Previous Article | Next Article ![]()
Journal of Virology, November 1999, p. 9619-9624, Vol. 73, No. 11
HIV/AIDS and Retrovirology Branch, Division
of AIDS, STD, and TB Laboratory Research, National Center for
Infectious Diseases, Centers for Disease Control and Prevention,
Atlanta, Georgia 30333
Received 8 April 1999/Accepted 11 August 1999
Although foamy viruses (FVs) are endemic among nonhuman primates,
FV infection among humans is rare. Recently, simian foamy virus (SFV)
infection was reported in 4 of 231 individuals occupationally exposed
to primates (1.8%). Secondary transmission to spouses has not been
seen, suggesting that while FV is readily zoonotic, humans may
represent dead-end hosts. Among different simian species, SFV
demonstrates significant sequence diversity within the U3 region of the
long terminal repeat (LTR) and 3' accessory open reading frames (ORFs).
To examine if persistent human SFV infection and apparent lack of
secondary transmission are associated with genetic adaptations in FV
regulatory regions, we conducted sequence analysis of the LTR, internal
promoter, ORF-1, and ORF-2 on a tissue culture isolate and peripheral
blood mononuclear cell samples from a human infected with SFV of
African green monkey origin (SFV-3). Compared to the prototype SFV-3
sequence, the LTR, internal promoter, and FV transactivator (ORF-1)
showed sequence conservation, suggesting that FV zoonosis is not
dependent on host-specific adaptation to these transcriptionally
important regions. However, ORF-2 contains a number of deleterious
mutations predicted to result in premature termination of protein
synthesis. ORF-2 codes in part for the 60-kDa Bet fusion protein,
proposed to be involved in the establishment of persistent cellular SFV
infections. These results suggest that persistent human infection by
SFV and reduced transmissibility may be influenced by the absence of a
functional ORF-2.
Foamy viruses (FVs)
(Spumavirinae) represent a unique genus of retrovirus,
endemic in a number of mammalian species, including nonhuman primates,
cats, rodents, and cows (20, 25, 36). Extremely cytopathic
in vitro, FVs have yet to be associated with any disease pathology in
their natural hosts. FVs appear to transmit readily via infectious
saliva, resulting in infection rates as high as 70 to 90% in some
species of nonhuman primates (28). Despite common evolution
and cohabitation with lower primates, FV infection is not endemic in
humans. Although an FV referred to as human foamy virus (HFV) was
reportedly isolated from cultures of a nasopharnygeal carcinoma taken
from a Kenyan patient (1, 12), the lack of evidence of
antibodies to HFV in widespread and diverse human populations and the
high degree of sequence relatedness between HFV and the strain of
simian foamy virus (SFV) found in chimpanzees has led to suggestions
that HFV may not be of human origin (3, 20, 21, 41, 42). It
has recently been reported that humans occupationally exposed to
nonhuman primates demonstrate a substantial prevalence (1.8%) of SFV
infection, suggesting that SFV is readily zoonotic (19).
Consistent with the lack of widespread FV infection in human
populations, there is no evidence of secondary transmission to exposed
spouses, suggesting that humans may represent dead-end hosts for SFV infection.
Known human retroviruses likely arose from the zoonotic transmission
and subsequent adaptation of retroviruses found in Old World primates
(10, 14, 17). The considerable period of time between the
identification of each of these human retroviruses and the initial
zoonotic events responsible for their establishment in humans,
precludes the investigation of the earliest adaptive changes which
occur during persistent infection of the new human host. The
identification of SFV-infected individuals provides a unique
opportunity to examine changes associated with retroviruses after
zoonotic transmission from the natural host into humans. Evidence of
SFV infection in all four cases reported among occupationally exposed
animal handlers included seropositivity and proviral DNA detection by
PCR (19). An SFV-3-like virus was subsequently isolated from
one individual who was severely bitten by an African green monkey prior
to 1975 and who demonstrated seropositivity since 1995, the earliest
time point for which material was available (19). The
derivation of this isolate, designated SFVHU-1, confirms long-term persistent infection of this individual with a
replication-competent SFV. Here, we present evidence suggesting that
while the long terminal repeat (LTR) and the orf-1 accessory
gene of SFV-3 demonstrate significant sequence stability upon
cross-species infection, the orf-2/bet gene does not appear
to be required for the establishment of a persistent infection in this individual.
The FV genome codes for Gag, Pol, and Env structural proteins and for
two or three accessory genes located between env and the 3'
LTR (13, 32, 33). Unique among retroviruses is the presence
of an internal promoter located within the 3' end of the env
gene which functions to independently drive the expression of the
accessory open reading frames (ORFs) (7, 22, 23). The 5'
proximal FV accessory gene (orf-1) codes for the FV Tas (or
Bel-1) transactivator protein which functions to facilitate FV
transcription through cis-acting response elements found in both the LTR U3 region as well as the internal promoter (13, 29,
31-33). The function of the second accessory ORF is currently unknown, although a 44-kDa protein believed to be encoded by
orf-2 has been identified in cells infected with HFV
(15). Alternate mRNA splicing results in a third HFV
accessory protein generated by the fusion of the N-terminal 88 amino
acids of orf-1 with the complete orf-2. The
resulting fusion protein of approximately 60 kDa, referred to as Bet,
is expressed at high levels within infected cells (4, 13,
39). Deletion analysis has revealed that only orf-1 is
mandatory for replication competence (34). The deletion of
orf-2/bet, although permissive for viral replication, reduces virus replication in vitro (4, 46, 47). While it has
been speculated that orf-2/bet may be required for viral
replication in vivo, animal studies involving deletion mutant viruses
have not been reported to date. Bet protein secreted from cells
persistently infected with HFV can subsequently be taken up by
uninfected cells, while cells which stably express Bet are resistant to
FV-induced lysis, suggesting that Bet may behave as a virokine by
impairing viral infection (16, 35). Bet expression in the
absence of structural gene expression has been associated with
persistent HFV infection, while HFV mutant viruses, which lack an
intact Bet gene, are apparently unable to establish chronic infections in vitro (16, 35, 37). Together these results imply a role for Bet in the establishment and control of viral persistence.
SFV endemic to different species of simians demonstrate the greatest
level of genome sequence diversity within the U3 region of the LTR and
3' ORFs (13). To examine if persistent human SFV infection
and the apparent lack of secondary transmission are associated with
genetic adaptations in FV regulatory regions, we conducted sequence
analysis of the LTR, internal promoter, orf-1, and
orf-2 of SFVHU-1. The complete nucleotide
sequence for SFV-3 has previously been published, enabling comparisons to be made with this zoonotic form of SFV-3 (30). The
SFVHU-1 template DNA used for sequence analysis was derived
from infected Cf2Th canine thymocyte cultures. Infected cells were
lysed in 10 mM Tris-HCl (pH 8.3), 0.05% Triton X-100, and 100 µg of
proteinase K/ml by incubation at 56°C for 1 h. Twenty
microliters of infected Cf2Th lysate was used in a 100-µl PCR volume
containing 2 mM MgCl2, 200 mM dinucleoside triphosphates, 1 U of Taq polymerase, and 100 ng each of oligonucleotide
primer. PCR was performed in a Perkin-Elmer thermocycler 9600. Reaction
conditions include an initial denaturization step at 94°C for 2 min,
followed by 35 cycles with incubations at 94°C for 30 s, 50°C
for 30 s, and 72°C for 1 min, with a final incubation at 72°C
for 5 min.
Primers were synthesized based on SFV-3 sequence to amplify the LTR,
envelope, orf-1, and orf-2 regions of
SFVHU-1 (Fig. 1). A series of
overlapping amplicons were generated and sequenced with the following
primer pairs: SLF2/SLR4, SLF3/SLR5, SLF2/SLR1, SLF2/SLR5, SLF3/SLR1,
SLF5/SLR3, SEF2/SER1, SEF4/SBR1, SEF3/SER2, SEF4/SBR1, SBF1/SBR2,
SBF2/SBR3, SBF2/SLR3, and SBF2/SLR4. The PCR fragments were either
sequenced directly or cloned into the pGEM T easy vector from Promega
(Madison, Wis.). At least two independent clones and/or amplicons were
sequenced in each region. Sequencing was performed using either ABI
Prism Dye Terminator or the Big Dye Terminator Cycle Sequencing Ready
Reaction Kit as specified by the manufacturer (PE Applied Biosystems,
Foster City, Calif.). An additional sequencing primer, SB5F3, 5'
GGATCTATTGGTCATTGTGC 3' (nucleotides [nt] 11179 to 11198),
was used for sequencing orf-2. The GenBank accession numbers
of other FVs used for comparison and analysis include: SFV-3 (M74895),
SFV-1 (M33561), HFV (Y07725), and SFVcpz (U04327). Sequence analysis
was performed with the Wisconsin Package, version 9.1, (Genetics
Computer Group, Madison, Wis.).
0022-538X/99/$04.00+0
Persistent Zoonotic Infection of a Human with
Simian Foamy Virus in the Absence of an Intact orf-2
Accessory Gene
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
![]()
View larger version (8K):
[in a new window]
FIG. 1.
Sequencing of the accessory genes and the regulatory
regions of SFVHU-1. The locations of the primers used for
PCR and sequencing are shown above. The primers and their locations
based on SFV-3 base numbers are as follows: SLF5, 5'
CCCAGGAAAAGGATTATTGG 3' (SFV-3 nt 31 to 50/11434 to 11453);
SLF2, 5' AACGACTGAGTGACATGAAG 3' (nt 11940 to 11960); SLF3,
5' GCACAGTAAATTAAGCTAGCAG 3' (nt 12232 to 12253); SLF4, 5'
ACTGCTCGCTGCGTCGAGAG 3' (nt 12746 to 12766); SLR3, 5'
CTAGTGGCTCCTATTGAGAG 3' (nt 11974 to 11993); SLR4, 5'
ATTAAAGGGATTCGAACTAC 3' (nt 12280 to 12299); SLR5, 5'
TTACCAAGCCTGGAGAGACTCG 3' (nt 12770 to 12791); SLR1, 5'
TCCTTAAAGAATTCCACCTC 3' (nt 13066 to 13086); SEF2, 5'
AATGATGAAAGGTTACAACAAGG 3' (nt 8865 to 8887); SEF3, 5'
TAGGTCATCTTGTTGAGTCAGCTGG 3' (nt 9242 to 9265); SEF4, 5'
AAAGATCAGATTGAAAGAGC 3' (nt 9735 to 9754); SER1, 5'
TCACAAATCACATAATCTTG 3' (nt 9369 to 9380); SER2, 5'
GTTACCTATGCCTTGAAGAGC 3' (nt 9858 to 9878); SBR1, 5'
TATATAGTCCACAAAGAATAAG 3' (nt 10292 to 10313); SBF1, 5'
AGAAATTGGGTTCCTGATCC 3' (nt 10241 to 10260); SBF2, 5'
ATGTCTGGAGGACCCTTCTGG3' (nt 10820 to 10841); SBR2, 5'
CCTAATTTTCACTAGGCCCAG 3' (nt 10878 to 10898); SBR3, 5'
CTTCCATGCTGAGGTCCATAAGC 3' (nt 11368 to 11390).
SFV-3 has two accessory genes located between env and the 3' LTR, similar to what has been reported for SFV-1 and differing from the three accessory ORFs described for HFV (30, 44). The first accessory ORF of SFV-3 encodes a 298-amino-acid protein which has been shown to function as the viral transactivator (26, 29, 31). Amino acid identity between SFV-3 orf-1 and the equivalent tas gene of SFV-1 and HFV is 52 and 38%, respectively. Sequence homologies between the transactivators of SFVHU-1 and SFV-3 are 83% identical at the nucleic acid level and 81% identical at the amino acid level (Fig. 2). The ratio of synonymous to nonsynonymous mutations between orf-1 of SFVHU-1 and that of SFV-3 is 0.2, suggesting that this region has most likely been placed under negative selective pressures to remain unchanged after zoonosis. Together, these data suggest that zoonosis and persistent human infection do not require or result in significant changes within the viral transactivator.
|
The SFV-3 orf-1 transactivator mediates viral transcription through response elements located within the internal promoter and U3 region of the LTR (31). The LTRs of FV tend to be large, ranging in length from 1,600 to 1,700 bp (13). SFVs endemic to different species of simians demonstrate a high degree of sequence conservation within the R and U5 regions of the LTR, while sequence divergence tends to be predominate within the U3 region (13). Moreover, the U3 region of HFV is particularly prone to deletion mutations during both in vitro as well as in vivo replication, suggesting that deletions within this region of the LTR may be associated with viral persistence during chronic HFV infection (8, 40). SFVHU-1 maintains a high degree of identity to SFV-3 in both the LTR and internal promoters (Fig. 2). At 92% identity, the LTRs of SFVHU-1 and SFV-3 are more similar than what has been reported for two independent African green monkey SFV isolates (6), implying that this cross-species infection into a human does not require significant changes within the LTR.
While the U3 region of the SFV-3 LTR is reportedly devoid of consensus sequence motifs for known cellular transcription factors (31), the LTR of HFV contains several Jun/Fos binding AP-1 sites as well as two Ets-1 sites located at bases 325 to 431 and bases 364 to 369. These Ets-1 sites bind a class of lymphocyte-specific transcription factors believed to confer a lymphotropic character on the promoter of HFV (40). Deletion of these sites in HFV results in diminished tissue culture kinetics in the H9 human T-cell line (40). Reanalysis of the published SFV-3 LTR sequence identifies the conservation of these Ets-1 sites at roughly the same location in the U3 of SFV-3, as well as an additional third Ets-1 site at bases 963 to 968. Point mutations in SFVHU-1 have abolished the first Ets-1 site, and a 13-bp deletion corresponding to bases 397 to 409 of SFV-3 has resulted in the loss of the second Ets-1 site in the U3 of SFVHU-1 (Fig. 2). The third putative Ets-1 site persists.
SFV-3 orf-2 is predicted to code for a protein of 388 amino acids, with 54% amino acid identity to orf-2 of SFV-1 and 38% identity to the analogous gene product in HFV. Overall, this region of SFVHU-1 shows close nucleic acid identity to that of SFV-3 (80%), supporting the proposed SFV-3 origin of the SFVHU-1 isolate (Fig. 2). However, orf-2 of SFVHU-1 has a number of deleterious mutations predicted to result in a loss of the ability of orf-2 to code for a functional protein. An ATG to ACA mutation in the predicted start codon is expected to result in a loss of the normal start of translation for SFVHU-1 orf-2. However, even in the absence of these mutations, a 5-base insertion at position 11063 and the resulting frameshift mutation, coupled with downstream mutations, results in the generation of a premature stop codon at position 183 (Fig. 3).
|
Based on the SFVHU-1 sequence, two sets of nested primers were designed to amplify selected regions of orf-2 present in the peripheral blood mononuclear cells (PBMCs) from the infected individual. Nested PCR was performed with 5 µl of the primary reaction mixture used in a 100-µl reaction mixture as described above. Primer pairs 51F1/51R1 and 51F2/51R2 amplified a region encompassing the start of orf-2. Primer pairs 52F1/52R1 and 52F2/52R2 amplified the section of orf-2 containing the deletion described above. The nested primers were used to sequence the PCR fragments generated. Primer sequences are given in the legend of Fig. 3.
All the mutations identified in the orf-2 region of SFVHU-1 were confirmed in PBMCs from the infected individual, with the exception that the 5-bp insertion in SFVHU-1 is represented by a 4-bp insertion at the same site, resulting in the generation of a translational stop codon at position 191. These data were generated by eight independent sequencing reactions performed on two separate PCRs using PBMCs from different time points. The identification of similar mutations within SFVHU-1 isolated from this individual suggests that they are associated with a replication-competent virus rather than a defective form of FV. At this time it is unclear if the 1-bp difference in insertion size is indicative of the chance isolation of a minor quasispecies in the infected individual or if the additional single base insertion was acquired during isolation or tissue culture passaging of the virus. Since PBMCs were the only tissue available for analysis, it is not possible to preclude the existence of a viral species with a functional orf-2 in other tissues.
Proteins analogous to Bet have been described for SFV-3 (24). Mutation in orf-2 of SFVHU-1 is predicted to result in the truncation of the entire orf-2 portion of the SFVHU-1 Bet protein because of the generation of a stop codon. Definitive analysis of the translational pattern of the accessory genes of SFVHU-1 awaits the development of specific immunologic reagents. With the material available, it is not possible to determine whether these changes are required for, or result from, human infection by SFV. However, they do indicate that human infection with FV can occur in the absence of a complete complement of accessory genes. These regions are being examined in additional SFV-infected individuals to further elucidate the role of SFV accessory genes in zoonosis and persistent infection.
To characterize the cellular reservoirs for persistent FV infection
within the PBMCs of this individual, monocyte, B-cell, CD4 T-cell, and
CD8 T-cell subsets were positively selected by using immunomagnetic
beads directly conjugated with antibodies to CD19, CD14, CD4, and CD8
(Dynal). Prior to selection, PBMCs were stained with fluorescent-tagged
antibodies and analyzed by FACScan Cell Quest software
(Becton-Dickinson) to determine the percentage of cells in the total
population. Approximate cell numbers were calculated based on the
percentage of cells and the total cell count. Directly conjugated
immunomagnetic beads were used in 10-fold excess of the approximate
cell count to positively select each PBMC subset. Void volume from the
positive selection was retained for the positive selection of the next
subset. PBMCs bound to immunomagnetic beads were washed once with
phosphate-buffered saline containing 1% fetal bovine serum and lysed
for PCR at a concentration of 6 × 106 cells per ml.
This process was repeated until each specific subset was selected,
beginning with CD19 selection, followed by CD14 selection, CD4
selection, and finally CD8 selection. After each positive selection,
approximately 2 × 105 cells from the void volume were
stained with fluorescent-tagged antibodies directed against the
population previously selected to confirm depletion of the population.
Samples were stored at
70°C for PCR analysis of SFV proviral
pol sequences as described elsewhere (2, 19). PCR
analysis revealed the presence of SFV proviral pol gene
sequences in both monocytes and B cells from the infected individual,
with the absence of SFV in both CD4+ and CD8+ T
lymphocytes (Fig. 4A). Analysis of human
beta-globulin gene sequences ensured that for each cellular subset,
amplifiable DNA was present and intact (Fig. 4B). These results differ
from what has been reported in other studies, where positive selection
on different aliquots of PBMCs identified CD8+ lymphocytes
as the major cellular reservoir for FV in African green monkeys,
chimpanzees, and two human infections (43). While FV was
found exclusively in the CD8 cells of infected humans, differential
infection of B cells, monocytes, and polymorphonuclear leukocytes was
reported for infected monkeys, suggesting that other cell types may be
permissive to SFV infection in vivo. SFVHU-1 differs from
SFV-3 in that it cannot grow in the SupT.1 human T-cell line (data not
shown). The small changes in the LTR may be responsible for the lack of
SFVHU-1 infection of T cells in vitro and in vivo.
Transfection experiments using LTR/reporter gene constructs may be
necessary to confirm this.
|
The demonstration of persistent human infection by SFV in the absence of an intact orf-2/bet has implications for the proposed use of FVs as viral vectors for gene therapy and novel recombinant vaccine applications (5, 9, 18, 27, 45). The dispensability of orf-2/bet for HFV replication in vitro has led to the development of several replication-competent FV vector systems in which the orf-2/bet region is replaced with foreign DNA (38). To date, the in vivo growth characteristics of these vectors have not been reported. Our data suggest that replication-competent FV vectors lacking an intact orf-2/bet may be capable of establishing long-term infections in humans. Recently, a number of retrovirus vectors based on HIV-1 have been reported in the literature, although vector stability and safety have remained a concern (11). In addition to the lack of disease in and secondary transmission from people infected with SFV, the apparent long-term stability of regulatory elements during persistent human infection would also be advantageous for vector applications based on SFV.
Nucleotide sequence accession number. The GenBank accession number for the SFVHU-1 sequences is AF18200.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported in part by the Emerging Infectious Diseases Fellowship Program administered by the Centers for Disease Control and Prevention and the Association of Public Health Laboratories.
| |
FOOTNOTES |
|---|
* Corresponding author. Present address: Bureau of HIV/AIDS, STD & TB, LCDC, Health Canada, Ottawa, Ontario, Canada K1A 0L2. Phone: (613) 957-8060. Fax: (613) 957-7258. E-mail: Paul_Sandstrom{at}hc-sc.gc.ca.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Achong, B. G., P. W. A. Mansell, M. A. Epstein, and P. Clifford. 1971. An unusual virus in cultures from a human nasopharyngeal carcinoma. J. Natl. Cancer Inst. 46:299-307. |
| 2. | Allan, J. S., S. R. Broussard, M. G. Michaels, T. E. Starzl, K. L. Leighton, E. M. Whitehead, A. G. Comuzzie, R. E. Lanford, M. M. Leland, W. M. Switzer, and W. Heneine. 1998. Amplification of simian retroviral sequences from human recipients of baboon liver transplants. AIDS Res. Hum. Retroviruses 14:821-824[Medline]. |
| 3. | Ali, M., G. P. Taylor, R. J. Pitman, D. Parker, A. Rethwilm, R. Cheingsong-Popov, J. N. Weber, P. D. Bieniasz, J. Bradley, and M. O. McClure. 1996. No evidence of antibody to human foamy virus in widespread human populations. AIDS Res. Hum. Retroviruses 12:1473-1483[Medline]. |
| 4. |
Baunach, G.,
B. Maurer,
H. Hahn,
M. Kranz, and A. Rethwilm.
1993.
Functional analysis of human foamy virus accessory reading frames.
J. Virol.
67:5411-5418 |
| 5. | Bieniasz, P. D., O. Irlwein, A. Aguzzi, A. Rethwilm, and M. O. McClure. 1997. Gene transfer using replication-defective human foamy virus vectors. Virology 235:65-72[Medline]. |
| 6. | Broussard, S. R., A. G. Comuzzie, K. L. Leighton, M. M. Leland, E. M. Whitehead, and J. S. Allan. 1997. Characterization of new simian foamy viruses from African nonhuman primates. Virology 237:349-359[Medline]. |
| 7. |
Campbell, M.,
L. Renshaw-Gegg,
R. Renne, and P. A. Luciw.
1994.
Characterization of the internal promoter of simian foamy viruses.
J. Virol.
68:4811-4820 |
| 8. | De Celis-Kosmas, J., A. Coronel, I. Grigorian, R. Emanoil-Ravier, and J. Tobaly-Tapiero. 1997. Non-random deletions in human foamy virus long terminal repeat during viral infection. Arch. Virol. 142:1237-1246[Medline]. |
| 9. |
Dittmer, U.,
D. M. Brooks, and K. J. Hasenkrug.
1998.
Characterization of a live-attenuated retroviral vaccine demonstrates protection via immune mechanisms.
J. Virol.
72:6554-6558 |
| 10. | Doolittle, R. F. 1989. Immunodeficiency viruses: the simian-human connection. Nature 339:338-339[Medline]. |
| 11. |
Dull, T.,
R. Zufferey,
M. Kelly,
R. J. Mandel,
M. Nguyen,
D. Trono, and L. Naldini.
1998.
A third-generation lentivirus vector with a conditional packaging system.
J. Virol.
72:8463-8471 |
| 12. | Epstein, M. A., B. G. Achong, and G. Ball. 1974. Further observations on a human syncytial virus from a nasopharyngeal carcinoma. J. Natl. Cancer Inst. 53:681-688. |
| 13. | Flugel, R. M. 1993. The molecular biology of the human spumavirus., p. 193-214. In B. R. Cullen (ed.), Human retroviruses IRL Press, Oxford, United Kingdom. |
| 14. | Gao, F., L. Yue, A. T. White, P. G. Pappas, J. Barchue, A. P. Hanson, B. M. Greene, P. M. Sharp, G. M. Shaw, and B. H. Hahn. 1992. Human infection by genetically diverse SIVSM-related HIV-2 in west Africa. Nature 358:495-499[Medline]. |
| 15. |
Giron, M.-L.,
F. Rozain,
M. C. Debons-Guillemin,
M. Canivet,
J. Peries, and R. Emanoil-Ravier.
1993.
Human foamy virus polypeptides: identification of env and bel gene products.
J. Virol.
67:3596-3600 |
| 16. |
Giron, M.-L.,
H. de The, and A. Saib.
1998.
An evolutionarily conserved splice generates a secreted Env-Bet fusion protein during human foamy virus infection.
J. Virol.
72:4906-4910 |
| 17. | Goubau, P., A. M. Vandamme, and J. Desmyter. 1996. Questions on the evolution of primate T-lymphotropic viruses raised by molecular and epidemiological studies of divergent strains. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 13:S242-S247. |
| 18. |
Heinkelein, M.,
M. Schmidt,
N. Fischer,
A. Moebes,
D. Lindemann,
J. Enssle, and A. Rethwilm.
1998.
Characterization of a cis-acting sequence in the pol region required to transfer human foamy virus vectors.
J. Virol.
72:6307-6314 |
| 19. | Heneine, W., W. M. Switzer, P. Sandstrom, J. Brown, S. Vedapuri, C. A. Schable, A. S. Khan, N. W. Lerche, M. Schweizer, D. Neumann-Haefelin, L. E. Chapman, and T. M. Folks. 1998. Identification of a human population infected with simian foamy viruses. Nat. Med. 4:403-407[Medline]. |
| 20. | Herchenroder, O., R. Renne, D. Loncar, E. K. Cobb, K. K. Murthy, J. Schneider, A. Mergia, and P. A. Luciw. 1994. Isolation, cloning, and sequencing of simian foamy viruses from chimpanzees (SFVcpz): high homology to human foamy virus (HFV). Virology 201:187-199[Medline]. |
| 21. | Herchenroder, O., R. Turek, D. Neumann-Haefelin, A. Rethwilm, and J. Schneider. 1995. Infectious proviral clones of chimpanzee foamy virus (SFVcpz) generated by long PCR reveal close functional relatedness to human foamy virus. Virology 214:685-689[Medline]. |
| 22. |
Kang, Y.,
W. S. Blair, and B. R. Cullen.
1998.
Identification and functional characterization of a high-affinity Bel-1 DNA binding site located in the human foamy virus internal promoter.
J. Virol.
72:504-511 |
| 23. |
Kang, Y., and B. R. Cullen.
1998.
Derivation and functional characterization of a consensus DNA binding sequence for the Tas transcriptional activator of simian foamy virus type 1.
J. Virol.
72:5502-5509 |
| 24. | Lochelt, M., and R. M. Flugel. 1995. The molecular biology of human and primate spumaretroviruses., p. 239-292. In J. A. Levy (ed.), The Retroviridae, vol. 4. Plenum Press, New York, N.Y. |
| 25. | Loh, P. C. 1992. Spumaviruses., p. 361-397. In J. A. Levy (ed.), The Retroviridae, vol. 2. Plenum Press, New York, N.Y. |
| 26. |
Mergia, A.,
K. E. Shaw,
E. Pratt-Lowe,
P. A. Barry, and P. A. Luciw.
1991.
Identification of the simian foamy virus transcriptional transactivator gene (taf).
J. Virol.
65:2903-2909 |
| 27. | Nestler, U., M. Heinkelein, M. Lucke, J. Meixensberger, W. Scheurlen, A. Kretschmer, and A. Rethwilm. 1997. Foamy virus vectors for suicide gene therapy. Gene Ther. 4:1270-1277[Medline]. |
| 28. | Neumann-Haefelin, D., U. Fleps, R. Renne, and M. Schweizer. 1993. Foamy viruses. Intervirology 35:196-207[Medline]. |
| 29. | Renne, R., U. Fleps, P. A. Luciw, and D. Neumann-Haefelin. 1996. Transactivation of the two promoters of SFV-3 by different mechanisms. Virology 221:362-367[Medline]. |
| 30. | Renne, R., E. Friedl, M. Schweizer, U. Fleps, R. Turek, and D. Neumann-Haefelin. 1992. Genomic organization and expression of simian foamy virus type 3 (SFV-3). Virology 186:597-608[Medline]. |
| 31. | Renne, R., A. Mergia, L. W. Renshaw-Gegg, D. Neumann-Haefelin, and P. A. Luciw. 1993. Regulatory elements in the long terminal repeat (LTR) of simian foamy virus type 3 (SFV-3). Virology 192:365-369[Medline]. |
| 32. | Rethwilm, A. 1995. Regulation of foamy virus gene expression. Curr. Top. Microbiol. Immunol. 193:1-24[Medline]. |
| 33. | Rethwilm, A. 1996. Unexpected replication pathways of foamy viruses. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 13:S248-S253. |
| 34. | Saib, A., J. Peries, and H. de The. 1993. A defective human foamy provirus generated by pregenome splicing. EMBO J. 12:4439-4444[Medline]. |
| 35. | Saib, A., M. H. M. Koken, P. van der Spek, J. Peries, and H. de The. 1995. Involvement of a spliced and defective human foamy virus in the establishment of chronic infection. J. Virol. 69:5261-5268[Abstract]. |
| 36. | Saib, A., and H. de The. 1996. Molecular biology of the human foamy virus. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 13:S254-S260. |
| 37. | Saib, A., M. Neves, M.-L. Giron, M.-C. Guillemin, J. Valla, J. Peries, and M. Canivet. 1997. Long-term persistent infection of domestic rabbits by the human foamy virus. Virology 228:263-268[Medline]. |
| 38. | Schmidt, M., and A. Rethwilm. 1995. Replicating foamy virus-based vectors directing high level expression of foreign genes. Virology 210:167-178[Medline]. |
| 39. | Schmidt, M., S. Niewiesk, J. Heeney, A. Aguzzi, and A. Rethwilm. 1997. Mouse model to study the replication of primate foamy viruses. J. Gen. Virol. 78:1929-1933[Abstract]. |
| 40. | Schmidt, M., O. Herchenroder, J. Heeney, and A. Rethwilm. 1997. Long terminal repeat U3 length polymorphism of human foamy virus. Virology 230:167-178[Medline]. |
| 41. | Schweizer, M., R. Turek, H. Hahn, A. Schliephake, K.-O. Netzer, G. Eder, M. Reinhardt, A. Rethwilm, and D. Neumann-Haefelin. 1995. Markers of foamy virus infections in monkeys, apes, and accidentally infected humans: appropriate testing fails to confirm suspected foamy virus prevalence in humans. AIDS Res. Hum. Retroviruses 11:161-170[Medline]. |
| 42. | Tobaly-Tapiero, J., M. Santillana-Hayat, M.-L. Giron, M. C. Guillemin, F. Rozain, J. Peries, and R. Emanoil-Ravier. 1990. Molecular differences between two immunologically related spumaretroviruses: the human prototype HSRV and the chimpanzee isolate SFV6. AIDS Res. Hum. Retroviruses 6:951-957[Medline]. |
| 43. | Von Laer, D., D. Neumann-Haefelin, J. L. Heeney, and M. Schweizer. 1996. Lymphocytes are the major reservoir for foamy viruses in peripheral blood. Virology 221:240-244[Medline]. |
| 44. | Weissenberger, J., and R. M. Flugel. 1994. Identification and characterization of the Bel 3 protein of human foamy virus. AIDS Res. Hum. Retroviruses 10:595-600[Medline]. |
| 45. |
Wu, M.,
S. Chari,
T. Yanchis, and A. Mergia.
1998.
cis-acting sequences required for simian foamy virus type 1 vectors.
J. Virol.
72:3451-3454 |
| 46. | Wybier-Franqui, J., J. Tobaly-Tapiero, A. Coronel, M.-L. Giron, C. Chopin-Robert, J. Peries, and R. Emanoil-Ravier. 1995. Human foamy virus DNA forms and expression in persistently infected Dami megakaryocytic cells. AIDS Res. Hum. Retroviruses 11:829-836[Medline]. |
| 47. |
Yu, S. E., and M. J. Linial.
1993.
Analysis of the role of the bel and bet open reading frames of human foamy virus by using a new quantitative assay.
J. Virol.
67:6618-6621 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»