Previous Article | Next Article 
Journal of Virology, December 1999, p. 10173-10182, Vol. 73, No. 12
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
A Single Rep Protein Initiates Replication of
Multiple Genome Components of Faba Bean Necrotic Yellows Virus, a
Single-Stranded DNA Virus of Plants
Tatiana
Timchenko,1,*
Françoise
de Kouchkovsky,1
Lina
Katul,2
Chantal
David,1
Heinrich Josef
Vetten,2 and
Bruno
Gronenborn1
Institut des Sciences Végétales,
CNRS, 91198 Gif sur Yvette, France,1 and
Biologische Bundesanstalt für Land und
Forstwirtschaft, Institut für Pflanzenvirologie, Mikrobiologie
und Biologische Sicherheit, D-38104 Braunschweig,
Germany2
Received 15 March 1999/Accepted 2 September 1999
 |
ABSTRACT |
Faba bean necrotic yellows virus (FBNYV) belongs to the
nanoviruses, plant viruses whose genome consists of multiple circular single-stranded DNA components. Eleven distinct DNAs, 5 of which encode
different replication initiator (Rep) proteins, have been identified in two FBNYV isolates. Origin-specific DNA cleavage and
nucleotidyl transfer activities were shown for Rep1 and Rep2 proteins
in vitro, and their essential tyrosine residues that catalyze these reactions were identified by site-directed mutagenesis. In addition, we showed that Rep1 and Rep2 proteins
hydrolyze ATP, and by changing the key lysine residue in the proteins'
nucleoside triphosphate binding sites, demonstrated that this ATPase
activity is essential for multiplication of virus DNA in vivo. Each of the five FBNYV Rep proteins initiated replication of the DNA molecule by which it was encoded, but only Rep2 was able to initiate replication of all the six other genome components. Furthermore, of the five rep components, only the Rep2-encoding DNA was always
detected in 55 FBNYV samples from eight countries. These data
provide experimental evidence for a master replication protein encoded
by a multicomponent single-stranded DNA virus.
 |
INTRODUCTION |
Rolling-circle replication (RCR) of
DNA appears particularly well suited for the multiplication of genetic
information stored in the form of single-stranded DNA (ssDNA)
(29). Genetic entities that multiply their DNA via RCR
range from ssDNA plasmids of Archaebacteria (57) and Eubacteria (31, 82),
ssDNA phages (e.g.,
X174) (7), ssDNA viruses of
plants (gemini- and nanoviruses) (19, 44, 52)
to circoviruses and ssDNA viruses of birds (8, 62) and
mammals (34, 60, 76). There is also a linear variant of RCR in the form of a rolling hairpin, a mechanism by which the
single-stranded linear genome of parvoviruses is multiplied (11,
21). Common denominators of all these examples are specific replication initiator (Rep) proteins encoded by their own respective plasmid or the virus DNA and their interaction with a target sequence that, in many cases, may form a particular secondary structure, for
instance, a hairpin (33, 36, 52, 54, 56).
Unlike the ssDNA plasmids, phages, and circoviruses, the genetic
information of some geminiviruses is distributed over two DNAs, and
that of the nanoviruses is distributed over at least six
different DNAs. This creates the need for the Rep proteins to ensure
multiplication of several different DNA molecules. In addition, the
apparent redundancy of nanovirus DNAs encoding similar yet
distinct Rep proteins raises questions about their respective specific
roles in the replication process of the multiple component genome of
the nanoviruses.
Nanoviruses (formerly referred to as "plant circoviruses")
have only recently been established as a separate genus of plant viruses with a genome consisting of multiple circular ssDNAs, each
about 1 kb in size (67). Six to 11 different DNA
components have so far been identified in the four assigned
nanovirus species, such as the banana bunchy top virus
(BBTV), faba bean necrotic yellows virus (FBNYV), milk
vetch dwarf virus (MDV), and subterranean clover stunt virus (SCSV)
(13, 14, 50, 70). With a single exception, each DNA appears
to contain only one gene (9, 10). Each ssDNA is
individually encapsidated into small isometric virions, and virus
transmission is accomplished only by insects (aphids). The lack of an
alternative experimental infection system has so far precluded the
identification of the entire set of DNAs that represent the complete
genome of a nanovirus.
In contrast, geminiviruses, the first ssDNA plant viruses described
(30, 37), are well characterized in biological and molecular
terms (12). They differ from the nanoviruses by
their twin (geminate) particles, their genome organization, and insect vector (55). Geminivirus replication proteins bind
specifically to double-stranded DNA (dsDNA) motifs in the origin region
(1, 24, 26) and have a site-specific in vitro cleavage and
joining activity on single-stranded oligonucleotides (40,
54) that represent part of the viral replication origin sequences
(39, 64, 71). In addition, they possess an ATPase activity
essential for virus replication (22, 35). The protein
domains and amino acids responsible for the various activities of Rep
proteins have been genetically or biochemically identified (18,
22, 42, 46, 53, 65, 66).
However, little is known about the molecular details of
nanovirus replication. Minus-strand DNA synthesis of BBTV is
primed by virion-associated primers (32), and a Rep protein
was inferred to be encoded by one of the six BBTV genome components
(36), based on the presence of amino acid motifs conserved
among RCR initiator proteins (44). For this protein, a
cleavage and joining activity of oligonucleotides corresponding to the
inverted repeat sequence of the viral replication origin has been shown
in vitro (33). A more complex picture emerged, however, when
four further Rep-encoding DNAs (rep components) were
identified from a Taiwanese isolate of BBTV (79, 80) and two
and four rep components were described for the 7- and
10-component genomes of SCSV (13) and MDV (70), respectively.
For FBNYV, the object of this study, 11 distinct ssDNA components
(C1 to C11) have been identified (48-50). Each of them
encodes a single protein, such as the virus capsid protein
(48), a cell cycle-link protein (4, 5), and four
other proteins of as yet unknown function. C1, -2, -7, -9, and -11 encode different but closely related Rep proteins, each of about 33 kDa. The presence in two FBNYV isolates of five DNAs encoding distinct
Rep proteins along with (at least) six DNAs encoding other viral
proteins immediately raised two questions: whether all rep
components are required and which of them are essential for the
multiplication of the other genome components.
Here we describe the first biochemical and genetic analyses of FBNYV
Rep1 and Rep2 protein activities along with the proof that each of five
replication proteins is functional in vivo, i.e., supports autonomous
replication of its coding component. Furthermore, we show that only one
Rep protein, Rep2, has the capability and is sufficient to initiate in
trans the replication of all other genome components of
FBNYV that encode no Rep. This demonstrates the existence of a master
replication protein in a multipartite ssDNA virus.
 |
MATERIALS AND METHODS |
Clones of FBNYV DNAs.
The DNA sequences of the FBNYV-Sy
isolate SV292-88 were previously described (48-50), and
their EMBL/GenBank accession numbers are as follows: X80879 (C1),
Y11405 to Y11409 (C2 to C6), and AJ005964 to AJ005967 (C7 to C10). C1
and C2 of this isolate are referred to here as C1-Sy and C2-Sy,
respectively. Clones of C2 to C10 of the Egyptian isolate EV1-93 were
obtained after PCR amplification by Pfu DNA polymerase by
using primers designed to create unique restriction sites at the ends
of the amplified DNA (see Tables 1 and 2 for
details). In this way, all components,
except C5 and C7, were cloned in the corresponding sites of pBluescript
IISK(+) (Stratagene). To clone C5, two overlapping fragments were
amplified by using the combination of the primer pairs P6 and P7 or P18
and P19 (Table 1). Both fragments were then digested with
Asp718 and PvuII, ligated, cut by
XbaI, and inserted into the XbaI site of pUC19
(81). Since for subsequent replication assays in plant
tissue the binary vector pBin19 was used (28), the 1-kb
amplification product of C7 had to be circularly permutated prior to
insertion into pBin19. Therefore, the DNA was digested by
PvuI, self-ligated, cut by HindIII, and
inserted into the HindIII site of pUC19. Similarly, a
clone of FBNYV C11 (FBNYV C1-Eg in reference 50),
available as a PstI insertion in pUC19, was liberated by
digestion with PstI, ligated, digested again by
XbaI, and inserted into the XbaI site of pUC19.
Rep expression in E. coli and protein
purification.
Rep1 and Rep2 proteins were expressed in
Escherichia coli with an N-terminal hexahistidine tag by
using plasmid pQE30 (QIAGEN). DNA of C1-Sy and C2-Sy, cloned in the
HindIII site of pGEM-3Zf(+), was released by
HindIII and self-ligated, and the respective
rep1 and rep2 genes were amplified by PCR with
Pfu DNA polymerase and the following primer pairs:
rep1 by using oligonucleotides rep1-SphI as the
5'-end primer and rep1-SalI as the 3'-end primer and
rep2 by using oligonucleotides rep2-SphI as the
5'-end primer and rep2-SalI as the 3'-end primer (see Table
1 for details). The SphI and SalI restriction
sites at the 5' and 3' ends of the amplified rep gene DNAs
served for insertion into the corresponding sites of plasmid pQE30. The
resulting plasmids, pQE30-rep1 and pQE30-rep2, were introduced into E. coli BL21(DE3)-recA
(2, 75) harboring plasmid pRep4 (Qiagen) and expressing a
high level of lac repressor to guarantee a tight control of
protein synthesis. Bacteria were grown at 28°C in M9 minimal medium
supplemented with 0.1% Casamino Acids, 2% glucose, and 0.1%
thiamine, to an optical density at 600 nm of about 0.5, and induced by
addition of 0.5 mM isopropyl-
-D-thiogalactopyranoside for 2 h. After centrifugation, the pellets were resuspended in 50 mM phosphate buffer (pH 8.0) containing 300 mM NaCl and 10% glycerol
(5 ml of buffer for the bacterial pellet from 250 ml of culture) and
frozen. Bacteria were lysed for 30 min with lysozyme (0.5 mg/ml) in the
presence of 0.5% Tween 20 and 1 mM phenylmethylsulfonyl fluoride at
0°C, sonicated for 3 min, and further incubated for 30 min on ice
with DNase and RNase (5 µg/ml). After clarification of the bacterial
lysate by centrifugation at 10,000 × g for 30 min, the
supernatant was loaded onto a TALON (Clontech) metal affinity resin
column (Co2+ as a chelating ion), and the Rep1 and Rep2
proteins were eluted with 250 mM imidazole. The two Rep proteins were
sufficiently pure for all subsequent biochemical assays; the yield of
Rep2 protein was consistently about 10 times higher than that of Rep1.
Site-directed mutagenesis of the rep1 and
rep2 genes.
Mutagenesis to change tyrosine residues
into phenylalanine (Y78 of Rep1 or Y79 of Rep2) and the lysine residues
into alanine (K177 of Rep1 or K187 of Rep2) was performed with plasmids
pBSKII:C1-Sy and pBSKII:C2-Sy or directly with expression plasmids
pQE30-rep1 and pQE30-rep2 by applying the "Quik
Change" site-directed mutagenesis kit (Stratagene). The primers
rep1Y78F(+) and
rep1Y78F(
) and
rep2Y79F(+) and
rep2Y79F(
) were used to change the respective
tyrosine residues, and rep1K177A(+) and
rep1K177A(
) and
rep2K187A(+) and
rep2K187A(
) were used to change the respective
lysine residues.
DNA cleavage and nucleotidyl transfer assay.
Approximately
50 to 500 ng of Rep1 or Rep2 protein was incubated with 50 fmol of
32P-labeled (and nonlabeled) substrate DNA in a total
volume of 20 µl for 20 min at 37°C in a reaction buffer containing
25 mM Tris-HCl (pH 7.5), 75 mM NaCl, 2.5 mM MnCl2, and 2.5 mM dithiothreitol. The reaction was stopped by adding 2 µl of 0.5 M
EDTA, lyophilized, resuspended in formamide, and analyzed on 12%
sequencing gels (68), which were then dried and autoradiographed.
ATPase assay.
About 100 ng of Rep1 or Rep2 protein was
incubated at room temperature with 5 nM [
-32P]ATP and
various (5 to 50 µM) concentrations of nonlabeled ATP in a 10-µl
reaction mixture containing 50 mM PIPES-NaOH (pH 7.0), 50 mM NaCl, 10 mM MgCl2, and 0.02% NP40. The reaction was stopped by the
addition of 1 µl of 0.5 M EDTA. The reaction products were separated
on thin-layer chromatography-polyethyleneimine cellulose (TLC-PEI)
plates (Schleicher & Schuell) with 0.5 M LiCl-1 M formic acid as
running buffer. The amount of 32Pi liberated
was quantified with a PhosphorImager (Molecular Dynamics).
Replication of FBNYV components in N. benthamiana.
For
replication assays, redundant copies (direct repeats) of the FBNYV
C1-Sy, C2-Sy, C3, C4, C5, C6, C9, and C10 were first constructed as
dimers in pUC19 or pBluescript IISK(+) (Table
2). The redundant copies were released by
using suitable restriction endonucleases (Table 2) and inserted into
the binary vector pBin19, which contains a DNA fragment from the T
region of Agrobacterium tumefaciens Ti plasmid (T-DNA)
(41). Dimers of C2, -7, and -8, as well as of the mutated
C1-Sy and C2-Sy (see the section above on site-directed mutagenesis),
were directly assembled in the HindIII site of pBin19; a
dimer of C11 in the XbaI site of pBin19 was obtained in the
same way. Because of a severe toxicity of Rep9 protein in agrobacteria,
the redundancy of C9 had to be reduced to 1.1. A 100-bp
PvuII-ApoI fragment of C9 was treated with the Klenow fragment of DNA polymerase I to obtain blunt ends prior to
cloning in the AccI site of pBluescript IISK(+), which had been similarly filled in. The unique AccI site in the FBNYV
DNA served to accept a full-length copy of C9 (liberated from pBSKII:C9 by digestion with PstI and circularly permuted by ligation
and subsequent cleavage with AccI). The 1.1-mer of C9 was
transferred as a BamHI-KpnI fragment into pBin19.
Viral DNA replication was assayed in leaf discs of
Nicotiana
benthamiana following agroinoculation. pBin19 derivatives carrying
redundant copies of the respective FBNYV DNAs were transferred
into
A. tumefaciens LBA 4404 (
41,
63) by
electroporation (
61).
The agrobacteria were used to
inoculate leaf discs of
N. benthamiana as described
previously (
43). One week after inoculation, total
DNA was
isolated from the leaf tissue and fractionated on 1% agarose
gels
containing 0.3 µg of ethidium bromide per ml (1.5 V/cm in
0.5×
Tris-borate-EDTA buffer at 4°C). Viral DNA replicative forms
were
identified by Southern hybridization (
68).
Dot blot hybridization assays for rep components in
FBNYV samples from different countries.
The samples of
FBNYV-infected legumes from Egypt, Ethiopia, Jordan, Morocco, and
Syria, kept as desiccated leaf tissue at 4°C, were those described
previously (27). In addition, FBNYV samples from virus
surveys in Ethiopia, Pakistan, and Turkey in 1997 (kindly provided by
K. M. Makkouk, ICARDA, Aleppo, Syria) and from Algeria (provided
by Linda Allala, INA, El-Harrach, Algeria) were also included.
Infection by FBNYV was determined by polyclonal and monoclonal
antibodies to the virus in double- and triple-antibody sandwich
enzyme-linked immunosorbent assays (27). Fresh and dried
samples extracted at 1:20 (wt/vol) and 1:200 (wt/vol), respectively, with 20× SSPE (3 M NaCl, 0.2 M Na2HPO4, 20 mM
EDTA [pH 7.4]) were dotted as 100-µl aliquots onto positively
charged nylon membranes (Boehringer Mannheim) by using a 96-well vacuum
manifold (Gibco BRL). 32P-labeled rep
component-specific probes (from nucleotide [nt] 598 to nt 929 for C1,
136 to 969 for C2, 67 to 814 for C7, 456 to 972 for C9, and 69 to 436 for C11) were prepared by PCR with primers derived from the respective
coding regions and viral DNA of FBNYV-Sy, except for the C11 probe, for
which FBNYV-Eg DNA served as template. Random-primed probe labeling
with [
-32P]dCTP was carried out with the Megaprime kit
(Amersham). Hybridization was conducted essentially as described in
reference 68 by incubating the membranes at 42°C
and washing the membranes at high stringency (0.1× SSPE and 0.1%
sodium dodecyl sulfate at 65°C).
 |
RESULTS |
The FBNYV isolate SV292-88 from Syria (FBNYV-Sy), whose DNA
sequence had been assembled mostly from partial clones and
PCR-amplified DNA, is no longer available as an
aphid-transmissible virus isolate. Therefore, full-sized genome
components of an FBNYV isolate, EV1-93, from Egypt (FBNYV-Eg)
that is serologically indistinguishable from FBNYV-Sy
(27) and maintained by continuous insect transmission on
fava bean (Vicia faba) were cloned, and their DNA sequences were determined (EMBL/GenBank accession no. AJ132179 to AJ132187 [C2 to C10] and AJ005968 [C11]). Whereas most of the components of
both FBNYV isolates were very similar (>94% nucleotide
identity), there was a striking difference in both coding (61% amino
acid identity) and noncoding regions (68% nucleotide identity) between the rep1 component of FBNYV-Sy and its closest homologue in
FBNYV-Eg (50). Therefore, the latter was designated C11.
Furthermore, the encoded Rep protein (Rep11) turned out to be
functionally distinct from Rep1 (see below). A sequence comparison of
the five different Rep proteins encoded by the respective
rep components (C1, C2, C7, C9, and C11) and the active site
amino acids of Rep1 and Rep2 altered by site-directed mutagenesis are
shown in Fig. 1.

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence comparison of FBNYV Rep proteins. Amino acid
sequences of Rep1 (FBNYV-Sy) and Rep2, -7, -9, and -11 (FBNYV-Eg) were
aligned by using PileUp of the UWGCG sequence analysis software
package. Amino acids identical in all five Rep proteins are shown in
black. Tyrosine and lysine residues that were altered by site-directed
mutagenesis are marked by an asterisk (Y78 and K177 in Rep1 and Y79 and
K187 in Rep2).
|
|
FBNYV DNAs encoding Rep proteins replicate autonomously.
The
association with FBNYV of five apparently distinct DNAs encoding
putative Rep proteins raised the question of whether all of these Rep
proteins were functional. Therefore, the capacity of each
rep component to replicate autonomously in leaf discs of
N. benthamiana was examined. Leaf discs were inoculated with agrobacteria carrying redundant copies of each of the five
rep components (C1, C2, C7, C9, and C11) in the binary T-DNA
vector pBin19. One week after agroinoculation, total DNA was isolated from the infected tissue and probed for replicative forms of viral DNA
by Southern hybridization analyses (Fig.
2). The results indicated that each of
the five rep components replicated autonomously, which means
they expressed a functional Rep protein that acts on its cognate
component to initiate DNA replication.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
FBNYV DNAs encoding Rep proteins replicate autonomously
in N. benthamiana. Southern hybridization of total DNA
extracted from N. benthamiana leaf discs inoculated
with agrobacteria carrying pBin19 with redundant copies of a respective
FBNYV rep component indicated below each blot
(rep1, rep2, rep7, and
rep11 components were cloned as dimers, and rep9
was cloned as a 1.1-mer). Component-specific probes were used as
indicated (rep probe). + S1, DNA was digested with nuclease
S1 to digest the ssDNA; + HindIII, DNA was digested
with HindIII to linearize rep1 or
rep2 DNAs. agro, DNA extracted from agrobacteria used for
inoculation. ss, ssDNA; ccc, covalently closed circular DNA; l,
linear DNA; oc, open circular DNA. The DNA bands that migrate slower
than double-stranded open circular DNA represent dimers and oligomers
of replicative forms as they disappeared after digestion by
HindIII.
|
|
FBNYV Rep1 and Rep2 proteins cleave origin DNA in vitro and have
nucleotidyl transfer activity.
The noncoding region of all
identified FBNYV DNA components contains GC-rich inverted repeats
flanking a highly conserved AT-rich sequence of 11 nt (48)
(Fig. 3), sequences that potentially form
a stem-loop on ssDNA and are supposed to be part of the origin for
initiation of RCR. To prove that the FBNYV Rep proteins possess origin
DNA cleavage and nucleotidyl transfer activity, the Rep1 and Rep2
proteins were expressed in E. coli, purified, and used for
in vitro assays. Oligonucleotides corresponding to the inverted repeat
sequences in the ori regions of rep1 and
rep2 components of FBNYV-Sy were used as substrates for the
cleavage by purified Rep proteins. The precise position of the cleavage
was determined by incubating a 5'-end-labeled ori1-specific
oligonucleotide, 1a, with Rep1 protein. The results presented in Fig.
4B demonstrate that cleavage occurred
between bases 7 and 8 of the consensus nonamer
TAGTATT
AC. The cleavage product
migrated to the same position as a synthetic marker oligonucleotide
with a 3'-OH, representing the 23-nt sequence from the 5' end of the
substrate to the presumed cleavage position. Both migrated slightly
slower than the corresponding Maxam and Gilbert fragment carrying a
phosphate at its 3' end. Hence, we infer that the cleavage product has
a free 3' hydroxyl group. Figure 4A schematically illustrates the
nucleotidyl transfer reaction. When 5'-labeled oligonucleotide 1a and
nonlabeled oligonucleotide 1b were incubated with Rep1 or Rep2 protein,
two labeled products appeared (Fig. 4C). These are the 5' cleavage
product of oligonucleotide 1a and a new recombinant oligonucleotide,
corresponding to the joining of the labeled 5' cleavage product of
oligonucleotide 1a and the 3' cleavage product of oligonucleotide 1b
(transfer product). In addition, Fig. 4C illustrates that both Rep1 and Rep2 proteins cleave the ori1 substrate and that
approximately 10-fold more Rep2 than Rep1 was required to obtain
comparative amounts of reaction products. At the moment, we cannot be
sure whether this difference reflects intrinsic features of the two proteins or whether it results from the strong overproduction of Rep2
and a concomitant partial inactivation of the protein due to
aggregation or misfolding. Nevertheless, both Rep proteins showed
similar in vitro DNA cleavage and nucleotidyl transfer efficiencies on
sets of oligonucleotides corresponding to the replication origins of
the rep1 and rep2 components, as well as on
substrate oligonucleotides representing the tomato yellow leaf curl
geminivirus (TYLCV) origin of replication (data not shown). The
cleavage reaction was strictly dependent on the presence of divalent
cations (2.5 mM Mg2+ or Mn2+). The addition of
10 µM ATP neither stimulated nor inhibited the reaction (data not
shown).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Comparison of the replication origin sequences of 11 FBNYV DNAs. The origin DNA sequences of 11 FBNYV components (C1 of
FBNYV-Sy and C2 to C11 of FBNYV-Eg) are aligned. Inverted repeat
sequences (open horizontal arrows) potentially forming a stem-loop are
boxed. The vertical arrow indicates the position of cleavage by Rep
protein. Conserved sequences shared by C2, C3, C4, C5, C6, C8, and C10
are indicated by small boxes, and the orientation of iteron-like
sequence repeats is indicated by horizontal solid arrows. FBNYV
component designations are on the left.
|
|

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
FBNYV Rep1 and Rep2 proteins possess in vitro cleavage
and nucleotidyl transfer activities. (A) Scheme of the cleavage and
nucleotidyl transfer reactions. The 5' 32P-labeled
oligonucleotide 1a (35 nt
[TGGACCAAGGCGGGTATAGTATTACCCCGCCTTGG])
(underlined inverted repeat sequences are indicated in the figure
by filled boxes) is cleaved by Rep protein giving rise to a 5' 23-nt
labeled and a 3' 12-nt nonlabeled product. Analogously, nonlabeled
oligonucleotide 1b (36 nt
[GGCGGGTATAGTATTACCCCGCCTTGGAACACCCTC])
is cleaved to yield a 5' product of 15 nt and a 3' product of 21 nt. When both oligonucleotides 1a and 1b are treated simultaneously
with Rep protein, their 5' and 3' cleavage products are joined, giving
rise to the recombinant molecules of the nucleotidyl transfer reaction,
the larger of which is 44 nt and carries the 5' 32P label.
(B) Identification of FBNYV origin cleavage position. The 5'
32P-labeled oligonucleotide 1a was subjected to the
G+A-specific chemical cleavage according to Maxam and Gilbert
(58) or incubated with Rep1 protein. The fragment indicated
by an arrow represents the Rep1-specific 5'-terminal cleavage product.
M-23 (TGGACCAAGGCGGGTATAGTATT) is a 32P-labeled
oligonucleotide identical to the 5' cleavage product. (C) Separation of
Rep-mediated DNA cleavage and nucleotidyl transfer products by
denaturing polyacrylamide gel electrophoresis. A mixture of labeled
oligonucleotide 1a and nonlabeled oligonucleotide 1b was incubated with
70 ng of Rep1 or 600 ng of Rep2 protein. The products of the resulting
cleavage and nucleotidyl transfer reactions are indicated. (D)
Alteration of the catalytic tyrosine Y78F or Y79F abolishes cleavage
and nucleotidyl transfer activity of the Rep1 or Rep2 proteins,
respectively. Cleavage and nucleotidyl transfer reactions were
performed with labeled oligonucleotide 1a and nonlabeled
oligonucleotide 1b by using the following Rep proteins: 1WT and 2WT,
wild-type Rep1 and Rep2 proteins; 1Y and 2Y, Rep1Y78F and
Rep2Y79F proteins; 1K and 2K, Rep1K177A and
Rep2K187A proteins, respectively. Since
Rep2K187A protein was available in a limited amount, only
70 ng of wild-type Rep2 or Rep2K187A protein was used in
this assay. Hence only faint bands represent cleavage and transfer
products. To ensure that Rep2Y79F has no cleavage and
nucleotidyl transfer activity, 500 ng of protein was used for this
reaction. It is noteworthy that Rep2K187A has the same
(low) specific cleavage and joining activities as wild-type Rep2
protein.
|
|
Sequence comparisons of Rep proteins of different nanoviruses,
including FBNYV, reveal a putative active site tyrosine in
a conserved
amino acid environment (YxxK) similar to that of replication
initiator
proteins of bacteriophages, prokaryotic plasmids, and
the Rep proteins
of geminiviruses (
44). To verify whether Y78
of Rep1 and Y79
of Rep2 of FBNYV (Fig.
1) are active site amino
acids in the cleavage
and nucleotidyl transfer reaction, their
respective tyrosines were
changed to phenylalanine by site-directed
mutagenesis. Mutant Rep
proteins were expressed, purified, and
tested in vitro as described for
the wild-type Rep proteins. Neither
Rep1
Y78F nor
Rep2
Y79F was active in cleavage and nucleotidyl transfer
(Fig.
4D). In
order to assess the effect of amino acid changes Y78F in
Rep1
and Y79F in Rep2 proteins on the replication of their coding DNAs,
we introduced the respective mutations into the corresponding
rep1 and
rep2 components and assayed their
replication in
N. benthamiana leaf discs. The results of a
typical replication experiment are
shown in Fig.
5. Mutant
rep1 and
rep2 components did not replicate,
proving that tyrosine 78 of Rep1 and tyrosine 79 of Rep2 protein
are essential for DNA
replication in vivo.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 5.
Replication of mutated rep components in
N. benthamiana leaf discs. Southern hybridization of total
DNA extracted from N. benthamiana leaf discs, inoculated
with agrobacteria carrying pBin19 with redundant copies of FBNYV
rep components. 1WT and 2WT, wild-type rep1 and
rep2 components, respectively (FBNYV-Sy); 1Y and 2Y,
rep1 and rep2 components expressing
Rep1Y78F and Rep2Y79F proteins, respectively;
1K and 2K, rep1 and rep2 components expressing
Rep1K177A and Rep2K187A proteins, respectively.
DNA forms are marked the same way as in Fig. 2.
|
|
FBNYV Rep1 and Rep2 proteins possess ATPase activity essential for
DNA replication.
The deduced amino acid sequence of the FBNYV Rep
proteins contains putative nucleoside triphosphate (NTP)-binding motifs
GxxGxxGKT/S (see Fig. 1) that differ slightly from the canonical P-loop
sequence GxxxxGKT/S (77). In order to determine whether the
proteins possess ATPase activity, the hydrolysis of
[
-32P]ATP by purified Rep1 or Rep2 proteins was
assayed. Both proteins were shown to possess ATPase activity with a
Km in the micromolar range similar to that of
TYLCV Rep protein (22). Km and
Vmax values for ATP hydrolysis are shown in Fig.
6A. Rep2 protein was a more active ATPase
than Rep1. The ATPase activity of both proteins was not stimulated by
ssDNA (data not shown). When the lysine residues in the P-loop of
the NTP binding site of Rep1 protein (K177) or Rep2 protein (K187) were
altered by site-directed mutagenesis into alanine, the ATPase
activities of both proteins dropped below the level of detection (Fig.
6B). However, the DNA cleavage and nucleotidyl transfer activity of the
mutant Rep proteins was not influenced by the alterations in the P-loop
(Fig. 4D).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
FBNYV Rep1 and Rep2 proteins possess ATPase activity.
About 100 ng of Rep1 or Rep2 protein was incubated at room temperature
with 5 nM [ -32P]ATP and various (5 to 50 µM)
concentrations of nonlabeled ATP and incubated for 5 min (A). Assays of
panel B were incubated for 20 min with 10 µM ATP as nonlabeled
substrate; the resulting products were separated on TLC-PEI plates. (A)
Determination of Km and
Vmax for ATP hydrolysis. The amount of
32Pi liberated was calculated upon analysis of
chromatograms with a PhosphorImager. The velocity of the reactions
is measured as the amount of total ATP hydrolyzed per minute and is
displayed in a double-reciprocal Lineweaver-Burk plot against the ATP
concentration (1/[ATP]). The Km of Rep1 was
15 ± 5 µM, and the Vmax was 25 ± 10 nmol min 1 mg 1. The
Km of Rep2 was 80 ± 10 µM and the
Vmax was 150 ± 30 nmol min 1
mg 1. (B) Alteration of the conserved lysine in the P-loop
abolishes ATPase activity of Rep1 and Rep2 proteins. Autoradiography of
a chromatogram of ATP hydrolysis by the following proteins was done:
1WT and 2WT, wild-type Rep1 and Rep2, respectively; 1K and 2K,
Rep1K177A and Rep2K187A proteins, respectively;
1Y and 2Y, Rep1Y78F and Rep2Y79F proteins,
respectively. ( ), no protein added.
|
|
The mutations leading to the expression of Rep proteins with an altered
P-loop (K177A in Rep1 and K187A in Rep2) were also
introduced into the
full-length
rep1 and
rep2 DNAs by site-directed
mutagenesis, and their replication was assayed. The results shown
in
Fig.
5 demonstrate that mutant
rep1 and
rep2
components do
not replicate, indicating that the Rep-associated ATPase
is required
for DNA replication in
vivo.
Rep1 and Rep2 proteins do not functionally cross-complement.
Since Rep2 protein in vitro cleaved oligonucleotides corresponding to
the rep1 component origin (Fig. 4) and vice versa (data not
shown), we determined whether a given Rep protein also initiates in
trans the replication of a heterologous rep
component. We used a mixture of two Agrobacterium strains,
one carrying a mutated rep1 component (Y78F or K177A)
and the other carrying a wild-type rep2 component, and vice
versa, to inoculate N. benthamiana leaf discs. Total DNA was
isolated 7 days after inoculation and probed for replication of the
respective rep components by Southern hybridization. As is
evident from Fig. 7, Rep1 protein could
not replace a mutant Rep2 to initiate replication and, conversely, Rep2
protein could not substitute for a mutant Rep1. Moreover,
rep11 also failed to complement a mutated rep1
component, indicating that the two Rep proteins are functionally
distinct.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 7.
Complementation assays with combinations of wild-type
and mutant FBNYV rep components. Different pairs of
agrobacteria carrying pBin19 with redundant copies of wild-type and
mutant rep1 and rep2 components (FBNYV-Sy) or
rep11 were used to coinoculate N. benthamiana
leaf discs. The designations of the respective mutant rep
components are as in Fig. 5. The blots were hybridized with probes
specific for rep1 and rep2 components as
indicated. Because rep11 shares sequence identity with the
rep1 probe, total DNA was treated prior to electrophoresis
with HindIII or PstI, which specifically
linearized either rep1 or rep11 DNA,
respectively. The appearance of a linear fragment upon PstI
treatment proves that only rep11 DNA replicated when
coinoculated with the mutant (Y78F) rep1 component.
|
|
Only FBNYV Rep2 protein triggers replication of other viral genome
components and only rep2 DNA is always associated with
different virus isolates.
Sequence comparison of the noncoding
regions of 11 FBNYV DNAs revealed conserved sequences of about 70 nt
shared by rep2 and all DNAs encoding proteins other than Rep
(non-rep components) (Fig. 3). Apart from the inverted
repeat sequence, there is only limited similarity in the origin region
between the rep2 component and the other rep
components. This observation suggested that Rep2 protein might
specifically recognize targets in the origin sequences common to all
FBNYV DNAs except the rep1, -7, -9,
and -11 components. To verify this hypothesis, we tested
whether replication of the non-rep components of FBNYV could
be initiated in trans by coinoculating each of them in
pairwise mixtures with one of the five rep components to
N. benthamiana leaf discs. Agroinoculation of the various
combinations of DNAs to be tested, DNA extraction, and probing for
replication by Southern hybridization were done as described above.
Figure 8 shows the summary of a series of replication assays. Only when coinoculated with agrobacteria carrying the rep2 component, was replication of each of the six other
FBNYV components observed. Coinoculations with each of the four other rep components did not lead to replication of any
non-rep DNA. This proves that only Rep2 protein catalyzes
the initiation of DNA replication of all FBNYV genome components that
encode viral proteins other than Rep. Therefore, Rep2 is the master Rep
protein of FBNYV.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 8.
Rep2 protein mediates replication of other
(non-rep) FBNYV components. Shown are Southern blots of DNAs
extracted from leaf discs coinoculated with pairwise combinations of
agrobacteria carrying the respective FBNYV DNA to be assayed for
replication (indicated at the bottom) and agrobacteria carrying the
respective rep component (indicated at the top). All DNAs,
except C1-Sy, are from FBNYV-Eg. Membranes were hybridized with probes
specific for the components indicated below each blot.
|
|
The identification of five distinct
rep components from two
geographical isolates of FBNYV (
50) raised the question as
to
what extent these
rep components are associated with
other isolates
of FBNYV. Therefore, 55 FBNYV samples from Algeria,
Egypt, Ethiopia,
Jordan, Morocco, Pakistan, Syria, and Turkey were
analyzed by
dot-blot hybridization with probes specific for each of the
five
rep components. As a result (Table
3), only a
rep2-like component
was detected in every sample. Variable combinations of
rep1-,
rep7-,
rep9-, and
rep11-like components were found in 33 samples,
whereas 22 samples did not contain any of them. Hence, this analysis
corroborates
the results of the replication assays obtained with
the cloned DNAs and
supports the finding that
rep2 encodes the
master Rep
protein of FBNYV.
 |
DISCUSSION |
All FBNYV rep components encode functional replication
initiator proteins.
The recent characterization of the
nanoviruses FBNYV and MDV has led to the identification of the
largest number of different DNA components among the
nanoviruses and, most strikingly, of four (MDV) and five
(FBNYV) different DNAs that potentially code for replication initiator
proteins (50, 70) (Fig. 1). This prompted us to study
whether all five FBNYV rep components encode functional Rep
proteins and, if so, which of these Rep proteins supports replication
initiation of the other genome components. Here, we have shown that, in
fact, all rep components direct the synthesis of functional
replication initiator proteins capable of triggering the autonomous
replication of their respective DNA component in plant cells (Fig. 2).
Moreover, the formation of ssDNA indicates that
nanoviruses, here represented by FBNYV, also replicate via a
rolling-circle mechanism.
The enzymatic properties of at least two FBNYV Rep proteins, Rep1 and
Rep2, resemble in some respects those of the geminivirus
Rep proteins
(
12,
52). The finding that both Rep1 and Rep2
proteins
possess an origin-specific DNA cleavage and nucleotidyl
transfer
activities and that a conserved tyrosine (Y78 of Rep1
and Y79 of Rep2)
is essential for these reactions (Fig.
4 and
5) underline this
similarity. Similar origin cleavage and nucleotidyl
transfer activities
have been reported for Rep protein of another
nanovirus, BBTV,
but active site amino acids were not identified
(
33).
Whereas the role of these Rep activities for virus replication is
evident, the biological significance of the second common
feature, the
ATPase activity of the nanovirus and geminivirus
Rep proteins,
remains elusive. We have shown that in vitro ssDNA
origin cleavage
and joining activity of FBNYV Rep1 and Rep2 proteins
requires no ATP
(Fig.
4D); however, their ATPase function is required
for viral DNA
replication in vivo (Fig.
5), similar to the geminivirus
Rep proteins
(
22,
35,
40,
54,
65). Replication initiator
proteins of some
animal viruses, such as Rep proteins of parvoviruses
and large
T-antigen of simian virus 40 (SV40) and other polyomaviruses,
are also
helicases that require ATP hydrolysis for the unwinding
of dsDNA
(
45,
73), and, consequently, mutants with mutations
in their
NTP-binding site are defective in viral replication (
6,
16,
21,
38,
59). Whether in gemini- and nanovirus Rep
proteins as
well the ATPase is part of a helicase function remains
unknown.
The controlled formation of hexameric complexes in an ATP-dependent
manner is a common feature of animal virus replication
initiator
proteins: for instance, the AAV Rep78 or SV40 large
T-antigen (
15,
72). Moreover, formation of multiprotein complexes
consisting of
replication-associated proteins and other host or
viral proteins is a
general prerequisite for origin recognition
prior to replication
initiation. Examples are represented by the
interaction of SV40 large
T-antigen with replication protein A
and DNA polymerase

-primase
(
78), by association of AAV Rep78
with high-mobility-group
protein HMG1 (
20), or by the papillomavirus
E1 protein
interaction with E2 (
69). For the latter, ATP modulates
this
interaction, and it appears to be an attractive hypothesis
that the
ATPase associated with the nano- and geminivirus Rep
proteins may play
a comparable role in the replication of these
plant
viruses.
Nanovirus replication is triggered by a master Rep protein.
One of the key steps during the initiation of DNA replication is origin
recognition (51). Geminivirus Rep proteins specifically recognize the origin of their cognate genome and do not initiate DNA
replication of other geminivirus genomes, as has been shown for two
different geminiviruses with a single genomic DNA, TYLCV (46) and beet curly top virus (BCTV) (18, 74).
Such recognition specificity is particularly relevant for the
geminiviruses with a bipartite genome. Their two genomic DNAs (DNA-A
and -B) share a common region that contains the replication origin and
multiple Rep protein binding sites. The binding sites are recognized by a given Rep protein and have been mapped to a 13-bp element containing 5-bp direct repeats (iterons) for tomato golden mosaic virus
(24) and BCTV (17, 74). The iterons have to be
identical on a given pair of DNA-A and -B to warrant correct
replication initiation and multiplication of both DNAs (25);
they differ, however, among different geminiviruses (1, 3,
74).
Here, we have demonstrated the same for a nanovirus: wild-type
Rep1 protein of FBNYV could not substitute for a mutated Rep2
protein
to initiate replication of
rep2 DNA and vice versa, which
is
entirely in line with the specificity requirements of origin
recognition by a given Rep protein (Fig.
7). The concept of a
modular
arrangement of specificity elements and a common initiation
signal,
recognized and acted on by Rep proteins in a two-step
process, is
easily transferable from the bipartite genome of some
geminiviruses to
the multipartite genome of the nanoviruses. As
long as a
nanovirus genome component contains a specific signal
recognized by a given Rep protein, that particular Rep protein
initiates its multiplication. This is exactly what we observed
in
replication assays, when we pairwise combined each of the six
FBNYV
DNAs coding for proteins other than a Rep with one of the
five
different
rep components: only Rep2 initiated the
replication
of all non-
rep components in addition to its
cognate DNA (Fig.
8). None of the other Rep proteins was able to
trigger replication
of any DNA other than its cognate. The observation
that DNA sequence
motifs flanking the conserved inverted repeat element
are shared
by
rep2 and the other six genome components,
whose replication
depends on the action of Rep2 protein (Fig.
3),
further suggests
that such common sequences may contain specificity
elements of
Rep2
recognition.
These molecular genetic findings were further supported by the results
of the hybridization analysis of 55 FBNYV samples from
eight countries
with
rep component-specific probes (Table
3).
Only a
rep2 component was detected in all samples, thus providing
independent evidence for this DNA encoding a master Rep protein.
Comparably, a single Rep-encoding DNA (DNA-1) was found in BBTV
isolates from 10 countries (
47). Remarkably, of all
nanovirus
Rep proteins, Rep1 of BBTV is most similar (55%
amino acid identity)
to Rep2 of FBNYV (
50). In contrast,
rep1, -
7, -
9, and -
11
components
were frequently detected in various combinations in the 55 samples
and were even absent from an appreciable number of
FBNYV-infected
samples. No pattern of geographic distribution could be
associated
with the presence or absence of one or more of these
rep components;
the erratic distribution of the
rep1, -
7, -
9, and -
11
components
in the geographically diverse FBNYV samples rather suggests
that
they may not be integral parts of the FBNYV genome. Because in
addition to being autonomously replicating satellites, depending
for
various functions (e.g., encapsidation into virus particles
and
dissemination by insects) on FBNYV, no information concerning
their
influence on disease symptoms is as yet available, it remains
unknown
if they are defective interfering molecules. An interesting
example of
a DNA satellite has recently been described for tomato
leaf curl virus
(TLCV), a monopartite geminivirus (
23). Unlike
the FBNYV
rep components, the TLCV satellite DNA carries only
a
replication origin and depends for multiplication on the Rep
protein of
its helper virus, and it has no obvious phenotypic
effect on
infection.
The intriguing question about the significance of
rep DNAs
that, in addition to a master Rep-encoding DNA, are frequently
associated with FBNYV and other nanoviruses, will only be
answered
by the experimental reproduction of the full biological
infection
cycle of a nanovirus by using infectious cloned
copies of the
complete genomic DNA. The challenge to fulfill Koch's
postulates
for any nanovirus remains
open.
 |
ACKNOWLEDGMENTS |
We thank L. Allala (INA, El-Harrach, Algeria) and K. M. Makkouk (ICARDA, Aleppo, Syria) for supplying FBNYV samples, L. Troussard for DNA sequencing, and J. Leung for critical comments on the manuscript. T. Timchenko is grateful to the Institute of Cytology and
Genetics, Russian Academy of Sciences, Novosibirsk, for granting her a
leave of absence.
This work was supported by the European Commission under the INCO-DC
Programme (ERBIC18-CT96-0121).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut des
Sciences Végétales, CNRS, 91198 Gif sur Yvette, France.
Phone: 33 1 69 82 38 13. Fax: 33 1 69 82 36 95. E-mail:
taniat{at}isv.cnrs-gif.fr.
 |
REFERENCES |
| 1.
|
Akbar Behjatnia, S. A.,
I. B. Dry, and M. Ali Rezaian.
1998.
Identification of the replication-associated protein binding domain within the intergenic region of tomato leaf curl geminivirus.
Nucleic Acids Res.
26:925-931[Abstract/Free Full Text].
|
| 2.
|
Angulo, J. F.,
E. Rouer,
A. Mazin,
M. G. Mattei,
A. Tissier,
P. Horellou,
R. Benarous, and R. Devoret.
1991.
Identification and expression of the cDNA of KIN17, a zinc-finger gene located on mouse chromosome 2, encoding a new DNA-binding protein.
Nucleic Acids Res.
19:5117-5123[Abstract/Free Full Text].
|
| 3.
|
Argüello-Astorga, G. R.,
R. G. Guevara-Gonzalez,
L. R. Herrera-Estrella, and R. F. Rivera-Bustamante.
1994.
Geminivirus replication origins have a group-specific organization of iterative elements: a model for replication.
Virology
203:90-100[Medline].
|
| 4.
|
Aronson, M.,
T. Timchenko,
A. Meyer,
F. de Kouchkovsky,
L. Katul,
H.-J. Vetten, and B. Gronenborn.
1998.
CLINK, a cell cycle link protein from ssDNA plant virus, p. 56.
In
Proceedings of the Fifth McGill University International Conference on Regulation of Eukaryotic DNA Replication St. Sauveur, Quebec, Canada
|
| 5.
| Aronson, M. N., A. D. Meyer, J. Györgyey, L. Katul, H. J. Vetten, B. Gronenborn, and T. Timchenko. Clink, a nanovirus encoded protein binds both
pRB and SKP1. Submitted for publication.
|
| 6.
|
Auborn, K.,
M. Guo, and C. Prives.
1989.
Helicase, DNA-binding, and immunological properties of replication-defective simian virus 40 mutant T antigens.
J. Virol.
63:912-918[Abstract/Free Full Text].
|
| 7.
|
Baas, P. D., and H. S. Jansz.
1988.
Single-stranded DNA phage origins.
Curr. Top. Microbiol. Immunol.
136:31-70[Medline].
|
| 8.
|
Bassami, M. R.,
D. Berryman,
G. E. Wilcox, and S. R. Raidal.
1998.
Psittacine beak and feather disease virus nucleotide sequence analysis and its relationship to porcine circovirus, plant circoviruses, and chicken anaemia virus.
Virology
249:453-459[Medline].
|
| 9.
|
Beetham, P. R.,
G. J. Hafner,
R. M. Harding, and J. L. Dale.
1997.
Two mRNAs are transcribed from banana bunchy top virus DNA-1.
J. Gen. Virol.
78:229-236[Abstract].
|
| 10.
|
Beetham, P. R.,
R. M. Harding, and J. L. Dale.
1999.
Banana bunchy top virus DNA-2 to 6 are monocistronic.
Arch. Virol.
144:89-105[Medline].
|
| 11.
|
Berns, K. I.
1990.
Parvovirus replication.
Microbiol. Rev.
54:316-329[Abstract/Free Full Text].
|
| 12.
|
Bisaro, D. M.
1996.
Geminivirus DNA replication, p. 833-854.
In
M. L. DePamphilis (ed.), DNA replication in eukaryotic cells. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 13.
|
Boevink, P.,
P. W. Chu, and P. Keese.
1995.
Sequence of subterranean clover stunt virus DNA: affinities with the geminiviruses.
Virology
207:354-361[Medline].
|
| 14.
|
Burns, T. M.,
R. M. Harding, and J. L. Dale.
1995.
The genome organization of banana bunchy top virus: analysis of six ssDNA components.
J. Gen. Virol.
76:1471-1482[Abstract/Free Full Text].
|
| 15.
|
Castellino, A. M.,
P. Cantalupo,
I. M. Marks,
J. V. Vartikar,
K. W. C. Peden, and J. M. Pipas.
1997.
trans-Dominant and non-trans-dominant mutant simian virus 40 large T antigens show distinct responses to ATP.
J. Virol.
71:7549-7559[Abstract].
|
| 16.
|
Chejanovsky, N., and B. J. Carter.
1990.
Mutation of a consensus purine nucleotide binding site in the adeno-associated virus rep gene generates a dominant negative phenotype for DNA replication.
J. Virol.
64:1764-1770[Abstract/Free Full Text].
|
| 17.
|
Choi, I. R., and D. C. Stenger.
1996.
The strain-specific cis-acting element of beet curly top geminivirus DNA replication maps to the directly repeated motif of the ori.
Virology
226:122-126[Medline].
|
| 18.
|
Choi, I. R., and D. C. Stenger.
1995.
Strain-specific determinants of beet curly top geminivirus DNA replication.
Virology
206:904-912[Medline].
|
| 19.
|
Chu, P. W. G.,
P. Boevink,
B. Surin,
P. Larkin,
P. Keese, and P. M. Waterhouse.
1995.
Non-geminated single-stranded DNA plant viruses, p. 311-341.
In
R. P. Singh, U. S. Singh, and K. Kohmoto (ed.), Pathogenesis and host specificity in plant diseases, vol. III. Viruses and viroids. Pergamon Press, Elmsford, N.Y
|
| 20.
|
Costello, E.,
P. Saudan,
E. Winocour,
L. Pizer, and P. Beard.
1997.
High mobility group chromosomal protein 1 binds to the adeno-associated virus replication protein (Rep) and promotes Rep-mediated site-specific cleavage of DNA, ATPase activity and transcriptional repression.
EMBO J.
16:5943-5954[Medline].
|
| 21.
|
Cotmore, S. E., and P. Tattersall.
1996.
Parvovirus DNA replication, p. 799-813.
In
M. L. DePamphilis (ed.), DNA replication in eukaryotic cells. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 22.
|
Desbiez, C.,
C. David,
A. Mettouchi,
J. Laufs, and B. Gronenborn.
1995.
Rep protein of tomato yellow leaf curl geminivirus has an ATPase activity required for viral DNA replication.
Proc. Natl. Acad. Sci. USA
92:5640-5644[Abstract/Free Full Text].
|
| 23.
|
Dry, I. B.,
L. R. Krake,
J. E. Rigden, and M. A. Rezaian.
1997.
A novel subviral agent associated with a geminivirus: the first report of a DNA satellite.
Proc. Natl. Acad. Sci. USA
94:7088-7093[Abstract/Free Full Text].
|
| 24.
|
Fontes, E. P.,
P. A. Eagle,
P. S. Sipe,
V. A. Luckow, and L. Hanley-Bowdoin.
1994.
Interaction between a geminivirus replication protein and origin DNA is essential for viral replication.
J. Biol. Chem.
269:8459-8465[Abstract/Free Full Text].
|
| 25.
|
Fontes, E. P.,
H. J. Gladfelter,
R. L. Schaffer,
I. T. Petty, and L. Hanley-Bowdoin.
1994.
Geminivirus replication origins have a modular organization.
Plant Cell
6:405-416[Abstract].
|
| 26.
|
Fontes, E. P.,
V. A. Luckow, and L. Hanley-Bowdoin.
1992.
A geminivirus replication protein is a sequence-specific DNA binding protein.
Plant Cell
4:597-608[Abstract/Free Full Text].
|
| 27.
|
Franz, A.,
K. M. Makkouk,
L. Katul, and H. J. Vetten.
1996.
Monoclonal antibodies for the detection and differentiation of faba bean necrotic yellows virus isolates.
Ann. Appl. Biol.
128:255-268.
|
| 28.
|
Frisch, D. A.,
L. W. Harris-Haller,
N. T. Yokubaitis,
T. L. Thomas,
S. H. Hardin, and T. C. Hall.
1995.
Complete sequence of the binary vector Bin 19.
Plant Mol. Biol.
27:405-409[Medline].
|
| 29.
|
Gilbert, W., and D. Dressler.
1968.
DNA replication: the rolling circle model.
Cold Spring Harbor Symp. Quant. Biol.
33:473-484[Abstract/Free Full Text].
|
| 30.
|
Goodman, R. M.
1977.
Infectious DNA from a whitefly-transmitted virus of Phaseolus vulgaris.
Nature
266:54-55.
|
| 31.
|
Gruss, A., and S. D. Ehrlich.
1989.
The family of highly interrelated single-stranded deoxyribonucleic acid plasmids.
Microbiol. Rev.
53:231-241[Abstract/Free Full Text].
|
| 32.
|
Hafner, G. J.,
R. M. Harding, and J. L. Dale.
1997.
A DNA primer associated with banana bunchy top virus.
J. Gen. Virol.
78:479-486[Abstract].
|
| 33.
|
Hafner, G. J.,
M. R. Stafford,
L. C. Wolter,
R. M. Harding, and J. L. Dale.
1997.
Nicking and joining activity of banana bunchy top virus replication protein in vitro.
J. Gen. Virol.
78:1795-1799[Abstract].
|
| 34.
|
Hamel, A. L.,
L. L. Lin, and G. P. S. Nayar.
1998.
Nucleotide sequence of porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs.
J. Virol.
72:5262-5267[Abstract/Free Full Text].
|
| 35.
|
Hanson, S. F.,
R. A. Hoogstraten,
P. Ahlquist,
R. L. Gilbertson,
D. R. Russell, and D. P. Maxwell.
1995.
Mutational analysis of a putative NTP-binding domain in the replication-associated protein (AC1) of bean golden mosaic geminivirus.
Virology
211:1-9[Medline].
|
| 36.
|
Harding, R. M.,
T. M. Burns,
G. Hafner,
R. G. Dietzgen, and J. L. Dale.
1993.
Nucleotide sequence of one component of the banana bunchy top virus genome contains a putative replicase gene.
J. Gen. Virol.
74:323-328[Abstract/Free Full Text].
|
| 37.
|
Harrison, B. D.,
H. Barker,
K. R. Bock,
E. J. Guthrie,
G. Meredith, and M. Atkinson.
1977.
Plant viruses with circular single-stranded DNA.
Nature
270:760-762.
|
| 38.
|
Hassel, B. A., and B. T. Brinton.
1996.
SV40 and polyomavirus DNA replication, p. 639-677.
In
M. L. DePamphilis (ed.), DNA replication in eukaryotic cells. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 39.
|
Heyraud, F.,
V. Matzeit,
S. Schaefer,
J. Schell, and B. Gronenborn.
1993.
The conserved nonanucleotide motif of the geminivirus stem-loop sequence promotes replicational release of virus molecules from redundant copies.
Biochimie
75:605-615[Medline].
|
| 40.
|
Heyraud-Nitschke, F.,
S. Schumacher,
J. Laufs,
S. Schaefer,
J. Schell, and B. Gronenborn.
1995.
Determination of the origin cleavage and joining domain of geminivirus Rep proteins.
Nucleic Acids Res.
23:910-916[Abstract/Free Full Text].
|
| 41.
|
Hoekema, A.,
P. R. Hirsch,
P. J. J. Hooykaas, and R. A. Schilperoort.
1983.
A binary plant vector strategy based on separation of vir- and T-region of Agrobacterium tumefaciens Ti-plasmid.
Nature
303:179-180.
|
| 42.
|
Hoogstraten, R. A.,
S. F. Hanson, and D. P. Maxwell.
1996.
Mutational analysis of the putative nicking motif in the replication-associated protein (AC1) of bean golden mosaic geminivirus.
Mol. Plant-Microbe Interact.
9:594-599[Medline].
|
| 43.
|
Horsch, R. B.,
S. G. Rogers, and R. T. Fraley.
1985.
Transgenic plants.
Cold Spring Harbor Symp. Quant. Biol.
50:433-437[Abstract/Free Full Text].
|
| 44.
|
Ilyina, T. V., and E. V. Koonin.
1992.
Conserved sequence motifs in the initiator proteins for rolling circle DNA replication encoded by diverse replicons from eubacteria, eucaryotes and archaebacteria.
Nucleic Acids Res.
20:3279-3285[Abstract/Free Full Text].
|
| 45.
|
Im, D. S., and N. Muzyczka.
1990.
The AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity.
Cell
61:447-457[Medline].
|
| 46.
|
Jupin, I.,
F. Hericourt,
B. Benz, and B. Gronenborn.
1995.
DNA replication specificity of TYLCV geminivirus is mediated by the amino-terminal 116 amino acids of the Rep protein.
FEBS Lett.
362:116-120[Medline].
|
| 47.
|
Karan, M.,
R. M. Harding, and J. L. Dale.
1994.
Evidence for two groups of banana bunchy top virus isolates.
J. Gen. Virol.
75:3541-3546[Abstract/Free Full Text].
|
| 48.
|
Katul, L.,
E. Maiss,
S. Y. Morozov, and H. J. Vetten.
1997.
Analysis of six DNA components of the faba bean necrotic yellows virus genome and their structural affinity to related plant virus genomes.
Virology
233:247-259[Medline].
|
| 49.
|
Katul, L.,
E. Maiss, and H. J. Vetten.
1995.
Sequence analysis of a faba bean necrotic yellows virus DNA component containing a putative replicase gene.
J. Gen. Virol.
76:475-479[Abstract/Free Full Text].
|
| 50.
|
Katul, L.,
T. Timchenko,
B. Gronenborn, and H. J. Vetten.
1998.
Ten distinct circular ssDNA components, four of which encode putative replication-associated proteins, are associated with the faba bean necrotic yellows virus genome.
J. Gen. Virol.
79:3101-3109[Abstract].
|
| 51.
|
Kornberg, A., and T. A. Baker.
1992.
DNA replication, 2nd ed.
W. H. Freeman, New York, N.Y
|
| 52.
|
Laufs, J.,
I. Jupin,
C. David,
S. Schumacher,
F. Heyraud-Nitschke, and B. Gronenborn.
1995.
Geminivirus replication: genetic and biochemical characterization of Rep protein function, a review.
Biochimie
77:765-773[Medline].
|
| 53.
|
Laufs, J.,
S. Schumacher,
N. Geisler,
I. Jupin, and B. Gronenborn.
1995.
Identification of the nicking tyrosine of geminivirus Rep protein.
FEBS Lett.
377:258-262[Medline].
|
| 54.
|
Laufs, J.,
W. Traut,
F. Heyraud,
V. Matzeit,
S. G. Rogers,
J. Schell, and B. Gronenborn.
1995.
In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus.
Proc. Natl. Acad. Sci. USA
92:3879-3883[Abstract/Free Full Text].
|
| 55.
|
Lazarowitz, S. G.
1992.
Geminiviruses: genome structure and function.
Crit. Rev. Plant Sci.
11:327-349.
|
| 56.
|
Mankertz, A.,
J. Mankertz,
K. Wolf, and H. J. Buhk.
1998.
Identification of a protein essential for replication of porcine circovirus.
J. Gen. Virol.
79:381-384[Abstract].
|
| 57.
|
Marsin, S., and P. Forterre.
1998.
A rolling circle replication initiator protein with a nucleotidyl-transferase activity encoded by the plasmid pGT5 from the hyperthermophilic archaeon Pyrococcus abyssi.
Mol. Microbiol.
27:1183-1192[Medline].
|
| 58.
|
Maxam, A. M., and W. Gilbert.
1980.
Sequencing end-labeled DNA with base-specific chemical cleavages.
Methods Enzymol.
65:499-560[Medline].
|
| 59.
|
McCarty, D. M.,
T.-H. Ni, and N. Muzyczka.
1992.
Analysis of mutations in adeno-associated virus Rep protein in vivo and in vitro.
J. Virol.
66:4050-4057[Abstract/Free Full Text].
|
| 60.
|
Meehan, B. M.,
J. L. Creelan,
M. S. McNulty, and D. Todd.
1997.
Sequence of porcine circovirus DNA: affinities with plant circoviruses.
J. Gen. Virol.
78:221-227[Abstract].
|
| 61.
|
Mozo, T., and P. J. Hooykaas.
1991.
Electroporation of megaplasmids into Agrobacterium.
Plant Mol. Biol.
16:917-918[Medline].
|
| 62.
|
Niagro, F. D.,
A. N. Forsthoefel,
R. P. Lawther,
L. Kamalanathan,
B. W. Ritchie,
K. S. Latimer, and P. D. Lukert.
1998.
Beak and feather disease virus and porcine circovirus genomes: intermediates between the geminiviruses and plant circoviruses.
Arch. Virol.
143:1723-1744[Medline].
|
| 63.
|
Ooms, G.,
P. J. Hooykaas,
R. J. Van Veen,
P. Van Beelen,
T. J. Regensburg-Tuink, and R. A. Schilperoort.
1982.
Octopine Ti-plasmid deletion mutants of Agrobacterium tumefaciens with emphasis on the right side of the T-region.
Plasmid
7:15-29[Medline].
|
| 64.
|
Orozco, B. M.,
H. J. Gladfelter,
S. B. Settlage,
P. A. Eagle,
R. N. Gentry, and L. Hanley-Bowdoin.
1998.
Multiple cis elements contribute to geminivirus origin function.
Virology
242:346-356[Medline].
|
| 65.
|
Orozco, B. M., and L. Hanley-Bowdoin.
1998.
Conserved sequence and structural motifs contribute to the DNA binding and cleavage activities of a geminivirus replication protein.
J. Biol. Chem.
273:24448-24456[Abstract/Free Full Text].
|
| 66.
|
Orozco, B. M.,
A. B. Miller,
S. B. Settlage, and L. Hanley-Bowdoin.
1997.
Functional domains of a geminivirus replication protein.
J. Biol. Chem.
272:9840-9846[Abstract/Free Full Text].
|
| 67.
|
Pringle, C. R.
1998.
Virus taxonomy San Diego 1998.
Arch. Virol.
143:1449-1459[Medline].
|
| 68.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 69.
|
Sanders, C. M., and A. Stenlund.
1998.
Recruitment and loading of the E1 initiator protein: an ATP-dependent process catalysed by a transcription factor.
EMBO J.
17:7044-7055[Medline].
|
| 70.
|
Sano, Y.,
M. Wada,
Y. Hashimoto,
T. Matsumoto, and M. Kojima.
1998.
Sequences of ten circular ssDNA components associated with the milk vetch dwarf virus genome.
J. Gen. Virol.
79:3111-3118[Abstract].
|
| 71.
|
Sanz-Burgos, A. P., and C. Gutiérrez.
1998.
Organization of the cis-acting element required for wheat dwarf geminivirus DNA replication and visualization of a Rep protein-DNA complex.
Virology
243:119-129[Medline].
|
| 72.
|
Smith, R. H.,
A. J. Spano, and R. M. Kotin.
1997.
The Rep78 gene product of adeno-associated virus (AAV) self-associates to form a hexameric complex in the presence of AAV ori sequences.
J. Virol.
71:4461-4471[Abstract].
|
| 73.
|
Stahl, H.,
P. Droge, and R. Knippers.
1986.
DNA helicase activity of SV40 large tumor antigen.
EMBO J.
5:1939-1944[Medline].
|
| 74.
|
Stenger, D. C.
1998.
Replication specificity elements of the Worland strain of beet curly top virus are compatible with those of the CFH strain but not those of the Cal/Logan strain.
Phytopathology
88:1174-1178[Medline].
|
| 75.
|
Studier, F. W.,
A. H. Rosenberg,
J. J. Dunn, and J. W. Dubendorff.
1990.
Use of T7 RNA polymerase to direct expression of cloned genes.
Methods Enzymol.
185:60-89[Medline].
|
| 76.
|
Tischer, I.,
H. Gelderblom,
W. Vettermann, and M. A. Koch.
1982.
A very small porcine virus with circular single-stranded DNA.
Nature
295:64-66[Medline].
|
| 77.
|
Walker, J. E.,
M. Saraste,
M. J. Runswick, and N. J. Gay.
1982.
Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold.
EMBO J.
1:945-951[Medline].
|
| 78.
|
Weisshart, K.,
P. Taneja, and E. Fanning.
1998.
The replication protein A binding site in simian virus 40 (SV40) T antigen and its role in the initial steps of SV40 DNA replication.
J. Virol.
72:9771-9781[Abstract/Free Full Text].
|
| 79.
| Wu, R. Y., and L. R. You. Nucleotide
sequence of DNA III and DNA IV associated with banana bunchy top virus
and their relation to other closely related virus DNAs. GenBank
accession no. U12586 and U12587.
|
| 80.
|
Wu, R. Y.,
L. R. You, and T. S. Soong.
1994.
Nucleotide sequences of two circular single-stranded DNAs associated with banana bunchy top virus.
Phytopathology
84:952-958.
|
| 81.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
| 82.
|
Yasukawa, H.,
T. Hase,
A. Sakai, and Y. Masamune.
1991.
Rolling-circle replication of the plasmid pKYM isolated from a gram-negative bacterium.
Proc. Natl. Acad. Sci. USA
88:10282-10286[Abstract/Free Full Text].
|
Journal of Virology, December 1999, p. 10173-10182, Vol. 73, No. 12
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Grigoras, I., Timchenko, T., Katul, L., Grande-Perez, A., Vetten, H.-J., Gronenborn, B.
(2009). Reconstitution of Authentic Nanovirus from Multiple Cloned DNAs. J. Virol.
83: 10778-10787
[Abstract]
[Full Text]
-
Grigoras, I., Timchenko, T., Gronenborn, B.
(2008). Transcripts encoding the nanovirus master replication initiator proteins are terminally redundant. J. Gen. Virol.
89: 583-593
[Abstract]
[Full Text]
-
Steinfeldt, T., Finsterbusch, T., Mankertz, A.
(2007). Functional Analysis of cis- and trans-Acting Replication Factors of Porcine Circovirus Type 1. J. Virol.
81: 5696-5704
[Abstract]
[Full Text]
-
Lageix, S., Catrice, O., Deragon, J.-M., Gronenborn, B., Pelissier, T., Ramirez, B. C.
(2007). The Nanovirus-Encoded Clink Protein Affects Plant Cell Cycle Regulation through Interaction with the Retinoblastoma-Related Protein. J. Virol.
81: 4177-4185
[Abstract]
[Full Text]
-
Hu, J.-M., Fu, H.-C., Lin, C.-H., Su, H.-J., Yeh, H.-H.
(2007). Reassortment and Concerted Evolution in Banana Bunchy Top Virus Genomes. J. Virol.
81: 1746-1761
[Abstract]
[Full Text]
-
Herrera-Valencia, V. A., Dugdale, B., Harding, R. M., Dale, J. L.
(2006). An iterated sequence in the genome of Banana bunchy top virus is essential for efficient replication.. J. Gen. Virol.
87: 3409-3412
[Abstract]
[Full Text]
-
Steinfeldt, T., Finsterbusch, T., Mankertz, A.
(2006). Demonstration of nicking/joining activity at the origin of DNA replication associated with the rep and rep' proteins of porcine circovirus type 1.. J. Virol.
80: 6225-6234
[Abstract]
[Full Text]
-
Timchenko, T., Katul, L., Aronson, M., Vega-Arreguin, J. C., Ramirez, B. C., Vetten, H. J., Gronenborn, B.
(2006). Infectivity of nanovirus DNAs: induction of disease by cloned genome components of Faba bean necrotic yellows virus. J. Gen. Virol.
87: 1735-1743
[Abstract]
[Full Text]
-
Vega-Arreguin, J. C., Timchenko, T., Gronenborn, B., Ramirez, B. C.
(2005). A Functional Histidine-Tagged Replication Initiator Protein: Implications for the Study of Single-Stranded DNA Virus Replication In Planta. J. Virol.
79: 8422-8430
[Abstract]
[Full Text]
-
Saunders, K., Bedford, I. D., Stanley, J.
(2002). Adaptation from whitefly to leafhopper transmission of an autonomously replicating nanovirus-like DNA component associated with ageratum yellow vein disease. J. Gen. Virol.
83: 907-913
[Abstract]
[Full Text]
-
Horser, C. L., Harding, R. M., Dale, J. L.
(2001). Banana bunchy top nanovirus DNA-1 encodes the 'master' replication initiation protein. J. Gen. Virol.
82: 459-464
[Abstract]
[Full Text]
-
Merits, A., Fedorkin, O. N., Guo, D., Kalinina, N. O., Morozov, S. Yu.
(2000). Activities associated with the putative replication initiation protein of Coconut foliar decay virus, a tentative member of the genus Nanovirus. J. Gen. Virol.
81: 3099-3106
[Abstract]
[Full Text]
-
Saunders, K., Bedford, I. D., Briddon, R. W., Markham, P. G., Wong, S. M., Stanley, J.
(2000). A unique virus complex causes Ageratum yellow vein disease. Proc. Natl. Acad. Sci. USA
97: 6890-6895
[Abstract]
[Full Text]
-
Aronson, M. N., Meyer, A. D., Györgyey, J., Katul, L., Vetten, H. J., Gronenborn, B., Timchenko, T.
(2000). Clink, a Nanovirus-Encoded Protein, Binds both pRB and SKP1. J. Virol.
74: 2967-2972
[Abstract]
[Full Text]