Previous Article | Next Article 
Journal of Virology, November 1999, p. 9369-9376, Vol. 73, No. 11
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Amino Acid Changes at Positions 173 and 187 in the
Human T-Cell Leukemia Virus Type 1 Surface Glycoprotein Induce
Specific Neutralizing Antibodies
Sophie
Blanchard,1
Thérèse
Astier-Gin,1,*
Béatrice
Tallet,1,2
Daniel
Moynet,3
Danielle
Londos-Gagliardi,2 and
Bernard
Guillemain2
EP630 CNRS-Université Victor
Ségalen Bordeaux 2, 33077 Bordeaux Cedex,1
and Laboratoire d'Immunologie3 and
Laboratoire de Virologie,2
Université Victor Ségalen Bordeaux 2, 33076 Bordeaux
Cedex, France
Received 29 March 1999/Accepted 23 July 1999
 |
ABSTRACT |
The nucleotide sequence of human T-cell leukemia virus type 1 (HTLV-1) is highly conserved, most strains sharing at least 95%
sequence identity. This sequence conservation is also found in the
viral env gene, which codes for the two envelope
glycoproteins that play a major role in the induction of a protective
immune response against the virus. However, recent reports have
indicated that some variations in env sequences may induce
incomplete cross-reactivity between HTLV-1 strains. To identify the
amino acid changes that might be involved in the antigenicity of
neutralizable epitopes, we constructed expression vectors coding for
the envelope glycoproteins of two HTLV-1 isolates (2060 and 2072) which
induced human antibodies with different neutralization patterns. The
amino acid sequences of the envelope glycoproteins differed at four
positions. Vectors coding for chimeric or point-mutated envelope
proteins were derived from 2060 and 2072 HTLV-1 env genes.
Syncytium formation induced by the wild-type or mutated envelope
proteins was inhibited by human sera with different neutralizing
specificities. We thus identified two amino acid changes, I173
V and
A187
T, that play an important role in the antigenicity of
neutralizable epitopes located in this region of the surface envelope glycoprotein.
 |
INTRODUCTION |
Human T-cell leukemia virus type 1 (HTLV-1) is the etiologic agent of adult T-cell leukemia and a chronic
neurological disease, tropical spastic paraparesis or HTLV-1-associated
myelopathy (14, 19, 29, 31, 39). The virus infects 10 to 20 million persons worldwide, 4% of whom will develop one of these
diseases. In common with that of other retroviruses, the entry of
HTLV-1 into the target cell is mediated by the viral envelope
glycoproteins. These are two noncovalently linked subunits, a 46-kDa
surface glycoprotein (SU) which is responsible for attachment of the
virus to a cell surface receptor and a 21-kDa transmembrane
glycoprotein (TM) which fuses the viral envelope to the target cell
membrane, allowing penetration of the viral core into the cytoplasm.
Several regions involved in viral entry have been identified on the
HTLV-1 envelope glycoproteins by the use of neutralizing antibodies or
peptides that inhibit fusion (1, 2, 10, 17, 30, 38) and by functional analysis (7, 8, 32).
HTLV-1 is distributed worldwide but exhibits relatively little sequence
variation. HTLV-1 strains from Japan, Africa, the West Indies, and the
Americas and belonging to the cosmopolitan clade have at least 95%
sequence similarity. More distantly related strains displaying 8%
nucleotide sequence variation have been found in remote populations
from the Solomon Islands, Papua New Guinea, and Australia
(15). HTLV-1 infection has been successfully transmitted to
rats, rabbits, and monkeys in the laboratory (25, 27, 37).
This infection can be prevented by passive immunization with
immunoglobulins purified from HTLV-1-infected patients (21, 26,
33) or by vaccination with various versions of HTLV-1 envelope
proteins (3, 12, 18, 22, 27, 36). These observations suggest
that genetically engineered HTLV-1 envelope proteins or synthetic
peptide-based subunits could be used in a vaccine against HTLV-1.
However, protective humoral and cellular immune responses elicited by
vaccine components could be foiled by the existence of different
antigenic forms of HTLV-1 proteins. In this respect, incomplete
cross-reactivity between some cosmopolitan and Melanesian strains of
HTLV-1 has been reported (4). More recently, we showed that
sera from some patients infected with cosmopolitan HTLV-1 strains with
only a few amino acid changes in their envelope glycoproteins displayed
different neutralization patterns (5). These patterns could
be classified into three categories that fit well with groups of
viruses each harboring the same residues in the major immunodominant
and neutralizable domain (amino acids [aa] 175 to 199) of SU. Since
within each group, different amino acids could be substituted at other
positions, the residues involved in the observed differences have yet
to be identified.
To identify the amino acid changes involved in the antigenic
specificity of neutralizable epitopes, we constructed expression vectors coding for the envelope proteins of two HTLV-1 isolates (2060 and 2072) which induced human antibodies with different neutralization
patterns. The serum of the patient infected with virus 2060 completely
neutralized cosmopolitan HTLV-1 of the three groups mentioned above,
whereas the serum of the virus 2072-infected patient had a higher
neutralization potential against the autologous virus than against
cosmopolitan viruses of the other two groups. The amino acid sequences
of the envelope glycoproteins of viruses 2060 and 2072 differed at four
positions located in surface gp46. Vectors coding for chimeric or
point-mutated envelope proteins were derived from 2060 and 2072 HTLV-1
env genes. Their ability to induced syncytium formation
after transfection in COS-LTRHIV-LacZ cells was assessed,
as was the inhibition of syncytium formation by sera from
HTLV-1-infected patients.
 |
MATERIALS AND METHODS |
Sera.
Human sera used for syncytium inhibition were provided
by J. C. Vernant (La Meynard Hospital, Fort-de-France,
Martinique), J. F. Moreau and J. L. Sarthou (Institut Pasteur de
Guyane, Cayenne, Cayenne, French Guiana), S. Sainte-Foie and C. Hajjar
(Centre Hospitalier Intercommunal de Basse-Terre/Sainte-Claude,
Basse-Terre, Guadeloupe), and M. C. Georges-Courbot (CIRMF,
Franceville, Gabon). All sera were heated for 30 min at 56°C before
use. The presence of HTLV-1 antibodies in these sera was assessed with
a commercially available Western blot diagnostic kit (Diagnostic
Biotechnology 2.3).
Cells.
HTLV-1-infected cell lines (infected with isolates
2060 and 2072) (28) were maintained in RPMI 1640 medium
(Whittaker) supplemented with 10% heat-inactivated fetal calf serum
(Whittaker), 100 U of penicillin per ml, 100 µg of streptomycin per
ml, and 200 U of interleukin 2 (Chiron) per ml.
COS-LTRHIV-LacZ cells were grown in Dulbecco modified Eagle
medium supplemented with the serum and antibiotics listed above and
with 150 µg of hygromycin B per ml. XC-tat cells were maintained in
RPMI 1640 medium supplemented with serum, penicillin, and streptomycin
as described above plus 400 µg of Geneticin per ml (9).
Construction of env expression vectors.
The
sequences of an HTLV-1 provirus cloned from 2060 HTLV-1-infected cells
were used for construction of the expression vectors. The proviral
clone, p4.39 (28), contains a full-length provirus in a
15.5-kbp EcoRI fragment. Sequence determination of the
env gene in this clone revealed a stop codon in the gp21
coding sequence instead of a tryptophan (position 427). The proviral
sequences were first excised by use of the BstEII enzyme and
then subcloned in plasmid pBR327 to eliminate most of the cellular
flanking sequences. The stop codon in the gp21 coding sequence of clone
p4.39 was eliminated by exchanging the StuI fragment with a
fragment from the MT2 provirus, which codes for the same amino acid
sequence as the nonmutated 2060 provirus (5). A large
deletion (2,750 bp) in the gag and pol genes was
created by HindIII digestion, and all sequences of the
5' long terminal repeat (LTR) were replaced by the cytomegalovirus
promoter as an NsiI-NheI fragment from pBK-CMV
(Stratagene). The resulting plasmid, pB1D, was used as an
env expression vector after transfection in COS cells.
The env gene of the 2072 provirus was obtained by PCR
amplification of the proviral DNA integrated in lymphocyte DNA from the
patient infected with isolate 2072. Two primer pairs were used: 5'
ACCATGGCTAAGTTTCTCG 3' and 5' GGAGACAAGCTTGACCGC 3'
for amplification of all gp46 coding sequences and 5'
GTCGACGCTCCAGGATATGACC 3' and 5' GGAGGATTTGATGGGAGA 3'
for amplification of DNA sequences coding for the
carboxyl-terminal half of gp46 and gp21.
Site-directed mutagenesis of the 2060 HTLV-1 env gene was
performed by use of the Sculptor in vitro mutagenesis system
(Amersham). The presence of mutations was verified by DNA sequencing.
Western blot analysis of envelope glycoproteins.
After
transfection, the cellular proteins were solubilized in 20 mM Tris (pH
7.9)-0.15 M NaCl-1 mM Na2HPO4-1 mM
phenylmethylsulfonyl fluoride-0.5% sodium deoxycholate-0.5% Nonidet
P-40. The glycoproteins were affinity purified on lentil
lectin-Sepharose (Pharmacia), fractionated on 12.5% polyacrylamide
gels as described by Laemmli (22a), and transferred to
nitrocellulose membranes (Pall Gelman Sciences). The nitrocellulose
sheets were incubated overnight at room temperature with 2% nonfat dry
milk and 0.5% bovine serum albumin in phosphate-buffered saline-20 mM
Tris (pH 7.4)-0.05% Tween 20. Next, the membranes were incubated in
the same buffer containing 20 µg of monoclonal antibody MF2 per ml,
specific for a peptide of HTLV-1 gp46 (24), or
immunoglobulin G purified from an HTLV-1-infected patient for 2 h
at 37°C; the membranes were then washed five times with
phosphate-buffered saline containing 0.1% Tween 20. Next, the
membranes were incubated with peroxidase-labelled goat anti-mouse or
anti-human immunoglobulin G F(ab')2 fragments (Immunotech)
for 1 h at room temperature. After five washes, the bound
antibodies were revealed with a Super Signal chemiluminescence kit (Pierce).
Transfection procedure and envelope fusion assay.
A
-galactosidase assay was used for the quantitative evaluation of
syncytium formation. Briefly, 15 ng of plasmid DNA was transfected into
COS-LTRHIV-LacZ cells (40,000 cells per well in 24-well
microplates) as described by Cullen (6). At 48 h posttransfection, 80,000 XC-tat indicator cells were added to each well
and incubation was continued for 24 h. Each experimental point was
determined in triplicate.
-Galactosidase activity was revealed by in
situ staining with
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
or by a colorimetric method with chlorophenol
red-
-D-galactopyranoside (CPRG) (Roche Diagnostics) as
an enzyme substrate as previously described (1).
Assay of syncytium inhibition by human sera.
At 48 h
posttransfection with env expression vectors,
COS-LTRHIV-LacZ cells were incubated for 1 h at 37°C
with human sera at various serial log3 dilutions (in 0.5 ml
of RPMI 1640, starting at dilution 1:50). XC-tat cells were then added
in 0.5 ml, and fusion assays were performed as described above. The
syncytium inhibition titer (ID50) was the reciprocal of the
serum dilution resulting in a 50% reduction in the number of blue
cells or in the absorbance at 620 nm of the positive control (coculture
in the absence of human serum) after subtraction of background values obtained with untransfected COS-LTRHIV-LacZ cells
cocultivated with XC-tat cells.
Statistical analyses.
For serum neutralization pattern
analysis, each experiment was repeated three to five times. The
significance of differences between the patterns was determined with
paired two-tailed Student's t tests for all experiments.
Confirmation was obtained with a two-way analysis of variance.
Differences were considered statistically significant when the
P value was <0.05. To assess the statistical significance
of the fusogenic properties of the envelope constructs, the 95%
confidence interval (95% CI) centered on the mean was determined after
calculation of the standard deviation.
 |
RESULTS |
Chimeric and mutant envelope proteins derived from 2060 and 2072 virus env genes.
In a previous report (5),
we showed that the amino acid sequences of the envelope glycoproteins
of viruses 2060 and 2072 differed at five positions: four located in
surface gp46 and one located in transmembrane gp21. A new determination
of the complete env gene sequences of viruses 2060 and 2072 confirmed the differences previously found in gp46 of both viruses, but
the amino acid change at position 375 in gp21 was not retrieved.
Consequently, both viruses had identical amino acid sequences for gp21.
Figure
1 shows the alignment of amino
acid changes observed in the surface envelope glycoproteins of viruses
2060 and 2072.
The sequence of the ATK-HTLV-1 envelope protein was
included in
this alignment for comparison (
35). The surface
envelope protein
sequences of these three viruses differed at eight
positions,
and only four amino acid changes were observed when the 2060 and
2072 viral envelope glycoproteins were compared (positions 39,
93, 173, and 187).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of amino acid (aa) changes observed in the
envelope glycoprotein sequences of different HTLV-I proviruses. Only
positions in which changes were observed in at least one of the
sequences are listed. Amino acid sequences were deduced from published
nucleotide sequences for ATK (35) and 2056, 2060, 2072, and
2085 (5). ATL, adult T-cell leukemia; TSP/HAM, tropical
spastic paraparesis or HTLV-1-associated myelopathy; AS, asymptomatic
carrier.
|
|
To identify amino acid changes that might be involved in the reactivity
of neutralizable epitopes harbored by the proteins
of the two viruses
under study, chimeric and mutant envelope constructs
were derived from
the virus 2060
env gene inserted downstream
from the
cytomegalovirus promoter (pB1D vector). Two chimeric
vectors were
constructed: pB1D/SU72, containing all coding sequences
of virus 2072 gp46, and pB1D/V173T187, containing the
SalI-
BamHI
fragment of the virus 2072
env gene, which codes for the carboxy
terminal half of gp46
(Fig.
2). Finally, single amino acid
changes
specific for virus 2072 gp46 were introduced into the virus
2060
envelope glycoprotein sequence. The names of the resulting
env expression vectors refer directly to the mutated
positions (Fig.
2). Western blot analysis of glycoproteins of COS cells
transfected
with the seven vectors by use of monoclonal antibody MF2
indicated
that all vectors synthesized equivalent amounts of gp61
precursor
(Fig.
3, lanes 2 to 8). Under
these experimental conditions, monoclonal
antibody MF2 recognized only
the precursor. A protein corresponding
to gp46 was visualized with IgG
purified from an HTLV-1-infected
patient (Fig.
3, lanes 10 to 13),
indicating that maturation of
the precursor occurred in COS cells.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic representation of the seven HTLV-1
env expression vectors. CMV, cytomegalovirus; LTR, long
terminal repeat; pX, X region of HTLV-1.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3.
Western blot analysis with monoclonal antibody MF2
(lanes 1 to 8) or human IgG (lanes 9 to 13) of glycoproteins of
transfected COS cells. Five hundred micrograms of total proteins of
transfected COS cells was affinity purified on lentil lectin-Sepharose.
The eluted glycoproteins were analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and transferred to
nitrocellulose membranes, and HTLV-1 glycoproteins were revealed with
specific antibodies. Lentil lectin-Sepharose-purified proteins were
from untransfected COS cells (lanes 1 and 9), COS cells transfected
with pB1D (lanes 2 and 10), COS cells transfected with pB1D/I173V-A187T
(lane 3), COS cells transfected with pB1D/SU72 (lane 4), COS cells
transfected with pB1D/E39K (lane 5), COS cells transfected with
pB1D/N93Y (lanes 6 and 11), COS cells transfected with pB1D/I173V
(lanes 7 and 12), and COS cells transfected with pB1D/A187T (lanes 8 and 13).
|
|
Fusogenic properties of recombinant HTLV-1 glycoproteins.
The
fusogenic properties of the 2060 (pB1D) and chimeric or point-mutated
envelope glycoproteins were monitored after transfection into
COS-LTRHIV-LacZ cells and coculturing with XC-tat cells. In
situ staining with X-Gal showed that the envelope glycoproteins expressed by all the vectors induced extensive formation of large syncytia. A quantitative evaluation of this phenomenon by the colorimetric method with CPRG confirmed that the seven envelope glycoproteins exhibited equivalent fusogenic activities. The results of
five independent experiments are listed in Table
1. The absorbances obtained for the
different envelope glycoproteins ranged from 1.021 to 2.213. This range
was also observed for the same envelope glycoproteins in independent
transfection series. Nevertheless, every mean fell within the 95% CI
of every other one. This result was thought to reflect variations in
cell culture conditions and/or transfection efficiencies. Consequently,
in subsequent experiments, all syncytium inhibition assays performed
with transfected COS-LTRHIV-LacZ cells were repeated three
to five times.
Inhibition of syncytium formation induced by recombinant HTLV-1
glycoproteins by 2060 and 2085 sera.
The 2085 serum was from a
patient infected by an HTLV-1 strain with a gp46 identical to that of
virus 2060. We showed that both 2060 and 2085 sera inhibited with the
same efficiency syncytium formation induced by viruses 2060 and 2072 produced by lymphoid cell lines originating from the respective
patients. These two sera were assayed for inhibition of syncytia
induced by the HTLV-1 glycoproteins synthesized from the seven vectors
described above. For comparison, inhibition of syncytium formation
induced by viruses 2060 and 2072 was tested in parallel with the 2085 serum. Figures 4 and
5 show the levels of inhibition plotted
against the reciprocal of the serum dilution. Consistent with our
previous results, the 2085 serum inhibited with the same efficiency
syncytium formation induced by viruses 2060 and 2072. The maximum
levels of inhibition (99%) and the ID50s (4,600 and 5,700 respectively) were similar to those found previously (Fig. 4). The
values were slightly lower when we tested the inhibition of syncytia
induced by 2060 and 2072 envelope glycoproteins produced by
COS-LTRHIV-LacZ cells transfected with pB1D or pB1D/SU72
(maximum levels of inhibition, 77 and 72%, respectively). This result
may have been due to differences in protein maturation and/or
presentation at the cell surface of HTLV-1-infected lymphoid cell lines
and of transiently transfected COS-LTRHIV-LacZ cells. The
inhibition curves obtained for syncytia induced by all chimeric and
point-mutated envelope glycoproteins were similar with both 2060 and
2085 sera (Fig. 4 and 5). The maximum levels of inhibition ranged from
71 to 77% with the 2085 serum and from 60 to 79% with the 2060 serum;
the ID50s differed by only one dilution (1/300 or 1/900).
Statistical analysis of the inhibition patterns confirmed that both
sera inhibited syncytia induced by the seven recombinant envelope
glycoproteins with the same efficiency (P, 0.105 to 0.930).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Inhibition curves for syncytia induced by 2060 (solid
circles)- and 2072 (open circles)-infected cells (broken lines) or
COS-LTRHIV-LacZ cells transfected with HTLV-1
env expression vectors (solid lines) with the 2085 serum.
Each point corresponds to the mean of two to five values obtained in
independent experiments. Expression vectors were pB1D (solid circles),
pB1D/I173V-A187T (open triangles), pB1D/N93Y (solid triangles),
pB1D/A187T (open diamonds), pB1D/SU72 (solid squares), pB1D/E39K (open
squares), and pB1D/I173V (solid diamonds).
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5.
Inhibition curves for syncytia induced by
COS-LTRHIV-LacZ cells transfected with HTLV-1
env expression vectors with the 2060 serum. Each point
corresponds to the mean of two to five values obtained in independent
experiments. Expression vectors were those listed in the legend to Fig.
4.
|
|
These results demonstrated that the neutralizing activity of 2060 and
2085 sera was not affected by amino acid differences
between the 2060 and 2072 envelope glycoproteins, whether these
proteins were presented
on the surface of either chronically infected
lymphoid cells or
transiently transfected COS-LTR
HIV-LacZ
cells.
Inhibition of syncytium formation induced by recombinant HTLV-1
glycoproteins by 2072 serum.
The serum from the patient infected
with virus 2072 displayed different neutralization patterns based on
the HTLV-1 strain produced by the infected cell lines used in the
syncytium and reporter gene inhibition assays. The 2072 serum
neutralized the autologous virus (i.e., 2072) with a higher efficiency
than the heterologous 2060 virus (5). To determine if amino
acid changes in envelope glycoproteins affected their recognition by
the 2072 serum, inhibition experiments were performed with syncytia
induced by 2060 and 2072 envelope glycoproteins and by the five
chimeric and point-mutated envelope glycoproteins described above.
Control experiments were also performed with syncytia induced by
viruses 2060 and 2072 produced by lymphoid cell lines. Figure
6 shows the inhibition curves obtained in
each case. The data obtained on syncytia induced by viruses from
lymphoid cell lines confirmed our previous findings, indicating that
the 2072 serum showed a maximum level of inhibition and a higher
ID50 against virus 2072 than against virus 2060. The
inhibition curves obtained when transiently transfected
COS-LTRHIV-LacZ cells were used as syncytium inducers could
be classified into two groups.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
Inhibition curves for syncytia induced by 2060 (solid
circles)- and 2072 (open circles)-infected cells (broken lines) or
COS-LTRHIV-LacZ cells transfected with HTLV-1
env expression vectors (solid lines) with the 2072 serum.
Each point corresponds to the mean of two to five values obtained in
independent experiments. Expression vectors were those listed in the
legend to Fig. 4.
|
|
The first group included the inhibition curves obtained with
COS-LTR
HIV-LacZ cells transfected with the pB1D/SU72 and
pB1D/I173V-A187T
vectors. Relatively high levels of inhibition of
syncytium formation
were obtained in both cases (47 and 66% maximum
inhibition at
a 1/100 dilution, respectively). The second group
included the
inhibition curves obtained with
COS-LTR
HIV-LacZ cells transfected
with the pB1D, pB1D/E39K,
pB1D/N93Y, pB1D/I173V, and pB1D/A187T
vectors. In this group, the
maximum levels of inhibition were
very low or null (maximum inhibition
at a 1/100 dilution, 0.7
to 26.3%).
Detailed analysis of the results obtained for the first group (Fig.
6
and Table
2) showed that the higher
inhibitory activities
of the 2072 serum were observed for syncytia
induced by the chimeric
proteins with the entire 2072 gp46 sequence
(pB1D/SU72) and with
only 2 amino acid changes in the 2072 gp46
sequence (pB1D/I173V-A187T)
(47 and 66%, respectively). Statistical
analysis confirmed that
syncytium inhibition by the 2072 serum for
cells transfected with
pB1D/SU72 and pB1D/I173V-A187T was significantly
different from
that for cells transfected with pB1D (expressing 2060 gp46) (
P,
0.012 and 0.002, respectively). The inhibition
curves obtained
for syncytia induced by point-mutated envelope
glycoproteins did
not differ from that obtained with the pB1D-encoded
glycoprotein,
(
P, 0.152 to 0.735), indicating that none of
the envelope glycoproteins
displayed the antigenic structure
specifically recognized by the
2072 serum.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Inhibition of syncytium formation induced by parental,
chimeric, and point-mutated envelope proteins by 2072 serum
|
|
Taken together, these results indicated that specific recognition of
envelope glycoproteins by neutralizing antibodies in
the 2072 serum
required a valine at position 173 and a threonine
at position
187.
Inhibition of syncytium formation induced by recombinant HTLV-1
glycoproteins by 2056 serum.
In a previous study (5),
we found that the 2056 serum showed a maximum level of inhibition and a
higher ID50 for virus 2072 than for virus 2060. However,
the observed differences were not statistically significant. This
result may have been due to the relatively low antibody titer of the
2056 serum compared to that of the 2072 serum or to differences in gp46
amino acid sequences at two positions (108 and 173) (Fig. 1). The
inhibitory activity of this serum was reevaluated by use of syncytium
inhibition assays performed with COS-LTRHIV-LacZ cells
transfected with different pB1D-derived vectors. The results presented
in Table 3 and Fig. 7 showed that the maximum level of
inhibition was slightly higher for syncytia induced by the pB1D/SU72
vector (expressing gp46 of virus 2072) (58%) than for syncytia induced
by all other chimeric or point-mutated envelope glycoproteins and the
2060 envelope glycoprotein (33 to 44%). However, the observed
differences were not statistically significant (P value for
pB1D compared to pB1D/SU72, 0.39). These observations could be
explained in light of those obtained with the 2072 serum indicating
that V173 and T187 are required for the specific recognition of
envelope glycoproteins by this serum. As shown in Fig. 1, virus 2056 has an isoleucine at position 173 and a threonine at position 187.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Inhibition of syncytium formation induced by parental,
chimeric, and point-mutated envelope proteins by 2056 serum
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7.
Inhibition curves for syncytia induced by
COS-LTRHIV-LacZ cells transfected with HTLV-1
env expression vectors with the 2056 serum. Each point
corresponds to the mean of two to five values obtained in independent
experiments. Expression vectors were those listed in the legend to Fig.
4.
|
|
 |
DISCUSSION |
In a previous study (5), we showed that sera from some
patients infected with cosmopolitan HTLV-1 strains with few amino acid
changes in their envelope glycoproteins displayed different neutralization patterns. These patterns could be classified into three
categories that fit well with groups of viruses each harboring the same
residues in the major immunodominant and neutralizable domain (aa 175 to 199) of SU (5). The sera from the first group completely
neutralized, with equivalent titers, viruses in the different groups,
whereas some sera from the other two groups partially neutralized
viruses in the different groups. Since within each group, different
amino acids could be found at other positions, the residues involved in
the observed differences could not be determined.
To identify the amino acid changes responsible for the antigenic
specificity of neutralizable epitopes, we constructed an expression
vector expressing the envelope glycoproteins of virus 2060. We derived
chimeric or point-mutated vectors expressing envelope glycoproteins
with the amino acid substitutions found in virus 2072, which induced
some specific neutralizing antibodies in the infected patient. We found
that two amino acids (positions 173 and 187) were important for correct
recognition of the envelope glycoproteins by neutralizing antibodies
present in the 2072 serum. Indeed, substitutions I173
V and A187
T
in 2060 gp46 restored recognition by neutralizing antibodies in the
2072 serum. The involvement of these two amino acids in the induction
of specific antibodies was corroborated by our observation that the
serum of a patient infected with a virus (2056) harboring a threonine at position 187 but an isoleucine at position 173 has a phenotype intermediate between those of the 2060 and 2072 sera. The existence in
2072 SU of V173 and T187 instead of I173 and A187, as in 2060 SU, could
alter the structure of the envelope glycoprotein, thereby affecting the
immunogenicity of the proteins in infected patients. Indeed, aa 173 is
located close to a conserved GYDP motif (aa 168 to 172). This motif,
probably a
turn, is proposed to be a hinge in gp46 (13)
and could be involved in an SU-TM association; a Y170
S mutation
results in SU secretion into culture medium (7). The aa 187 is located in a major immunodominant and neutralizable region (aa 175 to 210) of gp46. Synthetic peptides with sequences in this region were
recognized by 75 to 100% of HTLV-1-positive patient sera
(20). It has been shown that an A187
T mutation in a gp46
peptide affects the binding of monoclonal antibody 2.30g (34). In contrast, a linear neutralizable epitope including aa 173 has not so far been identified. A peptide encompassing aa 172 to
194 of gp46 and recognized by 56% of HTLV-1-positive human sera has
been shown to inhibit significantly the fusion induced by HTLV-1
(10). The two amino acids (V173 and T187) involved in
specific recognition by the 2072 serum are located in this peptide.
Amino acid changes at these positions could readily affect the
structure and antigenicity of a neutralizable epitope located in this
gp46 domain involved in cell fusion or of a conformational epitope
involving two domains of the molecule.
As the 2060 and 2085 sera completely inhibited syncytium induction by
envelope glycoproteins regardless of the amino acids at positions 173 and 187, it could be argued that the differences observed were not due
to variations in env sequences but were due to differences
in immune responses between individuals. This suggestion seems
unlikely, as it is now established that variations in the amino acid
sequence of the major immunodominant domain in gp46 modify recognition
by human sera (11, 23). This finding was confirmed by the
isolation of monoclonal antibodies specific for the amino acid sequence
of the injected gp46 peptide (24, 34). Definite proof that
I173
V and A187
T mutations affected the specificity of
neutralizing antibodies will depend on the immunization of animals with
recombinant glycoproteins which induce specific neutralizing
antibodies, as the virus does in humans.
The nucleotide sequences of HTLV-1 proviruses originating from
different areas in the world are highly conserved (1 to 5% variation for viruses found in Japan, the Caribbean Basin,
the Americas, or Africa and 8% variation for viruses infecting some Melanesian populations). However, the results reported here showed that
the influence of amino acid changes in the envelope glycoproteins, albeit rare, on neutralizing and cytotoxic activities induced in humans
is worthy of investigation. In particular, the effects of amino acid
changes in domains of gp46 known to contain neutralizable epitopes need
to be determined, as such information has implications for the
development of an effective vaccine against a wide range of HTLV-1
strains. The experimental approach described in this report could also
help identify conformational epitopes involved in viral neutralization
(16).
 |
ACKNOWLEDGMENTS |
We thank S. Jarman for reviewing the English.
This work was supported by the Institut National de la Santé et
de la Recherche Médicale (INSERM), the Ligue Départementale Contre le Cancer de la Gironde et de la Dordogne, the Association pour
la Recherche sur le Cancer (Villejuif, France), and the Agence Nationale de Recherche sur le Sida (fellowship for S.B.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: EP630
CNRS-Université Victor Ségalen Bordeaux 2, IBGC, 1 rue
Camille Saint Saëns, 33077 Bordeaux Cedex, France. Phone: (33) 05 56 99 90 24. Fax: (33) 05 56 99 90 57. E-mail:
t.astier{at}ibgc.u-bordeaux2.fr.
 |
REFERENCES |
| 1.
|
Astier-Gin, T.,
J. P. Portail,
D. Londos-Gagliardi,
D. Moynet,
S. Blanchard,
R. Dalibart,
J. F. Pouliquen,
M. C. Georges-Courbot,
C. Hajjar,
S. Sainte-Foie, and B. Guillemain.
1997.
Neutralizing activity and antibody reactivity toward immunogenic regions of the HTLV-I surface glycoprotein in sera of infected patients with different clinical status.
J. Infect. Dis.
175:716-719[Medline].
|
| 2.
|
Baba, E.,
M. Nakamura,
Y. Tanaka,
M. Kuroki,
Y. Itoyama,
S. Nakano, and Y. Niho.
1993.
Multiple neutralizing B-cell epitopes of human T-cell leukemia virus type I (HTLV-I) identified by human monoclonal antibodies.
J. Immunol.
151:1013-1024[Abstract].
|
| 3.
|
Baba, E.,
M. Nakamura,
K. Ohkuma,
J. I. Kira,
Y. Tanaka,
S. Nakano, and Y. Niho.
1995.
A peptide based human T cell leukemia virus type I vaccine containing T and B cell epitopes that induced high titers of neutralizing antibodies.
J. Immunol.
154:399-412[Abstract].
|
| 4.
|
Benson, J.,
E. Tschachler,
A. Gessain,
R. Yanagihara,
R. C. Gallo, and G. Franchini.
1994.
Cross-neutralizing antibodies against cosmopolitan and Melanesian strains of human T cell leukemia/lymphotropic virus type I in sera from inhabitants of Africa and the Solomon Islands.
AIDS Res. Hum. Retroviruses
10:91-96[Medline].
|
| 5.
|
Blanchard, S.,
T. Astier-Gin,
D. Moynet,
E. Edouard, and B. Guillemain.
1998.
Different neutralization patterns among sera of patients infected with cosmopolitan HTLV-I.
Virology
245:90-98[Medline].
|
| 6.
|
Cullen, B. R.
1987.
Use of eukaryotic expression technology in the functional expression of cloned genes.
Methods Enzymol.
152:684-704[Medline].
|
| 7.
|
Delamarre, L.,
C. Pique,
D. Pham,
T. Tursz, and M.-C. Dokhelar.
1994.
Identification of functional regions in the human T-cell leukemia virus type I SU glycoprotein.
J. Virol.
68:3544-3549[Abstract/Free Full Text].
|
| 8.
|
Delamarre, L.,
A. Rosenberg,
C. Pique,
D. Pham, and M.-C. Dokhelar.
1997.
A novel human T-leukemia virus type 1 cell-to-cell transmission assay permits definition of SU glycoprotein amino acids important for infectivity.
J. Virol.
71:259-266[Abstract].
|
| 9.
|
Denesvre, C.,
P. Sonigo,
A. Corbin,
H. Ellerbrok, and M. Sitbon.
1995.
Influence of transmembrane domains on the fusogenic abilities of human and murine leukemia retrovirus envelopes.
J. Virol.
69:4149-4157[Abstract].
|
| 10.
|
Desgranges, C.,
S. Souche,
J.-C. Vernant,
D. Smadja,
A. Vahlne, and P. Horal.
1994.
Identification of novel neutralization-inducing regions of the human T cell lymphotropic virus type I envelope glycoproteins with human HTLV-I seropositive sera.
AIDS Res. Hum. Retroviruses
10:163-173[Medline].
|
| 11.
|
Edouard, E.,
D. Londos-Gagliardi,
B. Busetta,
S. Geoffre,
P. Dalbon,
J. P. Moreau, and B. Guillemain.
1994.
Recognition by human sera of a variable region of the surface glycoprotein of HTLV-I.
Leukemia
8:S65-S67.
|
| 12.
|
Ford, C. M.,
J. Arp,
T. J. Palker,
E. E. King, and G. A. Dekaban.
1992.
Characterization of the antibody response to three different versions of the HTLV-I envelope protein expressed by recombinant vaccinia viruses: induction of neutralizing antibody.
Virology
191:448-453[Medline].
|
| 13.
|
Gallaher, W.,
J. Ball,
R. Garry,
A. Martin-Amedee, and R. Montelaro.
1995.
A general model for surface glycoprotein of HIV and retroviruses.
AIDS Res. Hum. Retroviruses
11:191-202[Medline].
|
| 14.
|
Gessain, A.,
F. Barin,
J. C. Vernant,
O. Gout,
L. Maurs,
A. Calender, and G. De The.
1985.
Antibodies to human T-lymphotropic virus type-1 in patients with tropical spastic paraparesis.
Lancet
ii:407-410.
|
| 15.
|
Gessain, A.,
R. Yanagihara,
G. Franchini,
R. M. Garruto,
C. L. Jenkins,
A. B. Adjukiewick,
R. C. Gallo, and D. C. Gajdusek.
1991.
Highly divergent molecular variants of human T lymphotropic virus type I from isolated populations in Papua New Guinea and the Solomon Islands.
Proc. Natl. Acad. Sci. USA
88:7694-7698[Abstract/Free Full Text].
|
| 16.
|
Hadlock, K.,
J. Rowe, and S. K. H. Foung.
1999.
The humoral immune response to human T-cell lymphotropic virus type 1 envelope glycoprotein gp46 is directed primarily against conformational epitopes.
J. Virol.
73:1205-1212[Abstract/Free Full Text].
|
| 17.
|
Hadlock, K. G.,
J. Rowe,
S. Perkins,
P. Bradshaw,
G.-Y. Song,
C. Cheng,
J. Yang,
R. Gascon,
J. Halmos,
S. M. M. Rehman,
M. S. McGrath, and K. H. Foung.
1997.
Neutralizing human monoclonal antibodies to conformational epitopes of human T-cell lymphotropic virus type 1 and 2 gp46.
J. Virol.
71:5828-5840[Abstract].
|
| 18.
|
Hakoda, E.,
H. Machida,
Y. Tanaka,
N. Norishita,
T. Sawada,
H. Shida,
H. Hoshino, and I. Miyoshi.
1995.
Vaccination of rabbits with recombinant vaccinia virus carrying the envelope gene of human T-cell lymphotropic virus type I.
Int. J. Cancer
60:567-570[Medline].
|
| 19.
|
Hinuma, Y.,
K. Nagata,
M. Hanaoka,
M. Nakai,
T. Matsumoto,
K. Kinoshita,
S. Shirakawa, and I. Miyoshi.
1981.
Adult T-cell leukemia: antigen in an ATL cell line and detection of antibodies to the antigen in human sera.
Proc. Natl. Acad. Sci. USA
78:6476-6480[Abstract/Free Full Text].
|
| 20.
|
Horal, P.,
W. W. Hall,
B. Svennerholm,
J. Lycke,
S. Jeansson,
L. Rymo,
M. H. Kaplan, and A. Vahlne.
1991.
Identification of type-specific linear epitopes in the glycoproteins gp46 and gp21 of human T-cell leukemia viruses type I and type II using synthetic peptides.
Proc. Natl. Acad. Sci. USA
88:5754-5758[Abstract/Free Full Text].
|
| 21.
|
Kataoka, R.,
N. Takehara,
Y. Iwahara,
T. Sawada,
Y. Ohtsuki,
Y. Dawei,
H. Hoshino, and I. Miyoshi.
1990.
Transmission of HTLV-I by blood transfusion and its prevention by passive immunization in rabbits.
Blood
76:1657-1661[Abstract/Free Full Text].
|
| 22.
|
Kazanji, M.,
R. Bomford,
J.-L. Bessereau,
T. Schultz, and G. Dethe.
1997.
Expression and immunogenicity in rats of recombinant adenovirus 5 DNA plasmids and vaccinia virus containing the HTLV-I env gene.
Int. J. Cancer
71:300-307[Medline].
|
| 22a.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 23.
|
Londos-Gagliardi, D.,
R. Dalibart,
S. Geoffre,
P. Dalbon,
J. F. Pouliquen,
M. C. Georges-Courbot,
C. Hajjar,
A. J. Georges,
J. P. Moreau, and B. Guillemain.
1996.
Immunogenicity of variable regions of the surface envelope glycoprotein of HTLV-I and identification of new major epitopes in the 239-261 region.
AIDS Res. Hum. Retroviruses
12:941-950[Medline].
|
| 24.
|
Londos-Gagliardi, D.,
V. Jauvin,
M. H. Armengaut,
T. Astier-Gin,
M. Goezt,
S. Huet, and B. Guillemain.
1999.
Influence of amino acid substitutions on antigenicity of immunodominant regions of the HTLV-I envelope surface glycoprotein study using monoclonal antibodies raised against relevant peptides.
AIDS Res. Hum. Retroviruses
10:909-920.
|
| 25.
|
Miyoshi, I.,
S. Yoshimoto,
I. Kubonishi,
M. Fujishita,
Y. Ohtsuki,
M. Yamashita,
K. Yamamoto,
S. Hirose,
H. Taguchi,
K. Niiya, and M. Kobayashi.
1985.
Infectious transmission of human T-cell leukemia virus to rabbits.
Int. J. Cancer
30:81-85.
|
| 26.
|
Miyoshi, I.,
N. Takehara,
T. Sawada,
Y. Iwahara,
R. Kataoka,
D. Yang, and H. Hoshino.
1992.
Immunoglobulin prophylaxis against HTLV-I in a rabbit model.
Leukemia
6(Suppl. 1):24-26.
|
| 27.
|
Nakamura, H.,
M. Hayami,
Y. Ohta,
K. Ishikawa,
H. Tsujimoto,
T. Kiyokawa,
M. Yoshida,
A. Sasagawa, and S. Honjo.
1987.
Protection of cynomolgus monkeys against infection by human T-cell leukemia virus type-I by immunisation with viral env produced in Escherichia coli.
Int. J. Cancer
40:403-407[Medline].
|
| 28.
|
Nicot, C.,
T. Astier-Gin,
E. Edouard,
E. Legrand,
D. Moynet,
A. Vital,
D. Londos-Gagliardi,
J. P. Moreau, and B. Guillemain.
1993.
Establishment of HTLV-I infected cell lines from French Guianese and West Indian patients and isolation of a proviral clone producing viral particles.
Virus Res.
30:317-334[Medline].
|
| 29.
|
Osame, M.,
K. Usuku,
S. Izumo,
N. Ijichi,
H. Amitani,
A. Igata,
M. Matsumoto, and M. Tara.
1986.
HTLV-I associated myelopathy, a new clinical entity.
Lancet
i:1031-1032.
|
| 30.
|
Palker, T. J.,
E. R. Riggs,
D. E. Spragion,
A. J. Muir,
R. M. Scearce,
R. R. Randall,
A. McKnight,
P. R. Clapham,
R. A. Weiss, and B. F. Haynes.
1992.
Mapping of homologous amino-terminal neutralizing regions of human T-cell lymphotropic virus type I and II gp46 envelope glycoproteins.
J. Virol.
66:5879-5889[Abstract/Free Full Text].
|
| 31.
|
Poiesz, B. J.,
F. W. Ruscetti,
A. F. Gazdar,
P. A. Bunn,
J. D. Minna, and R. C. Gallo.
1980.
Detection and isolation of type-C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T cell lymphoma.
Proc. Natl. Acad. Sci. USA
77:7415-7419[Abstract/Free Full Text].
|
| 32.
|
Rosenberg, A. R.,
L. Delamarre,
C. Pique,
D. Pham, and M.-C. Dokhelar.
1997.
The ectodomain of the human T-cell leukemia virus type 1 TM glycoprotein is involved in postfusion events.
J. Virol.
71:7180-7186[Abstract].
|
| 33.
|
Sawada, T.,
Y. Iwahara,
K. Ishii,
H. Taguchi,
H. Hoshino, and I. Miyoshi.
1991.
Immunoglobulin prophylaxis against milkborne transmission of human T cell leukemia virus type I in rabbits.
J. Infect. Dis.
164:1193-1196[Medline].
|
| 34.
|
Schulz, T. E.,
M. I. Calabro,
J. G. Hoad,
C. V. F. Carrington,
E. Matutes,
D. Catovsky, and R. A. Weiss.
1991.
HTLV-1 envelope sequences from Brazil, the Caribbean, and Romania: clustering of sequences according to geographic origin and variability in an antibody epitope.
Virology
184:483-491[Medline].
|
| 35.
|
Seiki, M.,
S. Hattori,
Y. Hirayama, and M. Yoshida.
1983.
Human adult T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA.
Proc. Natl. Acad. Sci. USA
80:3618-3622[Abstract/Free Full Text].
|
| 36.
|
Shida, H.,
T. Tochikura,
T. Sato,
T. Konno,
K. Hirayoshi,
M. Seki,
Y. Ito,
M. Hatanaka,
Y. Hinuma,
M. Sugimoto,
F. Takahashi-Nishimaki,
T. Maruyama,
K. Miki,
K. Suzuki,
M. Morita,
H. Sashiyama, and M. Hayami.
1987.
Effect of the recombinant vaccinia viruses that express HTLV-I envelope gene on HTLV-I infection.
EMBO J.
6:3379-3384[Medline].
|
| 37.
|
Suga, T.,
T. Kameyama,
T. Kinoshita,
K. Shimotohno,
M. Matsumura,
H. Tanaka,
S. Kushida,
T. Ami,
M. Uchida,
K. Uchida, and M. Miwa.
1991.
Infection of rats with HTLV-1: a small animal model for HTLV-1 carriers.
Int. J. Cancer
49:764-769[Medline].
|
| 38.
|
Tanaka, Y.,
L. Zeng,
H. Shiraki,
H. Shida, and H. Toyawa.
1991.
Identification of a neutralization epitope on the envelope gp46 antigen of human T cell leukemia virus type I and induction of neutralizing antibody by peptide immunization.
J. Immunol.
147:354-360[Abstract].
|
| 39.
|
Yoshida, M.,
J. Miyoshi, and Y. Hinuma.
1982.
Isolation and characterization of retrovirus from cell lines of human adult T-cell leukemia and its implication in the disease.
Proc. Natl. Acad. Sci. USA
79:2031-2035[Abstract/Free Full Text].
|
Journal of Virology, November 1999, p. 9369-9376, Vol. 73, No. 11
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Mirsaliotis, A., Nurkiyanova, K., Lamb, D., Kuo, C.-W. S., Brighty, D. W.
(2007). An antibody that blocks human T-cell leukemia virus type 1 six-helix-bundle formation in vitro identified by a novel assay for inhibitors of envelope function. J. Gen. Virol.
88: 660-669
[Abstract]
[Full Text]
-
Silverman, L. R., Phipps, A. J., Montgomery, A., Fernandez, S., Tsukahara, T., Ratner, L., Lairmore, M. D.
(2005). In vivo analysis of replication and immunogenicity of proviral clones of human T-lymphotropic virus type 1 with selective envelope surface-unit mutations. Blood
106: 3602-3608
[Abstract]
[Full Text]
-
Sundaram, R., Lynch, M. P., Rawale, S. V., Sun, Y., Kazanji, M., Kaumaya, P. T. P.
(2004). De Novo Design of Peptide Immunogens That Mimic the Coiled Coil Region of Human T-cell Leukemia Virus Type-1 Glycoprotein 21 Transmembrane Subunit for Induction of Native Protein Reactive Neutralizing Antibodies. J. Biol. Chem.
279: 24141-24151
[Abstract]
[Full Text]