cycles. Under these optimal PCR conditions, the
internal control glyceraldehyde-3-phosphate dehydrogenase (GAPDH; sense
primer, CCTTCATTGACCTCAACTACA; antisense primer,
GGCAGTGATGGCATGGCATGGACTGT) amplification was linear and did
not reach saturation. DNA contamination was ruled out by pretreatment of the samples with DNase (GIBCO BRL) for 15 min at 37°C and by omitting the reverse transcriptase from the PCR as a control.
For Northern analysis, total RNA was isolated with Trizol reagent
(Gibco BRL, Gaithersburg, Md.), and 10 µg of RNA was transferred
to
Duralon membranes (Stratagene, La Jolla, Calif.) after electrophoresis
through a 1% agarose gel under denaturing conditions. Probes were
prepared by using gel-purified cDNA fragments isolated from individual
clones and labeled with [
32P]dCTP by random priming
(Stratagene). Hybridizations were performed
in Quickhyb solution
(Stratagene) for 2 h at 65°C and were followed
by sequential
washes in 1× SSC (0.15 M sodium chloride, 0.015
M sodium
citrate)-0.1% sodium dodecyl sulfate for 30 min and in
0.1×SSC-0.1% sodium dodecyl sulfate for 30 min. Following
hybridization,
the membranes were analyzed by
autoradiography.
| |
RESULTS |
Isolation of differentially expressed cDNAs in endothelial
cells.
cDNAs of genes that were upregulated in the cells infected
with the E1 E4+ AdNull vector were isolated
by differential screening of the subtracted library. Of the 300 clones
screened, 30 clones were isolated that hybridized strongly to the total
cDNA probes derived from the E1 E4+ AdNull
vector-infected endothelial cells but did not hybridize or hybridized
weakly to total cDNA probes from control uninfected endothelial cells.
Of these, 10 cDNAs were identical to previously known sequences, one
was identical to a known EST, one was unique (GIA1, for "gene induced
by Ad vector") but showed a high homology to the
four-and-a-half-lim-only protein (FHL2) gene, and 16 contained sequences that were derived from the E1 E4+
AdNull vector (Table 1). Of the 12 cDNAs
selected for further study, all were represented by a single "hit,"
except for lymphoid blast crisis (LBC) cDNA, which was represented by
three independent clones containing different regions of the cDNA. The
12 cDNAs corresponding to known sequences were grouped based on their
known functions related to intracellular signaling, calcium-regulated cytoskeletal functions, growth regulation, and housekeeping functions.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Endothelial-cell cDNAs identified by subtraction analysis
and verification by subsequent mRNA analysis of endothelial cells
exposed to an E1 E4+
Ad vectora
|
|
To confirm that the different cDNAs were differentially expressed in
endothelial cells following infection with an E1
E4
+ Ad vector, levels of the mRNAs representing each gene
in uninfected
control endothelial cells were compared to those in cells
infected
with the E1
E4
+ AdNull vector.
RT-PCR analysis demonstrated that compared to
control uninfected cells,
the E1
E4
+ AdNull vector-infected cells had
an induction of expression of
LBC, guanine nucleotide binding protein
type S (G
-S) mitogen
kinase 5, (MEK5), calpactin subunits p11
and p36, vinculin, SCA1,
insulin-like growth factor binding protein
(IGFBP4), and transforming
growth factor
2 (TGF-
2), as well as
the EST
AA557947 and
the novel GIA1 gene (Fig.
1). The control GAPDH RNA levels were
similar in the control and E1
E4
+ Ad
vector-infected cells.
View larger version (53K):
[in this window]
[in a new window]
|
FIG. 1.
RT-PCR analysis of endothelial-cell gene expression
identified by a subtraction library as being upregulated by an
E1 E4+ Ad gene transfer vector. Total RNA
(200 ng/reaction) extracted from uninfected control cells (C) or cells
infected with E1 E4+ Ad vector (Ad) was used
as templates for RT-PCR analysis with gene-specific primers. GAPDH
primers were used to confirm RNA integrity and use of equal amounts of
RNA. Note that in most cases, there appears to be significant
upregulation of expression of the genes identified by the subtraction
library.
|
|
Effect of E1 E4+ Ad vector infection on
gene expression in other primary human cells.
To examine whether
the induction of endogenous gene expression by the E1
E4+ Ad vector was a general phenomenon or specific to
endothelial cells, primary human skin fibroblasts and alveolar
macrophages were infected with the E1 E4+
AdNull vector as for the endothelial cells and relative endogenous gene
expression was analyzed by RT-PCR. Infection of >90% of cells was
achieved with Ad vector at an MOI of 50 and 200 for fibroblasts and
macrophages, respectively. Interestingly, the levels of mRNA corresponding to genes that were observed to be upregulated in the
E1 E4+ AdNull vector-infected endothelial
cells were not modified in E1 E4+ AdNull
vector-infected skin fibroblasts (results not shown), similar to the
result observed by Zheng et al. (84) with an E1 E4+ Ad. Likewise, alveolar macrophages
infected with the E1 E4+ AdNull vector did
not demonstrate the upregulation of genes observed in the endothelial
cells (results not shown).
Kinetics of E1 E4+ Ad vector-induced
endothelial gene expression.
To further evaluate the
E1 E4+ Ad vector-induced modification of
endogenous endothelial cell gene expression, the kinetics of the genes
induced by the vector was evaluated by Northern analysis (Fig.
2). Induction of endogeneous gene
expression was first observed 24 h following Ad vector infection.
Earlier time points, including 0 h (right after the 90-min
infection period [results not shown]) or 6 h postinfection, did
not show any induction of gene expression, and the levels were similar
to those in uninfected control cells. Several patterns of induction of
mRNAs were observed. First, the increased expression of LBC (both 3.0- and 1.7-kb mRNA transcripts) was evident at 24 h postinfection,
remained elevated at 48 h, and was declining (but still elevated)
by 72 h (Fig. 2). The same pattern was true for the G-S, p11,
and p36 subunits of calpactin and EST AA557947. Second, a different
pattern was observed for TGF-2, with an increased expression of both
the 4.0- and 6.0-kb mRNA transcripts at 24 h that continued to
rise over the 72 h of observation. Finally, a third pattern of
expression induced by the AdNull vector was that seen for the novel
cDNA GIA1, where there was elevation of the small transcript (1.7 kb)
at 24 h, which then declined as the levels of a larger transcript
(2.3 kb) gradually rose over the 72 h of observation. Gene
expression in control cells remained unaltered (Fig. 2).
View larger version (89K):
[in this window]
[in a new window]
|
FIG. 2.
Northern analysis of kinetics of expression of
endogenous genes of human endothelial cells following infection by an
E1 E4+ Ad vector. (A) Control, uninfected
cells. Total RNA (10 µg/lane) was isolated from uninfected control
cells over time (6 to 72 h). Each lane was then hybridized to a
specific probe as indicated. Note that, other than the 4.0-kb
transcript of TGF-2, there is little change in the transcripts. (B)
Cells infected with an E1 E4+ Ad vector.
Total RNA was assessed as in panel A. In contrast to panel A, there are
marked changes in all transcripts other than GAPDH. The GAPDH probe was
used to confirm the integrity and equal loading of RNA.
|
|
Endothelial gene expression following addition of empty
capsids.
Successful infection of target cells by Ad vectors
requires initial interaction of the capsid with the cell surface
followed by internalization and transport of the vector DNA to host
cell nucleus (33, 42, 49, 74, 80). Since the initial binding of Ad vector capsids to the cell surface is sufficient to activate signal transduction pathways leading to induction of the interleukin-8 gene in HeLa cells (8), we evaluated the effect of empty Ad capsids devoid of vector DNA on endothelial cell gene expression, based
on the knowledge that empty capsids (noninfectious Ad particles) bind
to target cells in a fashion similar to that of intact, functional Ad
(17, 26). Levels of mRNAs corresponding to the subtracted cDNAs were evaluated by RT-PCR in control cells and cells treated with
empty capsids 48 h postinfection (data not shown). Compared to
control cells, mRNA levels changed very little, with minimal or no
increases in mRNA levels of LBC, G-S, MEK5, calpactin subunits p11
and p36, vinculin, SCA1, IGFBP4, and TGF-2. The control GAPDH RNA
levels also remained unaltered. Thus, elevated expression of the genes
represented by the subtracted cDNAs requires an intact Ad vector,
suggesting that Ad components other than just the surface capsid play a
role in the observed induction of host cell gene expression.
Requirement of the AdE4 gene for E1 Ad vector
induction of endogenous gene expression.
Based on the knowledge
that E1 E4+ Ad vectors express low levels of
E4 open reading frames (ORF) (2, 6, 30, 43, 60) and that
several E4 ORFs have functions that may be linked to host cell
transcriptional regulation (21, 34, 38, 74), we hypothesized
that E4 region may play a role in the E1 E4+
Ad vector in inducing endogenous endothelial-cell gene expression. To
evaluate this hypothesis, induction of endogenous gene expression was
analyzed in cells infected with an E1 E4 Ad
vector (Fig. 3). RT-PCR analysis of total
RNA extracted from cells infected with E1 E4+
Ad vector showed an E4-specific 360-bp PCR product (Fig. 3A). In
contrast, neither uninfected control endothelial cells nor endothelial
cells infected with E1 E4 Ad vector showed
the E4-specific PCR product; i.e., Ad E4 genes are expressed in
endothelial cells following infection with an E1
E4+ Ad gene transfer vector but not in the E1
E4 Ad vector-infected or naive control cells.
View larger version (42K):
[in this window]
[in a new window]
|
FIG. 3.
RT-PCR analysis of endogenous gene expression of human
endothelial cells following E1 E4 Ad vector
infection. (A) Expression of Ad E4 genes in human endothelial cells
following infection with an E1 E4 Ad gene
transfer vector compared to that with an E1
E4+ vector. Total RNA (200 ng/reaction) extracted from
uninfected control cells (C) or cells infected with an E1
E4+ (E4+) or E1 E4
(E4) Ad gene transfer vectors were used for RT-PCR
analysis with AdE4 gene-specific primers. Note that with the
E1 E4+ vector but not with the
E1 E4 vector, E4 transcripts are observed.
(B) Expression of endogenous endothelial genes. The analysis was
carried out as in Fig. 1, with total RNA (200 ng/reaction) extracted
from uninfected control cells (C) or cells exposed to E1
E4 Ad vector (Ad) used as templates for RT-PCR analysis
with gene-specific primers. For both panels A and B, GAPDH primers were
used to confirm RNA integrity and use of equal amounts of RNA. (C)
Northern analysis of expression of TGF-2, calpactin p36, and G-S
expression in endothelial cells infected with E1
E4+ compared to E1 E4 Ad
vectors. Total RNA (10 µg) extracted from uninfected control cells or
cells infected with either E1 E4+ or
E1 E4 Ad gene transfer vectors were used
for Northern analysis and probed with TGF-2, calpactin p36, and
G-S cDNA probes. Note that there is little change in transcript
levels with the E1 E4 vector but there is
upregulation with the E1 E4+ vector.
|
|
RT-PCR analysis demonstrated that, in contrast to the E1
E4
+ Ad vector (Fig.
1), infection of endothelial cells with
an E1
E4
Ad vector had little effect on
endogenous endothelial gene expression
(Fig.
3B). In this regard, while
mRNA levels of G
-S and IGFBP4
were mildly increased in the
E1
E4
Ad vector-infected cells, the mRNA
levels of the other genes
upregulated by the E1
E4
+ Ad vector, including the mRNAs for LBC, MEK5, the p11
and p36
subunits of calpactin, vinculin, SCA1, and TGF-
2, remained
unaltered
(Fig.
3B). Northern blot analysis further confirmed the
minimal
induction of G
-S expression in E1
E4
Ad vector-infected cells while calpactin p36 and
TGF-
2 expression
remained constant (Fig.
3C). Thus, while the
modulation of G
-S
gene expression may be independent, to some
degree, of AdE4 gene
products, the induced expression of other genes
corresponding
to subtracted cDNAs by E1
E4
Ad vectors appear to require expression of at least some AdE4
gene
ORFs.
| |
DISCUSSION |
The basic concept underlying the use of any gene transfer strategy
is that the vector will deliver the expression cassette with the
exogenous gene to the target cell nucleus, where it will be expressed
without substantially modifying the integrity and function of the
target cell. While it is known that E1 E4+ Ad
vectors can achieve delivery and expression of exogenous genes to human
endothelium in vitro and in vivo with reasonable efficacy (13, 25,
47, 48, 82), the present study demonstrates that E1
E4+ Ad vectors achieve this at a price, since the vector
concomitantly initiates the expression of a number of endogenous
endothelial cell genes. By using a subtraction cloning strategy, the
data demonstrate that E1 E4+ Ad vectors
upregulate a variety of genes that appear to be relatively endothelial-cell specific, since the same vector had little effect on
other primary human cells such as fibroblasts and AM. Interestingly, empty Ad capsids did not significantly induce endogenous
endothelial-cell gene expression, and comparison of E1
E4+ and E1 E4 Ad vectors
demonstrated that the induction of endogenous endothelial genes by the
E1 E4+ Ad vector was linked, to a significant
degree, to expression of E4 gene products.
Mechanisms of endothelial-cell upregulation of endogenous genes by
E1 E4+ Ad vectors.
Ad vector-mediated
induction of endothelial-cell gene expression could be mediated either
by virus attachment to the cell surface receptors or by Ad viral
proteins that are synthesized at very low levels following vector DNA
transport to the nucleus. In regard to virus attachment, it has been
shown that following addition of an Ad vector to HeLa cells, the
Raf/MAP kinase pathway is induced within 20 min of Ad vector binding to
the cells; i.e., binding of the Ad vector to the receptor alone is
sufficient to activate this pathway (8). However, in regard
to endothelial cells, the absence of any significant induction of
endothelial gene expression until 24 h following vector infection
suggested that the Ad vector binding to its receptor alone was not
sufficient, at least for the induction of genes identified by
subtraction analysis.
Consistent with this conclusion, empty vector capsids devoid of virus
DNA did not induce endothelial-cell gene expression.
This observation
suggests the requirement of Ad vector DNA to
induce the expression of
endothelial-cell genes. Because the E1
E4
+
but not E1
E4
Ad vector induced endogenous
gene expression in endothelial cells,
it is likely that AdE4 gene
products play a significant role in
Ad vector-mediated induction of
gene expression. Consistent with
this concept, E4 gene expression was
detected by RT-PCR in E1
E4
+ but not in
E1
E4
Ad vector-infected endothelial cells.
The molecular mechanisms
underlying Ad E4 gene-mediated induction of
endogenous gene expression
in the endothelial cells are not clear.
However, it is known that
several proteins encoded by the seven E4 ORFs
have functions that
regulate cellular transcription. For example, ORF3
protein is
associated with the nuclear matrix and is required for
accumulation
of late viral mRNA in the host cell nucleus (
5,
69). ORF6/7
protein modulates the activity of cellular
transcription factor
E2F (
34,
38). ORF4 regulates
phosphorylation of the c-
fos component of the AP-1
transcription factor (
45,
58). Finally,
there is recent
evidence suggesting that E4 genes may play a role
in the persistence of
expression of transgenes following in vivo
transfer with
E1
Ad vectors (
6,
30,
43). Thus, although
expression of E4
gene is significantly reduced in the absence of E1,
the low-level
expression of the E4 gene in an E1
E4
+ Ad gene transfer vector seem to be sufficient to
modulate cellular
as well as transgene
expression.
Endothelial-cell genes evoked by Ad vectors.
The genes that
are upregulated in endothelial cells by an E1
E4+ Ad vector encode proteins that are components of
intracellular signaling (LBC, G-S, and MEK5), the cytoskeleton
(vinculin, calpactin subunits p11 and p36, and SCA1), and growth
regulation (IGFBP4 and TGF-2).
The LBC gene product is known to associate with the GTP binding protein
Rho in vivo and functions as a Rho-specific guanine
nucleotide exchange
factor (
84). Consistent with an in vivo
role for LBC in Rho
regulation, microinjection of the LBC cDNA
into quiescent Swiss 3T3
fibroblasts induces actin stress fiber
formation indistinguishable from
that induced by Rho (
84).
The G
-S subunit of the heterotrimeric G-proteins is a GTPase
that mediates the rate-limiting hydrolysis of GTP to GDP
(
19).
G
-S stimulates adenyl cyclase and increases
cellular cyclic AMP
levels. Constitutively active mutants of
G
-S-coupled thyrotropin-stimulating
hormone receptors have been
isolated from hyperfunctioning thyroid
adenomas, suggesting a role for
G
-S in the regulation of cell
growth (
83). Recent
evidence also suggests a growth-inhibitory
role for constitutively
active G
-S in MCSF-7 breast carcinoma
cells (
11).
The observation that G
-S expression in endothelial cells is
upregulated by the E1
E4
+ Ad vector is
consistent with the upregulation of MEK5 expression
by the same vector
in the same cells. In this context, it is hypothesized
that the
constitutively active G
-S might disrupt downstream mitogen-activated
protein (MAP) kinase pathways (
44,
53). In this pathway, Raf
(MAP kinase kinase kinase) phosphorylates and activates MEK (MAP
kinase
kinase), which in turn mediates the activation of ERK1
and ERK2 (MAP
kinase). MEK-5, a novel member of the MEK family,
phosphorylates a
downstream substrate, big MAP kinase (BMK1),
which, in turn, activates
myocyte-specific enhancer binding factor
(MEF2C), resulting in the
induction of the immediate-early response
gene c-
jun
(
44).
Vinculin, a 16-kDa single-chain cytoskeletal protein, is organized as
linear arrays confined to cell-cell contact areas or
as plaques in
resting and migrating endothelium (
57). Vinculin
is a
component of a focal adhesion complex which integrates
integrin-mediated
signaling events (
50). Disruption of this
complex results in
cell death (
50). Vinculin is a substrate
for several serine/threonine
and tyrosine kinases (
57) and
may play a role in cell growth
and transformation. In this context, the
exposure of normal rabbit
arteries to high concentrations of an
E1
E4
+ Ad vector upregulates the expression
of the adhesion molecules
ICAM-1 and VCAM-1 in vascular smooth muscle
cells of the arterial
wall (
61).
Calpactins/lipocortines are a family of calcium binding proteins which
interact with phospholipids and cytoskeletal proteins,
actin, and
spectrins (
14). Calpactin I exists as a 36-kDa monomer
or as
a dimer complexed with an 11-kDa protein (
31,
85). The
p36
calpactin heavy chain is phosphorylated at a tyrosine residue
in
transformed and growth factor-stimulated cells (
39,
41).
Interestingly, both p36 and p11 mRNA levels were upregulated in
parallel in the E1
E4
+ Ad-infected
endothelial cells. Interestingly, there is persistence
of parallel
upregulation of both subunits in the TGF-
2 upregulates
both
calpectin p11 and p36 subunits (
59).
SCA1 (for "spinocerebellar ataxia 1"), a 200-kDa single-chain
protein also referred to as ataxin, is expressed in fetal and
adult
brain. The neurodegenerative disease spinocerebellar ataxia
is
associated with expansion of CAG codons in the ataxin coding
sequence
and consequently a long polyglutamine tract in the ataxin
protein. The
SCA1 gene is expressed as an 11-kb transcript in
all tissues
examined (
3,
73). We observed that SCA1 is expressed
at very
low levels in endothelial cells, but the functional role
of ataxin in
endothelial cells is not
known.
Upregulation of IGFBP4 expression by the E1
E4
+ Ad vector in primary human endothelial cells suggests a
role for this protein
in endothelial cell growth and survival. In this
regard, IGF-I
and IGF-II are structurally related to insulin and
mediate the
growth promoting-effects of growth hormones, they are
essential
during fetal development (
23,
63). IGF-I is both
mitogenic
and chemotactic for endothelial cells (
4). IGFs
are normally
bound to high-affinity binding proteins (IGFBP), which
inhibit
or potentiate the IGF effect depending on the ambient
conditions
and cell type (
63). IGFBP4 is one of the members
of this family
and is synthesized and secreted by bovine arterial,
aortic, and
microvessel endothelial cells (
56).
The TGF-
family includes multifunctional proteins displaying a
variety of activities in a cell-specific manner (
54).
TGF-
2,
a member of the family, is known to be expressed in
endothelial
cells (
72). TGF-
2 is a strong chemoattractant
and mitogen for
some cell types, but it inhibits endothelial-cell
growth and migration
(
27,
54,
70).
Glyceraldehyde-6-phosphate dehydrogenase (G6PDH) is a rate-limiting
enzyme of the hexose monophosphate shunt (
66). Expression
of
G6PDH is under nutritional and hormonal control (
29,
52,
62). G6PDH activity is very low under fasting conditions in
parenchymal cells, and G6PDH mRNA levels are markedly unregulated
following refeeding and insulin administration (
52,
62).
Hepatic
endothelial cells express a very low level of G6PDH under
resting
conditions and is stimulated severalfold following
administration
of bacterial endotoxin (
75).
Interestingly, the present study
demonstrates that G6PDH mRNA
levels are very low in resting HUVEC
but that they are upregulated
following infection with an E1
E4
+ Ad
vector.
Consequences of E1 E4+ Ad vector
modification of gene expression.
The specific consequences of the
genes observed to be upregulated in endothelial cells by an
E1 E4+ Ad vector are unknown. The pattern of
E1 E4+ Ad vector induction of genes appears
to have at least some cell specificity, in that none of the genes
induced by E1 E4+ Ad gene transfer vectors in
endothelial cells were upregulated in human primary skin fibroblasts or
alveolar macrophages. It is intriguing to speculate on a link between
the known function of some of these genes and our recent observation
that E1 E4+ Ad vectors suppress the
proliferation of primary human endothelial cells in vitro and that
primary human endothelial cells infected by E1
E4+ Ad vectors remained viable for prolonged periods even
in the absence of serum and growth factors and independent of the
transgene carried by the Ad vector (64). Further,
E1 E4+ Ad vectors appear to provide an
antiapoptotic signal to endothelial cells, in that infection with the
vector results in an increase in the ratio of Bcl2 to Bax levels in the
endothelial cells. Although the mechanism of these profound effects of
E1 E4+ Ad vectors on endothelial-cell
survival is unclear, it requires the presence of AdE4 gene products in
a fashion similar to that observed in the present study, with the
requirement of E4 gene products to induce endothelial-cell genes
following infection with the Ad vector.
In view of these observations, at least some of the genes induced by
E1
E4
+ Ad vectors might play a role in the
inhibition of endothelial-cell
proliferation and survival following Ad
vector infection. For
example, the signaling molecules LBC, G
-S, and
MEK5 could initiate
a cell survival pathway resulting in prolonged
survival of Ad
infected endothelial cells. In light of evidence
suggesting that
cytoskeletal organization and the resulting cell shape
play a
major role in cell attachment to the substratum and cell
survival
(
65), the cytoskeletal proteins vinculin and
calpactins p11
and p36 interact with actin and thus could affect
endothelial-cell
adhesion and cell shape and hence cell survival.
Finally, upregulation
of TGF-
2 in Ad-infected endothelial cells
might be responsible
for the inhibition of cellular DNA synthesis and
proliferation.
| |
ACKNOWLEDGMENTS |
We thank D. Brough, Gen Vec, Inc., Rockville, Md., for the Ad
E1 E4+ vector and N. Mohamed for help in
preparing the manuscript.
These studies were supported, in part, by the National Institutes of
Health/National Heart, Lung and Blood Institute (grant R01 HL 57318);
the Will Rogers Memorial Fund, Los Angeles, Calif.; and Gen Vec, Inc.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Weill Medical
College of Cornell UniversityNew York Presbyterian Hospital, 520 E. 70th St., ST 505, New York, NY 10021. Phone: (212) 746-2258. Fax: (212)
746-8383. E-mail:
geneticmedicine{at}mail.med.cornell.edu.
| |
REFERENCES |
| 1.
|
Anderson, W. F.
1998.
Human gene therapy.
Nature
392:25-30[Medline].
|
| 2.
|
Armentano, D.,
J. Zabner,
C. Sacks,
C. C. Sookdeo,
M. P. Smith,
J. A. St. George,
S. C. Wadsworth,
A. E. Smith, and R. J. Gregory.
1997.
Effect of the e4 region on the persistence of transgene expression from adenovirus vectors.
J. Virol.
71:2408-2416[Abstract].
|
| 3.
|
Banfi, S.,
A. Servadio,
M. Y. Chung,
T. J. J. Kwiatkowski,
A. E. McCall,
L. A. Duvick,
Y. Shen,
E. J. Roth,
H. T. Orr, and H. Y. Zoghbi.
1994.
Identification and characterization of the gene causing type 1 spinocerebellar ataxia.
Nat. Genet.
7:513-520[Medline].
|
| 4.
|
Bar, R. S.,
B. A. Booth,
M. Boes, and B. L. Dake.
1989.
Insulin-like growth factor-binding proteins from vascular endothelial cells: purification, characterization, and intrinsic biological activities.
Endocrinology
125:1910-1920[Abstract/Free Full Text].
|
| 5.
|
Bridge, E., and G. Ketner.
1989.
Redundant control of adenovirus late gene expression by early region 4.
J. Virol.
63:631-638[Abstract/Free Full Text].
|
| 6.
|
Brough, D. E.,
C. Hsu,
V. A. Kulesa,
G. M. Lee,
L. J. Cantolupo,
A. Lizonova, and I. Kovesdi.
1997.
Activation of transgene expression by early region 4 is responsible for a high level of persistent transgene expression from adenovirus vectors in vivo.
J. Virol.
71:9206-9213[Abstract].
|
| 7.
|
Brough, D. E.,
A. Lizonova,
C. Hsu,
V. A. Kulesa, and I. Kovesdi.
1996.
A gene transfer vector-cell line system for complete functional complementation of adenovirus early regions E1 and E4.
J. Virol.
70:6497-6501[Abstract].
|
| 8.
|
Bruder, J. T., and I. Kovesdi.
1997.
Adenovirus infection stimulates the Raf/MAPK signaling pathway and induces interleukin-8 expression.
J. Virol.
71:398-404[Abstract].
|
| 9.
|
Chan, K. K.,
S. K. Tsui,
S. M. Lee,
S. C. Luk,
C. C. Liew,
K. P. Fung,
M. M. Waye, and C. Y. Lee.
1998.
Molecular cloning and characterization of FHL2, a novel LIM domain protein preferentially expressed in human heart.
Gene
210:345-350[Medline].
|
| 10.
|
Chen, E. Y.,
A. Cheng,
A. Lee,
W. J. Kuang,
L. Hillier,
P. Green,
D. Schlessinger,
A. Ciccodicola, and M. D'Urso.
1991.
Sequence of human glucose-6-phosphate dehydrogenase cloned in plasmids and a yeast artificial chromosome.
Genomics
10:792-800[Medline].
|
| 11.
|
Chen, J.,
J. A. Bander,
T. A. Santore,
Y. Chen,
P. T. Ram,
M. J. Smit, and R. Iyengar.
1998.
Expression of Q227L-galphas in MCF-7 human breast cancer cells inhibits tumorigenesis.
Proc. Natl. Acad. Sci. USA
95:2648-2652[Abstract/Free Full Text].
|
| 12.
|
Clesham, G. J.,
P. J. Adam,
D. Proudfoot,
P. D. Flynn,
S. Efstathiou, and P. L. Weissberg.
1998.
High adenoviral loads stimulate NF kappaB-dependent gene expression in human vascular smooth muscle cells.
Gene Ther.
5:174-180[Medline].
|
| 13.
|
Crawford, L. E.,
E. E. Milliken,
K. Irani,
J. L. Zweier,
L. C. Becker,
T. M. Johnson,
N. T. Eissa,
R. G. Crystal,
T. Finkel, and P. J. Goldschmidt-Clermont.
1996.
Superoxide-mediated actin response in post-hypoxic endothelial cells.
J. Biol. Chem.
271:26863-26867[Abstract/Free Full Text].
|
| 14.
|
Crompton, M. R.,
S. E. Moss, and M. J. Crumpton.
1988.
Diversity in the lipocortin/calpactin family.
Cell
55:1-3[Medline].
|
| 15.
|
Crystal, R. G.
1995.
Transfer of genes to humans: early lessons and obstacles to success.
Science
270:404-410[Abstract/Free Full Text].
|
| 16.
|
Crystal, R. G.,
N. G. McElvaney,
M. A. Rosenfeld,
C. S. Chu,
A. Mastrangeli,
J. G. Hay,
S. L. Brody,
H. A. Jaffe,
N. T. Eissa, and C. Danel.
1994.
Administration of an adenovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis.
Nat. Genet.
8:42-51[Medline].
|
| 17.
|
Defer, C.,
M. T. Belin,
M. L. Caillet-Boudin, and P. Boulanger.
1990.
Human adenovirus-host cell interactions: comparative study with members of subgroups B and C.
J. Virol.
64:3661-3673[Abstract/Free Full Text].
|
| 18.
|
de Martin, R.,
B. Haendler,
R. Hofer-Warbinek,
H. Gaugitsch,
M. Wrann,
H. Schlusener,
J. M. Seifert,
S. Bodmer,
A. Fontana, and E. Hofer.
1987.
Complementary DNA for human glioblastoma-derived T cell suppressor factor, a novel member of the transforming growth factor-beta gene family.
EMBO J.
6:3673-3677[Medline].
|
| 19.
|
Dhanasekaran, N.,
S. T. Tsim,
J. M. Dermott, and D. Onesime.
1998.
Regulation of cell proliferation by G proteins.
Oncogene
17:1383-1394[Medline].
|
| 20.
|
Diatchenko, L.,
Y. F. Lau,
A. P. Campbell,
A. Chenchik,
F. Moqadam,
B. Huang,
S. Lukyanov,
K. Lukyanov,
N. Gurskaya,
E. D. Sverdlov, and P. D. Siebert.
1996.
Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries.
Proc. Natl. Acad. Sci. USA
93:6025-6030[Abstract/Free Full Text].
|
| 21.
|
Dobner, T.,
N. Horikoshi,
S. Rubenwolf, and T. Shenk.
1996.
Blockage by adenovirus E4orf6 of transcriptional activation by the p53 tumor suppressor.
Science
272:1470-1473[Abstract].
|
| 22.
|
Dooley, T. P.,
K. L. Weiland, and M. Simon.
1992.
cDNA sequence of human p11 calpactin I light chain.
Genomics
13:866-868[Medline].
|
| 23.
|
Elgin, R. G.,
W. H. J. Busby, and D. R. Clemmons.
1987.
An insulin-like growth factor (IGF) binding protein enhances the biologic response to IGF-I.
Proc. Natl. Acad. Sci. USA
84:3254-3258[Abstract/Free Full Text].
|
| 24.
|
English, J. M.,
C. A. Vanderbilt,
S. Xu,
S. Marcus, and M. H. Cobb.
1995.
Isolation of MEK5 and differential expression of alternatively spliced forms.
J. Biol. Chem.
270:28897-28902[Abstract/Free Full Text].
|
| 25.
|
Erzurum, S. C.,
P. Lemarchand,
M. A. Rosenfeld,
J. H. Yoo, and R. G. Crystal.
1993.
Protection of human endothelial cells from oxidant injury by adenovirus-mediated transfer of the human catalase cDNA.
Nucleic Acids Res.
21:1607-1612[Abstract/Free Full Text].
|
| 26.
|
Fender, P.,
R. W. H. Ruigrok,
E. Gout,
S. Buffet, and J. Chroboczek.
1999.
Adenovirus dodecahedron, a new vector for human gene transfer.
Nat. Biotechnol.
15:52-56.
|
| 27.
|
Frater-Schroder, M.,
G. Muller,
W. Birchmeier, and P. Bohlen.
1986.
Transforming growth factor-beta inhibits endothelial cell proliferation.
Biochem. Biophys. Res. Commun.
137:295-302[Medline].
|
| 28.
|
Frey, B. M.,
S. Rafii,
M. Teterson,
D. Eaton,
R. G. Crystal, and M. A. S. Moore.
1998.
Adenovector-mediated expression of human thrombopoietin cDNA in immune-compromised mice: insights into the pathophysiology of osteomyelofibrosis.
J. Immunol.
160:691-699[Abstract/Free Full Text].
|
| 29.
|
Fritz, R. S.,
D. J. Stumpo, and R. F. Kletzien.
1986.
Glucose-6-phosphate dehydrogenase mRNA sequence abundance in primary cultures of rat hepatocytes. Effect of insulin and dexamethasone.
Biochem. J.
237:617-619[Medline].
|
| 30.
|
Gao, G. P.,
Y. Yang, and J. M. Wilson.
1996.
Biology of adenovirus vectors with E1 and E4 deletions for liver-directed gene therapy.
J. Virol.
70:8934-8943[Abstract].
|
| 31.
|
Glenney, J. R. J.
1987.
Calpactins: calcium-regulated membrane-skeletal proteins.
Bioessays
7:173-175[Medline].
|
| 32.
|
Graham, F. L., and L. Prevec.
1991.
Manipulation of adenovirus vectors, p. 109-128.
In
E. J. Murray (ed.), Methods in molecular biology. The Humana Press, Clifton, N.J
|
| 33.
|
Greber, U. F.,
M. Willetts,
P. Webster, and A. Helenius.
1993.
Stepwise dismantling of adenovirus 2 during entry into cells.
Cell
75:477-486[Medline].
|
| 34.
|
Hardy, S.,
D. A. Engel, and T. Shenk.
1989.
An adenovirus early region 4 gene product is required for induction of the infection-specific form of cellular E2F activity.
Genes Dev.
3:1062-1074[Abstract/Free Full Text].
|
| 35.
|
Harris, B. A.
1988.
Complete cDNA sequence of a human stimulatory GTP-binding protein alpha subunit.
Nucleic Acids Res.
16:3585[Free Full Text].
|
| 36.
|
Hersh, J.,
R. G. Crystal, and B. Bewig.
1995.
Modulation of gene expression after replication-deficient, recombinant adenovirus-mediated gene transfer by the product of a second adenovirus vector.
Gene Ther.
2:124-131[Medline].
|
| 37.
|
Hidaka, C.,
E. Milano,
P. L. Leopold,
J. M. Bergelson,
N. R. Hackett,
R. W. Finberg,
T. J. Wickham,
I. Kovesdi,
P. Roelvink, and R. G. Crystal.
1999.
CAR-dependent and CAR-independent pathways of adenovirus vector-mediated gene transfer and expression in human fibroblasts.
J. Clin. Investig.
103:579-587[Medline].
|
| 38.
|
Huang, M. M., and P. Hearing.
1989.
The adenovirus early region 4 open reading frame 6/7 protein regulates the DNA binding activity of the cellular transcription factor, E2F, through a direct complex.
Genes Dev.
3:1699-1710[Abstract/Free Full Text].
|
| 39.
|
Isacke, C. M.,
I. S. Trowbridge, and T. Hunter.
1986.
Modulation of p36 phosphorylation in human cells: studies using anti-p36 monoclonal antibodies.
Mol. Cell. Biol.
6:2745-2751[Abstract/Free Full Text].
|
| 40.
|
Jaffe, E. A.,
R. L. Nachman,
C. G. Becker, and C. R. Minick.
1973.
Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria.
J. Clin. Investig.
52:2745-2756.
|
| 41.
|
Johnsson, N.,
V. P. Nguyen,
H. D. Soling, and K. Weber.
1986.
Functionally distinct serine phosphorylation sites of p36, the cellular substrate of retroviral protein kinase: differential inhibition of reassociation with p11.
EMBO J.
5:3455-3460[Medline].
|
| 42.
|
Kaner, R. J.,
S. Worgall,
P. L. Leopold,
E. Stolze,
E. Milano,
C. Hidaka,
R. Ramalingam,
N. R. Hackett,
R. Singh,
J. Bergelson,
R. Finberg,
E. Falck-Pedersen, and R. G. Crystal.
1999.
Modification of the genetic program of human alveolar macrophages by adenovirus vectors in vitro is feasible but inefficient, limited in part by the low level of expression of the Coxsackie/adenovirus receptor.
Am. J. Respir. Cell Mol. Biol.
20:361-370[Abstract/Free Full Text].
|
| 43.
|
Kaplan, J. M.,
D. Armentano,
T. E. Sparer,
S. G. Wynn,
P. A. Peterson,
S. C. Wadsworth,
K. K. Couture,
S. E. Pennington,
J. A. St. George,
L. R. Gooding, and A. E. Smith.
1997.
Characterization of factors involved in modulating persistence of transgene expression from recombinant adenovirus in the mouse lung.
Hum. Gene Ther.
8:45-56[Medline].
|
| 44.
|
Kato, Y.,
V. V. Kravchenko,
R. I. Tapping,
J. Han,
R. J. Ulevitch, and J. D. Lee.
1997.
BMK1/ERK5 regulates serum-induced early gene expression through transcription factor MEF2C.
EMBO J.
16:7054-7066[Medline].
|
| 45.
|
Kleinberger, T., and T. Shenk.
1993.
Adenovirus E4orf4 protein binds to protein phosphatase 2A, and the complex down regulates E1A-enhanced junB transcription.
J. Virol.
67:7556-7560[Abstract/Free Full Text].
|
| 46.
|
La Tour, D.,
S. Mohan,
T. A. Linkhart,
D. J. Baylink, and D. D. Strong.
1990.
Inhibitory insulin-like growth factor-binding protein: cloning, complete sequence, and physiological regulation.
Mol. Endocrinol.
4:1806-1814[Abstract/Free Full Text].
|
| 47.
|
Lemarchand, P.,
H. A. Jaffe,
C. Danel,
M. C. Cid,
H. K. Kleinman,
L. D. Stratford-Perricaudet,
M. Perricaudet,
A. Pavirani,
J. P. Lecocq, and R. G. Crystal.
1992.
Adenovirus-mediated transfer of a recombinant human alpha 1-antitrypsin cDNA to human endothelial cells.
Proc. Natl. Acad. Sci. USA
89:6482-6486[Abstract/Free Full Text].
|
| 48.
|
Lemarchand, P.,
M. Jones,
C. Danel,
I. Yamada,
A. Mastrangeli, and R. G. Crystal.
1994.
In vivo adenovirus-mediated gene transfer to lungs via pulmonary artery.
J. Appl. Physiol.
76:2840-2845[Abstract/Free Full Text].
|
| 49.
|
Leopold, P. L.,
B. Ferris,
I. Grinberg,
S. Worgall,
N. R. Hackett, and R. G. Crystal.
1998.
Fluorescent virions: dynamic tracking of the pathway of adenoviral gene transfer vectors in living cells.
Hum. Gene Ther.
9:367-378[Medline].
|
| 50.
|
Levkau, B.,
B. Herren,
H. Koyama,
R. Ross, and E. W. Raines.
1998.
Caspase-mediated cleavage of focal adhesion kinase pp125FAK and disassembly of focal adhesions in human endothelial cell apoptosis.
J. Exp. Med.
187:579-586[Abstract/Free Full Text].
|
| 51.
|
Lieber, A.,
C. Y. He,
L. Meuse,
D. Schowalter,
I. Kirillova,
B. Winther, and M. A. Kay.
1997.
The role of Kupffer cell activation and viral gene expression in early liver toxicity after infusion of recombinant adenovirus vectors.
J. Virol.
71:8798-8807[Abstract].
|
| 52.
|
Manos, P.,
R. Nakayama, and D. Holten.
1991.
Regulation of glucose-6-phosphate dehydrogenase synthesis and mRNA abundance in cultured rat hepatocytes.
Biochem. J.
276:245-250.
|
| 53.
|
Marshall, C. J.
1995.
Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation.
Cell
80:179-185[Medline].
|
| 54.
|
Massague, J.
1990.
The transforming growth factor-beta family.
Annu. Rev. Cell Biol.
6:597-641.
|
| 55.
|
McElvaney, N. G., and R. G. Crystal.
1995.
IL-6 release and airway administration of human CFTR cDNA adenovirus vector.
Nat. Med.
1:182-184[Medline].
|
| 56.
|
Moser, D. R.,
W. L. J. Lowe,
B. L. Dake,
B. A. Booth,
M. Boes,
D. R. Clemmons, and R. S. Bar.
1992.
Endothelial cells express insulin-like growth factor-binding proteins 2 to 6.
Mol. Endocrinol.
6:1805-1814[Abstract/Free Full Text].
|
| 57.
|
Muhs, A.,
T. Noll, and H. M. Piper.
1997.
Vinculin phosphorylation and barrier failure of coronary endothelial monolayers under energy depletion.
Am. J. Physiol.
273:H608-H617[Abstract/Free Full Text].
|
| 58.
|
Muller, U.,
T. Kleinberger, and T. Shenk.
1992.
Adenovirus E4orf4 protein reduces phosphorylation of c-Fos and E1A proteins while simultaneously reducing the level of AP-1.
J. Virol.
66:5867-5878[Abstract/Free Full Text].
|
| 59.
|
Munz, B.,
V. Gerke,
R. Gillitzer, and S. Werner.
1997.
Differential expression of the calpactin I subunits annexin II and p11 in cultured keratinocytes and during wound repair.
J. Invest. Dermatol.
108:307-312[Medline].
|
| 60.
|
Nevins, J. R.
1981.
Mechanism of activation of early viral transcription by the adenovirus E1A gene product.
Cell
26:213-220[Medline].
|
| 61.
|
Newman, K. D.,
P. F. Dunn,
J. W. Owens,
A. H. Schulick,
R. Virmani,
G. Sukhova,
P. Libby, and D. A. Dichek.
1995.
Adenovirus-mediated gene transfer into normal rabbit arteries results in prolonged vascular cell activation, inflammation, and neointimal hyperplasia.
J. Clin. Investig.
96:2955-2965.
|
| 62.
|
Prostko, C. R.,
R. S. Fritz, and R. F. Kletzien.
1989.
Nutritional regulation of hepatic glucose-6-phosphate dehydrogenase. Transient activation of transcription.
Biochem. J.
258:295-299[Medline].
|
| 63.
|
Rajaram, S.,
D. J. Baylink, and S. Mohan.
1997.
Insulin-like growth factor-binding proteins in serum and other biological fluids: regulation and functions.
Endocr. Rev.
18:801-831[Abstract/Free Full Text].
|
| 64.
|
Ramalingam, R.,
S. Rafii,
S. Worgall,
D. E. Rough, and R. G. Crystal.
1999.
E1 E4+ adenoviral gene transfer vectors function as a "pro-life" signal to promote survival of primary human endothelial cells.
Blood
93:2936-2944[Abstract/Free Full Text].
|
| 65.
|
Re, F.,
A. Zanetti,
M. Sironi,
N. Polentarutti,
L. Lanfrancone,
E. Dejana, and F. Colotta.
1994.
Inhibition of anchorage-dependent cell spreading triggers apoptosis in cultured human endothelial cells.
J. Cell Biol.
127:537-546[Abstract/Free Full Text].
|
| 66.
|
Rognstad, R., and J. Katz.
1979.
Effects of 2,4-dihydroxybutyrate on lipogenesis in rat hepatocytes.
J. Biol. Chem.
254:11969-11972[Abstract/Free Full Text].
|
| 67.
|
Rosenfeld, M. A.,
K. Yoshimura,
B. C. Trapnell,
K. Yoneyama,
E. R. Rosenthal,
W. Dalemans,
M. Fukayama,
J. Bargon,
L. E. Stier,
L. Stratford-Perricaudet,
M. Perricaudet,
W. B. Guggino,
A. Pavirani,
J.-P. Lecocq, and R. G. Crystal.
1992.
In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithelium.
Cell
68:143-155[Medline].
|
| 68.
|
Russi, T. J., and R. G. Crystal.
1997.
Pulmonary macrophages, p. 371-371.
In
R. G. Crystal (ed.), The lung: scientific foundations. Lippencott-Raven, Inc., Philadelphia, Pa
|
| 69.
|
Sandler, A. B., and G. Ketner.
1989.
Adenovirus early region 4 is essential for normal stability of late nuclear RNAs.
J. Virol.
63:624-630[Abstract/Free Full Text].
|
| 70.
|
Sankar, S.,
N. Mahooti-Brooks,
M. Centrella,
T. L. McCarthy, and J. A. Madri.
1995.
Expression of transforming growth factor type III receptor in vascular endothelial cells increases their responsiveness to transforming growth factor beta 2.
J. Biol. Chem.
270:13567-13572[Abstract/Free Full Text].
|
| 71.
|
Saris, C. J.,
B. F. Tack,
T. Kristensen,
J. R. J. Glenney, and T. Hunter.
1986.
The cDNA sequence for the protein-tyrosine kinase substrate p36 (calpactin I heavy chain) reveals a multidomain protein with internal repeats.
Cell
46:201-212[Medline].
|
| 72.
|
Sato, Y.,
R. Tsuboi,
R. Lyons,
H. Moses, and D. B. Rifkin.
1990.
Characterization of the activation of latent TGF-beta by co-cultures of endothelial cells and pericytes or smooth muscle cells: a self-regulating system.
J. Cell Biol.
111:757-763[Abstract/Free Full Text].
|
| 73.
|
Servadio, A.,
B. Koshy,
D. Armstrong,
B. Antalffy,
H. T. Orr, and H. Y. Zoghbi.
1995.
Expression analysis of the ataxin-1 protein in tissues from normal and spinocerebellar ataxia type 1 individuals.
Nat. Genet.
10:94-98[Medline].
|
| 74.
|
Shenk, T.
1997.
Adenoviridae: the viruses and their replication, p. 2111.
In
B. N. Fields, et al. (ed.), Fields virology. Lippincott-Raven, Philadelphia, Pa
|
| 75.
|
Spolarics, Z., and L. Navarro.
1994.
Endotoxin stimulates the expression of glucose-6-phosphate dehydrogenase in Kupffer and hepatic endothelial cells.
J. Leukoc. Biol.
56:453-457[Abstract].
|
| 76.
|
Tan, E. M.,
J. Uitto,
E. A. Bauer, and A. Z. Eisen.
1981.
Human skin fibroblasts in culture: procollagen synthesis in the presence of sera from normal human subjects and from patients with dermal fibroses.
J. Investig. Dermatol.
76:462-467[Medline].
|
| 77.
|
Toksoz, D., and D. A. Williams.
1994.
Novel human oncogene lbc detected by transfection with distinct homology regions to signal transduction products.
Oncogene
9:621-628[Medline].
|
| 78.
|
Verma, I. M., and N. Somia.
1997.
Gene therapypromises, problems and prospects.
Nature
389:239-242[Medline].
|
| 79.
|
Weller, P. A.,
E. P. Ogryzko,
E. B. Corben,
N. I. Zhidkova,
B. Patel,
G. J. Price,
N. K. Spurr,
V. E. Koteliansky, and D. R. Critchley.
1990.
Complete sequence of human vinculin and assignment of the gene to chromosome 10.
Proc. Natl. Acad. Sci. USA
87:5667-5671[Abstract/Free Full Text].
|
| 80.
|
Wickham, T. J.,
P. Mathias,
D. A. Cheresh, and G. R. Nemerow.
1993.
Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment.
Cell
73:309-319[Medline].
|
| 81.
|
Wilson, J. M.
1996.
Adenoviruses as gene-delivery vehicles.
N. Engl. J. Med.
334:1185-1187[Free Full Text].
|
| 82.
|
Wrighton, C. J.,
R. Hofer-Warbinek,
T. Moll,
R. Eytner,
F. H. Bach, and R. de Martin.
1996.
Inhibition of endothelial cell activation by adenovirus-mediated expression of I kappa B alpha, an inhibitor of the transcription factor NF-kappa B.
J. Exp. Med.
183:1013-1022[Abstract/Free Full Text].
|
| 83.
|
Zeiger, M. A.,
M. Saji,
P. Caturegli,
W. H. Westra,
L. D. Kohn, and M. A. Levine.
1996.
Transformation of rat thyroid follicular cells stably transfected with cholera toxin A1 fragment.
Endocrinology
137:5392-5399[Abstract].
|
| 84.
|
Zheng, Y.,
M. F. Olson,
A. Hall,
R. A. Cerione, and D. Toksoz.
1995.
Direct involvement of the small GTP-binding protein Rho in lbc oncogene function.
J. Biol. Chem.
270:9031-9034[Abstract/Free Full Text].
|
| 85.
|
Zokas, L., and J. R. J. Glenney.
1987.
The calpactin light chain is tightly linked to the cytoskeletal form of calpactin I: studies using monoclonal antibodies to calpactin subunits.
J. Cell Biol.
105:2111-2121[Abstract/Free Full Text].
|
| 86.
|
Zolotukhin, S.,
M. Potter,
W. W. Hauswirth,
J. Guy, and N. Muzyczka.
1996.
A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells.
J. Virol.
70:4646-4654[Abstract].
|
Journal of Virology, December 1999, p. 10183-10190, Vol. 73, No. 12
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Flaherty, D. M., Hinde, S. L., Monick, M. M., Powers, L. S., Bradford, M. A., Yarovinsky, T., Hunninghake, G. W.
(2004). Adenovirus vectors activate survival pathways in lung epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol.
287: L393-L401
[Abstract]
[Full Text]
-
Katusic, Z. S., Caplice, N. M., Nath, K. A.
(2003). Nitric Oxide Synthase Gene Transfer as a Tool to Study Biology of Endothelial Cells. Arterioscler. Thromb. Vasc. Bio.
23: 1990-1994
[Abstract]
[Full Text]
-
Zhang, F., Hackett, N. R., Lam, G., Cheng, J., Pergolizzi, R., Luo, L., Shmelkov, S. V., Edelberg, J., Crystal, R. G., Rafii, S.
(2003). Green fluorescent protein selectively induces HSP70-mediated up-regulation of COX-2 expression in endothelial cells. Blood
102: 2115-2121
[Abstract]
[Full Text]
-
Zhang, L.-Q., Mei, Y.-F., Wadell, G.
(2003). Human adenovirus serotypes 4 and 11 show higher binding affinity and infectivity for endothelial and carcinoma cell lines than serotype 5. J. Gen. Virol.
84: 687-695
[Abstract]
[Full Text]
-
Akman, H. O., Zhang, H., Siddiqui, M. A. Q., Solomon, W., Smith, E. L. P., Batuman, O. A.
(2001). Response to hypoxia involves transforming growth factor-beta 2 and Smad proteins in human endothelial cells. Blood
98: 3324-3331
[Abstract]
[Full Text]
-
Russell, W. C.
(2000). Update on adenovirus and its vectors. J. Gen. Virol.
81: 2573-2604
[Full Text]
-
JIANG, C., LU, H., VINCENT, K. A., SHANKARA, S., BELANGER, A. J., CHENG, S. H., AKITA, G. Y., KELLY, R. A., GOLDBERG, M. A., GREGORY, R. J.
(2002). Gene expression profiles in human cardiac cells subjected to hypoxia or expressing a hybrid form of HIF-1{alpha}. Physiol. Genomics
8: 23-32
[Abstract]
[Full Text]
Top
Abstract
Introduction
