Previous Article | Next Article 
Journal of Virology, November 1999, p. 9294-9302, Vol. 73, No. 11
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Incorporation of Wild-Type and C-Terminally Truncated Human
Epidermal Growth Factor Receptor into Human Immunodeficiency
Virus-Like Particles: Insight into the Processes Governing
Glycoprotein Incorporation into Retroviral Particles
Peter
Henriksson,
Tanya
Pfeiffer,
Hanswalter
Zentgraf,
Alexandra
Alke, and
Valerie
Bosch*
Forschungsschwerpunkt Angewandte
Tumorvirologie, Deutsches Krebsforschungszentrum, D-69120
Heidelberg, Germany
Received 8 March 1999/Accepted 26 July 1999
 |
ABSTRACT |
Previous results have indicated that incorporation of surface
glycoprotein into retroviral particles is not a specific process and
that many heterologous viral and cellular glycoproteins can be
incorporated as long as they do not have long cytoplasmic C-terminal regions which were presumed to be sterically inhibitory. In this study,
this concept has been directly examined by analyzing the incorporation
of the wild-type human epidermal growth factor receptor (Wt-EGFR) and
of a C-terminally truncated mutant of Wt-EGFR (Tr-EGFR) into human
immunodeficiency virus (HIV)-like particles. Incorporation was directly
analyzed at the protein level and by immunogold labelling of enriched
HIV-like particles. In agreement with the above concept, Tr-EGFR, with
only 7 C-terminal amino acids (aa), was efficiently incorporated into
HIV-like particles. Incorporation of the Wt-EGFR species, with 542 C-terminal cytoplasmic aa, was reduced by a factor of about 5 in
comparison to that of the Tr-EGFR species. However, the Wt-EGFR species
was still very significantly present in the HIV-like particles. A
series of control experiments verified that this represents genuine
incorporation of Wt-EGFR into the membrane of HIV-like particles. These
observations allow further speculation as to the processes governing
glycoprotein incorporation into retroviral particles and indicate that
the internal virus structure of HIV (in particular the matrix layer
[MA]) can accommodate much larger heterologous cytoplasmic domains in
incorporated glycoproteins than previously assumed.
 |
INTRODUCTION |
The incorporation of surface
glycoprotein into retroviral particles is not restricted to the
homologous glycoprotein. Pseudotyping with heterologous viral
glycoproteins has been possible in many combinations, e.g., influenza
virus hemagglutinin in Rous sarcoma virus particles (6),
vesicular stomatitis virus (VSV) G protein in murine retroviral and in
lentivirus vector particles (e.g., reference 16),
and others. Furthermore, several reports have demonstrated that
cellular proteins can be incorporated into retroviral particles. This
has been demonstrated for human immunodeficiency virus type 1 (HIV-1),
released from infected T-lymphocytes, generally by indirect methods
whereby the putatively incorporated protein species were not visualized
(summarized in reference 1). Nearly a decade ago,
Young et al. (28) directly demonstrated the incorporation of
the human CD4 protein into avian leukosis virus particles expressed in
quail cells. Since then, many reports have demonstrated that CD4 is
incorporated into the membrane of rhabdoviruses and retroviruses, and,
in fact, in the situation in which HIV coreceptor (CXCR-4 or CCR-5) is
also incorporated, the resulting pseudotyped viruses are infectious for
HIV-infected cells (7, 15, 22).
In contrast to the glycoproteins of other membrane viruses, lentiviral
glycoproteins are an exception in that they carry very long C-terminal
cytoplasmic regions (about 150 to 200 amino acids [aa] long).
Evidence from genetic analyses and from in vitro assays (4)
indicates that, in the case of the wild-type HIV glycoprotein, there is
a specific interaction between the C-terminal domain and the viral
matrix (MA) protein. Despite this, neither the cytoplasmic C terminus
nor the homologous membrane anchor of HIV Env is necessary for
glycoprotein incorporation, and virions encoding glycoproteins in which
these domains are lacking or have been replaced are infectious (8,
13, 26, 27). In fact, as mentioned above, several heterologous
viral glycoprotein species can be incorporated into HIV particles and
mediate infectivity (vector transduction). However, it was not possible
to achieve the reverse situation, i.e., pseudotyping of heterologous
membrane viruses with wild-type HIV Env. Incorporation and pseudotyping
could be achieved only by either removing or replacing the cytoplasmic
C terminus (e.g., in murine leukemia virus) particles (14,
23). Furthermore, incorporation of HIV Env carrying a long
heterologous cytoplasmic C terminus (of the cellular glycoprotein CD22)
could not be detected (27). These results have led to the
concepts that a long cytoplasmic C terminus, e.g., that of lentivirus
Env, has to fit to the viral MA layer and that long heterologous C
termini result in steric inhibition of incorporation.
Further proof for this concept of steric inhibition has been obtained
by a recent analysis of CD4 incorporation into HIV-like particles in
the presence and absence of p56lck.
p56lck binds to the cytoplasmic C terminus of
wild-type CD4 (Wt-CD4) but cannot bind to mutant CD4
(CD4cyt
) lacking this region. We have demonstrated that
both CD4 and CD4cyt
were incorporated into HIV-like
particles. However, on coexpression of p56lck,
incorporation of Wt-CD4 was inhibited but incorporation of
CD4cyt
remained unaffected (9). This was
interpreted to be due to steric inhibition at the C terminus, in this
case, by the presence of the bulky p56lck
molecule interacting with Wt-CD4.
In order to directly test the concept that a cellular surface
glycoprotein with a long cytoplasmic C terminus would be excluded from
incorporation into retroviral particles but that incorporation would
become possible on removal of the cytoplasmic C terminus, we have
chosen to study incorporation of the wild-type human epidermal growth
factor receptor (Wt-EGFR), which is a type 1 glycoprotein carrying 542 cytoplasmic aa, into HIV-like particles. We have generated a
C-terminally truncated mutant of Wt-EGFR (Tr-EGFR), carrying only seven
cytoplasmic C-terminal aa and, in agreement with our anticipation, this
latter molecule was efficiently incorporated into HIV-like particles.
However, surprisingly, the wild-type molecule was also present in
enriched HIV-like particles, albeit in amounts that were reduced
compared to those of the truncated form. We describe the experiments
verifying the incorporation of Wt-EGFR and conclude that the internal
structure of HIV particles, and in particular the matrix layer directly
underlying the lipid membrane, can accommodate bulky structures at the
C terminus of incorporated glycoproteins to a greater extent than anticipated.
 |
MATERIALS AND METHODS |
Constructs.
pKEx-Wt-EGFR is a eucaryotic expression vector
(based on pKEx [20]) for the human EGFR
(24). pKEx-Tr-EGFR was generated by standard PCR technology
by introducing a premature stop codon into the EGFR gene which then
encoded a truncated glycoprotein with only 7, instead of 542, cytoplasmic C-terminal aa. Specifically, the mutagenizing
oligonucleotide (nucleotide positions 2201 to 2229 in the EGFR sequence
[24],
ACATCGTTCGGTAGCGCACAGCTGCGGAGG, with
the nucleotide changes underlined) changed nucleotide 2212 from A to T
(codon AAG for lysine to TAG) and inserted a nucleotide (A) between
positions 2219 and 2220, thus generating a PvuII site for
easy identification of mutant plasmids. pKEx-HIV
Env3 encodes all of
the HIV-1 genes except nef and env and leads to
the release of HIV-like particles lacking glycoprotein (described in
reference 9).
Analysis of expression of Wt-EGFR and Tr-EGFR.
pKEx-Wt-EGFR
and pKEx-Tr-EGFR with and without pKEx-HIV
Env3 were transfected into
293T cells by standard calcium phosphate procedures. Expression of EGFR
was analyzed with culture supernatant (EGFR antibody) from H-EGFR-RI
mouse hybridoma cells secreting antibody directed against an epitope in
the extracellular domain of EGFR (25). Expression of viral
proteins from pKEx-HIV
Env3 was analyzed with rabbit antiserum
directed against the HIV-1 capsid protein (CA), p24 (12).
The amounts of virus particles released into the culture supernatants
were quantitated by enzyme-linked immunosorbent assay detecting HIV-1
CA (Medipro, Ketsch, Germany).
For indirect immunofluorescence of cell-surface EGFR, intact
transfected 293T cells were aspirated off the dish, collected by
low-speed centrifugation, and incubated for 30 min with undiluted EGFR
antibody and 0.02% azide at low temperatures. After washing and
incubation with fluorescein-labelled anti-mouse immunoglobulin G (IgG)
(both steps performed with 0.02% azide at low temperatures), the
labelled cells were either smeared on a glass slide, air-dried, and
embedded for microscopy or suspended in phosphate-buffered saline
(PBS)-3% fetal calf serum-0.02% azide for flow cytometric analysis.
Analyses of EGFR in cell, medium, and viral lysates were performed by
radioimmunoprecipitation. For this purpose, transfected
cells were
metabolically labelled for different time periods with
100 µCi of
[
35S]methionine and [
35S]cysteine (Pro-mix;
Amersham, Braunschweig, Germany) per ml.
Labelling of cells for
analysis of the intracellular distribution
of Wt-EGFR and Tr-EGFR was
for 5 h at 48 h posttransfection (p.t.).
Preparation of the
membrane and cytosolic fractions was performed
essentially as described
previously (
19). Briefly, labelled
cells were scraped off
the dish and broken by douncing in hypotonic
buffer and, after removal
of nuclei and large debris by low-speed
centrifugation, the cellular
membranes were separated from the
cytosol by ultracentrifugation at
100,000 ×
g.
For labelling of released HIV-like particles, metabolic labelling of
transfected cells was from 32 to 48 h p.t. The resultant
culture
supernatants were clarified by filtering through a 45-µm
filter and
centrifuged through a cushion of 32% sucrose for 3
h at
200,000 ×
g. The pellets, consisting of enriched
HIV-like
particle material, were either analyzed by gel electrophoresis
directly, further fractionated by velocity centrifugation (see
below),
or subjected to immunoprecipitation. Prior to immunoprecipitation,
the
total cells, the cellular membrane fractions, or the pelleted
HIV-like
particle preparations were lysed in RIPA buffer (1% Triton,
0.5%
deoxycholate, 0.1% sodium dodecyl sulfate [SDS] in PBS).
The
cytosolic fractions and uncentrifuged cell culture supernatants
were
adjusted to 1% Triton-0.5% deoxycholate-0.1% SDS.
Immunoprecipitations
of appropriate aliquots of these lysates were
performed with 1
ml of undiluted culture supernatant containing EGFR
antibody (containing
approximately 10 µg of mouse IgG) or 10 µl of
rabbit anti-CA serum
plus protein G-Sepharose (Pharmacia, Uppsala,
Sweden) and analyzed
by polyacrylamide gel electrophoresis (PAGE) and
autoradiography
as described previously (
17). Quantitation
of radioactivity
in specific bands was performed by direct measurement
of counts
in specific bands of the polyacrylamide gel as described
previously
(
2).
Velocity centrifugation of HIV-like particles in OptiPrep
gradients.
HIV-like particles which had been concentrated by
centrifugation through 32% sucrose were resuspended in PBS and
analyzed on OptiPrep (6 to 18% iodixanol; Gibco, Life Technology)
velocity gradients. These gradients were prepared and centrifuged as
recently described (5). Eleven fractions were collected from
the top and, after addition of 10 µg of nonradioactive carrier
protein (bovine serum albumin [BSA]), radioactive proteins were
precipitated with 20% trichloroacetic acid at low temperatures and
analyzed directly by gel electrophoresis and autoradiography.
Immunoprecipitation of intact HIV-like particles.
The
culture supernatants of transfected cells which had been metabolically
labelled from 32 to 48 h p.t. were filtered through a 45-µm
filter. As a control, the supernatants of cells expressing Wt-EGFR or
Tr-EGFR alone were mixed with the medium of cells expressing HIV-like
particles alone. These mixed supernatants were further incubated for
1 h at 37°C. Unmixed and mixed culture supernatants were
incubated, in the presence of protease inhibitor cocktail (Boehringer,
Mannheim, Germany), with 1 ml of culture supernatant containing EGFR
antibody and protein G-Sepharose for 2 h at low temperatures. The
protein G-Sepharose was subsequently carefully washed with PBS, in the
absence of detergent, and the immunoprecipitated material was analyzed
by gel electrophoresis and autoradiography.
Immunoelectron microscopy.
In order to obtain sufficient
material for immunoelectron microscopy, five 10-cm-diameter dishes of
transfected 293T cells were employed for each sample. In experiments in
which culture supernatants were mixed, five dishes of each type of
transfected cells were employed and further incubated for 1 h at
37°C. The unmixed and mixed supernatants were centrifuged through a
sucrose cushion, and the resulting HIV-like particles were taken up in 100 µl of PBS. Aliquots (20 µl) were placed for 1 min on
glow-discharged carbon-coated copper grids and subsequently washed with
20 drops of double-distilled water. The following sequence of
incubations was performed facedown on top of 50- to 100-µl drops
placed on a sheet of Parafilm: 30 min in undiluted culture supernatant
containing EGFR antibody; three sequential incubations, each for 5 min,
in PBS-1% BSA; 60 min of incubation in a suspension of 5-nm gold spheres coated with antibody against mouse IgG-IgM (Amersham) diluted
in PBS-1% BSA (1:10); three sequential incubations, each for 5 min,
in PBS-1% BSA. Finally, the grids were washed again with 20 drops of
double-distilled water, stained with 2% uranyl acetate, and air-dried.
Grids were examined in a Zeiss 10A electron microscope at 80 kV. The
magnification indicator of the microscope was routinely controlled with
a grading replica.
 |
RESULTS |
Expression of Wt-EGFR and Tr-EGFR.
The EGFR molecule is a type
I transmembrane glycoprotein consisting of 647 extracellular aa
(including the signal peptide), a membrane anchor of 21 aa and a
cytoplasmic C-terminal region of 542 aa (24). Our aim was to
examine if, and to what extent, incorporation of Wt-EGFR into HIV-like
particles occurs and to determine if this would be influenced by
removal of the cytoplasmic C-terminal region. For this purpose, an
expression vector encoding a truncated EGFR molecule (Tr-EGFR), with
only 7 instead of 542 cytoplasmic aa, was generated (Fig.
1). Indirect immunofluorescence analysis
of permeabilized 293T cells transfected with pKEx-Tr-EGFR or the
wild-type construct, pKEx-Wt-EGFR, and immunoprecipitation of
metabolically labelled lysates of transfected cells confirmed expression in both cases (data not shown). Since most of its
cytoplasmic C terminus had been removed, it was important to confirm
that Tr-EGFR was still an integral membrane protein and was transported to the cell surface. Metabolically labelled, transfected 293T cells
were separated into membrane and cytosolic fractions, and these were
subjected to immunoprecipitation employing monoclonal antibody specific
for an epitope in the extracellular domain of EGFR. Figure 1 shows gel
electrophoresis of the immunoprecipitated components. In both cases,
specific bands of comparable intensities were observed only in the
membrane fractions, consistent with both Wt-EGFR and Tr-EGFR being
integral membrane proteins. The mobilities are consistant with the
calculated molecular masses of approximately 166,000 Da for Wt-EGFR and
108,000 Da for Tr-EGFR (in each case without signal peptide and
assuming glycosylation at each potential N-glycosylation site in the
extracellular domain). Cell-surface staining of intact transfected
cells was bright in both cases (Fig. 2A).
Flow cytometric analyses (Fig. 2B) revealed that about 50% of the
cells transiently transfected with Wt-EGFR or Tr-EGFR had fluorescence
levels above the cutoff for the control untransfected cells. The mean
cellular fluorescence was 75.34 in the case of Wt-EGFR and 131.65 in
the case of Tr-EGFR. This means that, although both EGFR species are
clearly present at the cell surface, the total cellular and/or surface
expression of Tr-EGFR may be somewhat higher than that of Wt-EGFR.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of Wt-EGFR and Tr-EGFR in cellular membranes.
Upper panel: Schematic representation of Wt-EGFR (extracellular domain,
647 aa; membrane anchor, 21 aa, cytoplasmic domain, 542 aa) and Tr-EGFR
(extracellular domain, 647 aa; membrane anchor, 21 aa; cytoplasmic
domain, 7 aa). Lower panel: Autoradiogram of a PAGE analysis of
immunoprecipitates obtained with EGFR antibody from the membrane (M)
and cytosolic (C) fractions of metabolically labelled 293T cells
transfected with pKEx-Wt-EGFR (Wt) or pKEx-Tr-EGFR (Tr). The positions
of molecular mass markers are shown on the left.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 2.
Cell surface immunofluorescence. Intact 293T cells
expressing Wt-EGFR or Tr-EGFR (as indicated) were probed with EGFR
antibody plus fluorescein-labelled secondary antibody. (A) Microscopic
analysis. (B) Flow cytometric analysis. From left to right, graphs are
for untransfected 293T cells (the cutoff has been set such that less
than 0.1% positive cells are within the region M2), 293T cells
transiently transfected with pKEx-Wt-EGFR (M2 contains 51.5% positive
cells with a mean fluorescence of 75.34), and 293T cells transiently
transfected with pKEx-Tr-EGFR (M2 contains 53.21% positive cells with
a mean fluorescence of 131.65), respectively.
|
|
Incorporation of EGFR into HIV-like particles.
pKEx-HIV
Env3
encodes all HIV-1 gene products except Nef and Env and leads to the
release of HIV-like particles lacking glycoprotein (9, 27).
pKEx-Wt-EGFR and pKEx-Tr-EGFR were transfected either alone or together
with pKEx-HIV
Env3 into 293T cells. Cells were metabolically
labelled with [35S]methionine plus
[35S]cysteine from 30 to 44 h p.t., and
subsequently, radioactively labelled particle-like materials were
concentrated from the culture supernatants by centrifugation through a
sucrose cushion. Figure 3A shows the
immunoprecipitated products from the cell lysates and confirms that the
glycoproteins Wt-EGFR and Tr-EGFR were being expressed in similar
amounts and that this was not influenced by the coexpression of
pKEx-HIV
Env3. Immunoprecipitation with anti-CA serum reveals
Pr55gag and p24 in the lysates of
pKEx-HIV
Env3-expressing cells. The amounts of HIV-like particles
released into the media were quantitated by enzyme-linked immunosorbent
assay for CA and were approximately equivalent in individual
transfections and not negatively influenced by the coexpression of
EGFR. Figure 3B shows analysis of the pellets obtained after
centrifugation of the transfected culture supernatants through sucrose
cushions. Immunoprecipitation with anti-EGFR antibody revealed the
presence of both Wt-EGFR and Tr-EGFR glycoproteins only in those cases
in which pKEx-HIV
Env3 had been coexpressed, i.e., only when HIV-like
particles were present (Fig. 3B, lanes 4 and 8). No radioactive
glycoprotein could be detected in the centrifuged supernatants from
cells transfected with either pKEx-Wt-EGFR or pKEx-Tr-EGFR alone (this
was repeated in more than 10 experiments), confirming that neither
protein was released into the culture medium in a pelletable form
(e.g., membrane vesicles) in the absence of virus-like particles. In
contrast to the predominant single band representing full-length
Wt-EGFR in the cell lysates, the glycoprotein immunoprecipitated from
the HIV-like particles was present as two bands, one migrating at the
position of the full-length molecule and one smaller. The identity of
this lower band, which was present in varying amounts, was not
determined, but it most likely represents proteolytically degraded
Wt-EGFR preferentially present in the HIV-like particles. However, it
should be stressed here that EGFR species migrating at the position of
the full-length Wt-EGFR molecule, and thus carrying very long
cytoplasmic C termini, make up about 50% of the total EGFR species in
the enriched HIV-like particles.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of the incorporation of Wt-EGFR and Tr-EGFR
into HIV-like particles. (A) PAGE and autoradiography of the
immunoprecipitates, obtained with anti-CA serum (lanes 1, 3, 5, and 7)
or EGFR antibody (lanes 2, 4, 6, and 8), from metabolically labelled
293T cells expressing Wt-EGFR (lanes 1 to 4) or Tr-EGFR (lanes 5 to 8)
without (lanes 1, 2, 5, and 6) or with (lanes 3, 4, 7, and 8)
coexpression of HIV-like particles (the presence or absence of HIV-like
particles [Gag] is indicated below each lane). (B) As described for
panel A, but immunoprecipitates were of lysates of enriched HIV-like
particles obtained by centrifugation of culture supernatants through
sucrose. The positions of molecular mass markers are indicated on the
left and the positions of Wt-EGFR, Tr-EGFR,
Pr55gag, and CA are indicated on the right.
|
|
In order to compare the relative extents of putative incorporation of
Wt-EGFR and Tr-EGFR into HIV-like particles, the amounts
of
radioactivity in the immunoprecipitated bands in the cell and
viral
lysates were quantitated. The percentage of glycoprotein
present in the
pelleted HIV-like particles in comparison to the
total (i.e., cell plus
virus) was 3.1% for Wt-EGFR (taking only
the upper, full-length band
into account), and 16.6% for Tr-EGFR.
These values fluctuated slightly
from experiment to experiment,
with the relative amount (i.e., the
percentage of the total amount)
of Tr-EGFR always exceeding that of
full-length Wt-EGFR by a factor
of about 5. After correction for the
number of methionines plus
cysteines, this means that there are, in
fact, about 7.5 times
fewer Wt-EGFR molecules than there are Tr-EGFR
molecules in the
enriched HIV-like particle fraction. However, in a
very large
number of experiments and with no exception, these
significant
amounts of both full-length Wt-EGFR and Tr-EGFR were
clearly detectable
in the pelleted HIV-like
particles.
These results point to both Wt-EGFR and Tr-EGFR being incorporated into
HIV-like particles. In the case of Tr-EGFR, this is
perhaps not
surprising, since Tr-EGFR is present at the cell surface
and carries
only 7 cytoplasmic aa, which should not sterically
interfere with the
HIV-1 matrix layer, while the result that Wt-EGFR,
with 542 cytoplasmic
aa, was incorporated into HIV-like particles
was contrary to our
expectations. Thus the further experiments
described below were aimed
at confirming or refuting this
result.
Analysis of total cell culture supernatants from transfected
cells.
As a first step, we wished to analyze the total cell
culture supernatants before enrichment of particles by centrifugation through sucrose. 293T cells were transfected and metabolically labelled
as described above. The supernatants were centrifuged, filtered,
adjusted to 1% Triton X-100-0.5% deoxycholate-0.1% SDS, and
immunoprecipitated directly with EGFR antibodies. As shown in Fig.
4, radioactive Wt-EGFR was detected in
the supernatants of cells expressing this glycoprotein alone (Fig. 4,
lane 1). It is important to remember that, as indicated above, this
material could not be pelleted through a sucrose cushion. In the
presence of HIV-like particles, several different species derived from Wt-EGFR could be detected in the culture supernatant in amounts significantly higher than those detected in the absence of HIV-like particles (Fig. 4, lane 2). In addition to a band representing the
full-length molecule, at least two further faster-migrating species
were present, one at the position of truncated EGFR and a further
species migrating between the positions of Wt-EGFR and Tr-EGFR.
Additionally, in all immunoprecipitations of total supernatants, radioactive bands of about 50 kDa, which were interpreted to represent soluble proteolytic digestion products of the extracellular domain of
EGFR, were observed despite the presence of protease inhibitor during
the analyses. In the case of Tr-EGFR, no glycoprotein of 108 kDa was
observed in the absence of HIV-like particles but a strong band could
be detected in the supernatant of cells coexpressing HIV-like
particles. This latter result further supports the conclusion drawn
from results shown in Fig. 3, namely, that Tr-EGFR can truly be
incorporated into HIV-like particles.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of total cell culture supernatants. PAGE and
autoradiography of immunoprecipitates (with EGFR antibody) from lysates
of HIV-like particles generated from the culture supernatants of
metabolically labelled 293T cells expressing Wt-EGFR (lanes 1 and 2) or
Tr-EGFR (lanes 3 and 4) without (lanes 1 and 3) or with (lanes 2 and 4)
HIV-like particles (Gag) as indicated below each lane. The positions of
molecular mass markers are indicated on the left, and the positions of
Wt-EGFR and Tr-EGFR are indicated on the right.
|
|
Concerning Wt-EGFR, although pelletable glycoprotein was present in the
culture supernatant only when HIV-like particles were
coexpressed, its
presence in the absence of HIV-like particles
prompted us to perform
further control
experiments.
Further analyses of incorporation of Wt-EGFR and Tr-EGFR HIV-like
particles.
We considered the possibility that Wt-EGFR, which as
shown above can be released into the culture supernatant independently of the presence of HIV-like particles, could subsequently
nonspecifically associate with these and, as a result, be pelleted
through a sucrose cushion. We thus transfected cells with pKEx-Wt-EGFR,
pKEx-Tr-EGFR, and pKEx-HIV
Env3 alone and in combination and, after
metabolic labelling, harvested the cell culture supernatants. The
supernatants from cells expressing the EGFR glycoproteins alone (and
thus, in the case of Wt-EGFR, containing released radioactive Wt-EGFR) were mixed with the supernatant of cells expressing pKEx-HIV
Env3 alone (and thus containing radioactive HIV-like particles) and incubated further for 1 h at 37°C. Subsequently, the mixed
media, and media from cells coexpressing Wt-EGFR or Tr-EGFR plus
HIV-like particles, were centrifuged through a sucrose cushion. In this experiment, the resulting HIV-like particles were analyzed directly, i.e., without immunoprecipitation. As shown in Fig.
5, the particles derived from the
cultures coexpressing pKEx-Wt-EGFR or pKEx-Tr-EGFR plus pKEx-HIV
Env3
contained, as major components, only CA and either Wt-EGFR or Tr-EGFR.
However, the particles derived from centrifugation of the mixed culture
supernatants contained only CA. No EGFR components, and in particular
no Wt-EGFR, could be detected even with a very long exposure of the
gel. This makes it unlikely that the presence of Wt-EGFR in the
HIV-like particles is due to nonspecific association of released
Wt-EGFR with independently released particles but rather points to
genuine incorporation, i.e., to Wt-EGFR being an integral component of
the viral membrane. To gain further support for this view, the pelleted
HIV-like particles containing Wt-EGFR or Tr-EGFR (i.e., material as in
Fig. 5, lanes 1 and 2) were further analyzed by velocity gradient
centrifugation (OptiPrep gradients), a procedure which has been
reported to yield retroviral particles of superior purity compared to
those obtained with conventional gradients (5). Gel
electrophoretic analysis of the radioactive proteins in the gradient
fractions revealed comigration of all EGFR components (Wt-EGFR and
Tr-EGFR) and HIV CA to a single region of the gradient (Fig.
6). This provides further proof that
these components are truly present in HIV-like particles and not in
contaminating vesicular material which would migrate differently in the
OptiPrep gradient.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 5.
Direct PAGE (no immunoprecipitation) of HIV-like
particles. HIV-like particles, concentrated by centrifugation through a
sucrose cushion, have been derived from the culture supernatants of
metabolically labelled 293T cells coexpressing (Co) Wt-EGFR (lane 1) or
Tr-EGFR (lane 2) plus HIV-like particles or from culture supernatants
of 293T cells expressing HIV-like particles alone mixed (Mix) with the
supernatant of cells expressing Wt-EGFR alone (lane 3) or Tr-EGFR alone
(lane 4).
|
|

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
OptiPrep velocity gradient centrifugation. HIV-like
particles concentrated from the culture supernatants of metabolically
labelled 293T cells coexpressing Wt-EGFR plus HIV-like particles (A) or
Tr-EGFR plus HIV-like particles (B) were centrifuged on 6 to 18%
iodixanol gradients as described previously (5). Lanes P,
gel electrophoresis of the starting materials; lane P*, a longer
exposure of lane P, done to visualize more weakly labelled bands at the
positions of HIV MA and reverse transcriptase; lanes 1 to 11 (from the
top to the bottom of the gradient), gel electrophoresis of the
radioactive proteins in the gradient fractions. The positions of
Wt-EGFR, Tr-EGFR, CA, and MA are shown.
|
|
As additional proof of incorporation of Wt-EGFR and Tr-EGFR into
HIV-like particles, we analyzed whether immunoprecipitation
with EGFR
antibody under native conditions would result in precipitation
of
intact HIV-like particles and thus coimmunoprecipitation of
radioactive
CA. Radioactively labelled supernatants from cells
coexpressing Wt-EGFR
or Tr-EGFR plus pKEx-HIV

Env3 were clarified
by filtration and
subsequently immunoprecipitated, in the absence
of detergent, with EGFR
antibody. As shown in Fig.
7, in both
cases this led to coimmunoprecipitation of radioactive CA. In
addition
to the specific EGFR products of high molecular weight,
the 50-kDa EGFR
species observed previously could again be seen.
The fact that CA was
immunoprecipitated with EGFR antibody indicates
that intact particles
were immunoprecipitated and is further proof
of incorporation of
Wt-EGFR and Tr-EGFR into the viral membrane.
In summary, all of the
experiments described so far point to the
presence of Wt-EGFR and
Tr-EGFR in HIV-like particles demonstrating
genuine incorporation.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 7.
Immunoprecipitation of native HIV-like particles with
EGFR antibody. PAGE and autoradiography of immunoprecipitates derived,
in the absence of detergent, from the supernatants of metabolically
labelled 293T cells coexpressing Wt-EGFR (lane 1) or Tr-EGFR (lane 2)
plus HIV-like particles. The positions of molecular mass markers are
indicated on the right, and the positions of Wt-EGFR, Tr-EGFR, and CA
are indicated on the left.
|
|
Immunogold labelling of HIV-like particles with incorporated
Wt-EGFR and Tr-EGFR.
We wanted to confirm that the Wt-EGFR and
Tr-EGFR components detected in the preparations of HIV-like particles
and interpreted to represent incorporation were spatially tightly
associated with the surface of these particles. For this purpose,
HIV-like particle preparations were labelled with EGFR antibody and
secondary gold-labelled antibodies and analyzed by electron microscopy.
The visualized particles, which had remained unfixed and untreated
during the labelling procedure, were of relatively uniform round size
and not observed at all in samples of centrifuged supernatants from cells expressing Wt-EGFR or Tr-EGFR alone. Particles from supernatants of cells coexpressing pKEx-Wt-EGFR and pKEx-HIV
Env (Fig.
8, panels a and b) or from cells
coexpressing pKEx-Tr-EGFR and pKEx-HIV
Env (Fig. 8, panels c through
e) showed very significant gold labelling. The labelling was
exclusively on, or in the vicinity of, the HIV-like particles, and
virtually no gold particles could be observed in any other areas of the
preparation. The negative controls were HIV-like particles from culture
supernatants mixed and incubated as described above (Fig. 8, panels f
and g) and HIV-like particles from cells expressing HIV-like particles
in the absence of any EGFR species (Fig. 8, panel h). In these latter
cases, no gold particles could be observed on or in the vicinity of the
HIV-like particles.

View larger version (138K):
[in this window]
[in a new window]
|
FIG. 8.
Immunogold labelling of HIV-like particles. HIV-like
particles derived from supernatants of cells coexpressing pKEx-Wt-EGFR
and pKEx-HIV Env (a and b), from supernatants of cells coexpressing
pKEx-Tr-EGFR and pKEx-HIV Env (c through e), from culture supernatant
of cells expressing pKEx-Wt-EGFR alone mixed and incubated with the
supernatant of cells expressing pKEx-HIV Env alone (f and g), and
from the culture supernatant of cells expressing pKEx-HIV Env alone
(h) were labelled with EGFR antibody and secondary antibody coupled to
gold particles. Bar, 100 nm.
|
|
The immunogold labelling of the particles that had incorporated Tr-EGFR
was dense, reflecting the very significant incorporation
of this
component, as illustrated by the results already described.
The
labelling of the HIV-like particles that had incorporated
Wt-EGFR,
although very significant, was clearly less dense than
that of
particles with Tr-EGFR. Presumably, this reflects the
fact that, as
indicated from the results in Fig.
3, in comparison
to Tr-EGFR,
incorporation of Wt-EGFR was reduced by a factor of
about 5 and the
actual number of incorporated Wt-EGFR molecules
was reduced by a factor
of about 7.5. Assuming that about half
of the signal in the HIV-like
particles with Wt-EGFR may be due
to proteolytically degraded EGFR
components, the immunolabelling
of the full-length Wt-EGFR in these
particles was still very significant,
verifying the incorporation of
this component into the HIV-like
particles.
 |
DISCUSSION |
In this paper, we have addressed the question of whether a bulky
foreign C terminus on a heterologous cell-surface glycoprotein sterically inhibits its incorporation into the membranes of HIV particles and, if so, whether this inhibition can be alleviated by
truncation of the C-terminal domain. Wt-EGFR is a type 1 surface glycoprotein, as is HIV Env. It has a long cytoplasmic domain of 542 aa. Wt-EGFR and a truncated version with only 7 C-terminal aa (Tr-EGFR)
were thus chosen as suitable molecules to address this question.
We could establish very significant incorporation of Tr-EGFR into
HIV-like particles. Incorporation of Wt-EGFR was significantly decreased (by a factor of about 5 in comparison to that of Tr-EGFR) but, to our surprise, was clearly detectable. The negative controls were the centrifuged materials derived from the culture supernatants of
cells expressing the glycoprotein species alone. Without exception (well over 10 experiments were performed), no Wt-EGFR or Tr-EGFR material could be detected in these samples. It is important to emphasize this fact, since in the case of certain other viral and
chimeric glycoproteins we have observed that the glycoprotein of
interest may be detectable to varying extents in the centrifuged materials obtained in the absence of virus-like particles (unpublished data), a situation which has also been described and further analyzed for VSV G glycoprotein (21). In these cases, and in the
absence of further assays (e.g., infectivity conferred by the
putatively incorporated glycoprotein), it is virtually impossible to
reach a conclusion as to whether incorporation into particles has
occurred or not. Importantly, as mentioned above, this was never
observed with Wt-EGFR or Tr-EGFR, so that the finding of pelletable
glycoprotein pointed to genuine incorporation of these components into
the membranes of the HIV-like particles. This conclusion was further verified by a number of control experiments and, most convincingly, by
immunoelectron microscopy. EGFR antibody-coated gold particles significantly labelled only the surface of the HIV-like particles with
incorporated Wt-EGFR or Tr-EGFR, and virtually no gold particles were
detected anywhere else in the purified virus preparation. In fact, the
labelling of the HIV-like particles which had incorporated Tr-EGFR was
very dense, pointing to the incorporation of this moiety being
efficient. In a direct comparison of metabolically labelled virus
particles, the number of Tr-EGFR molecules in HIV-like particles
exceeded the number of gp120 molecules present in wild-type particles,
expressed from a proviral construct, by a factor of about 5 (data not
shown). Although detection of gp120, which can be lost from particles
by shedding, gives an underestimate of the extent of HIV glycoprotein
incorporation, this comparison nevertheless indicates that the
incorporation of the overexpressed Tr-EGFR into HIV-like particles is
presumably at least as efficient as that of the homologous viral
glycoprotein. This lends further support to the notion that
heterologous viral or cellular surface glycoproteins are incorporated
into HIV-like particles (and presumably into retroviral particles in
general) more or less passively, i.e., when circumstances which do not
prevent incorporation are present. These inhibitory circumstances
include interactions with other cellular proteins which prevent
incorporation either sterically or by sequestering in subcellular
regions different from the virus assembly site. Members of our group
have previously demonstrated that this situation can apply to the
incorporation of Wt-CD4 into HIV-like particles. Coexpression of its
cellular interaction partner, p56lck, which
binds to the C terminus of CD4, inhibited incorporation (9).
Since we were unable to demonstrate a different subcellular localization of CD4 in the presence or absence of
p56lck, we concluded that there had been steric
inhibition of incorporation due to the presence of the bulky
p56lck molecule at the C terminus of CD4.
However, it cannot be strictly ruled out that, in the presence of
p56lck, CD4 is sequestered away from the virus
assembly site and that this could not be detected by the methods
employed. Recently, evidence has been reported that HIV-1 glycoprotein,
which is not incorporated into VSV particles, localized to plasma
membrane domains distinct from the VSV budding sites. This distinct
localization was mediated by a defined region in the cytoplasmic C
terminus (11) and could account for the lack of
incorporation, independent of a possible additional inhibitory role of
the large size of the HIV glycoprotein C terminus. It is likely that in
a differentiated cell, most cellular proteins will have functional
interaction partners and thus be excluded from the membrane of
retroviral particles. This would result in a passive enrichment of
those cell-surface components lacking cellular interaction partners in
the viral, as compared to the cellular, membrane. This situation would
apply for Tr-EGFR expressed in 293T cells, and, in fact, the dense
immunogold labelling of the HIV-like particles having incorporated this
component strongly speaks for its enrichment in the viral membrane.
The demonstration of incorporation of Wt-EGFR into HIV-like particles
was a surprising result since we had anticipated that the long
cytoplasmic domain, which is foreign with respect to the viral core
structure, would be sterically inhibitory. This anticipation was based
on the fact that, in several cases, viral glycoproteins with long
heterologous C termini have been excluded from incorporation into
retroviral particles (14, 23, 27). However, in a recent
report it was shown that murine leukemia virus vector particles
pseudotyped with wild-type simian immunodeficiency virus Env, which has
a long C-terminal domain, could mediate vector transduction into
CD4+ cells (10). It is not clear how many
incorporated Env molecules are required for infectivity, and in that
report, neither the extent of incorporation nor the identity of the Env
components was analyzed. As shown here for Wt-EGFR, proteolytically
processed components may become preferentially incorporated, a
possibility which was not analyzed in the case of wild-type simian
immunodeficiency virus Env. In the present study, we directly
visualized and quantitated incorporation of the expressed EGFR
components and established that, in the case of the Wt-EGFR, the
full-length molecule, and not exclusively a processed product, was
incorporated into the HIV-like particles. Wt-EGFR is expressed slightly
less at the cell surface than Tr-EGFR (Fig. 2B), which may be one of
the factors contributing to its decreased incorporation. It is also not
known to what extent Wt-EGFR and, in particular, its C-terminal domain may encounter interaction partners in 293T cells in which it is normally not expressed and how this may be influenced by natural ligands present in the medium (fetal calf serum). Thus the fivefold reduction in the extent of incorporation of Wt-EGFR in comparison to
that of Tr-EGFR may be due to interactions with further cellular factors which themselves result in steric inhibition or altered subcellular localization away from the virus assembly site.
Alternatively, steric inhibition by the very long Wt-EGFR C terminus
itself may result in reduced but not completely abolished
incorporation. Based on crystallographic data, it has been proposed
that retroviral matrix proteins form a network of trimers with
saucer-like depressions between neighboring trimers which is proposed
to accommodate the cytoplasmic tail of gp41 (18;
reviewed in reference 3). It is possible that the
542 C-terminal aa of the incorporated Wt-EGFR are somehow accommodated
in this region. Alternatively, the matrix layer may not exclusively and
tightly occupy the total space underlying the viral membrane, with the
result that space could be available to accommodate this bulky
C-terminal region.
In conclusion, the information gained from these analyses allows
further refinement of models concerning the processes governing glycoprotein incorporation into retroviral particles. A hypothesis which is compatible with the data available at present is that viral
and cellular glycoproteins are incorporated into retroviral particles
when inhibitory circumstances do not prevail. Circumstances preventing
incorporation depend on both the structure of the particular glycoprotein and the cell in which it is expressed. Surface proteins which interact with further cellular proteins may be excluded from
incorporation either sterically or by sequestering to subcellular regions distinct from the viral assembly site. However, surface glycoproteins lacking cellular interaction partners would presumably be
able to passively diffuse to the viral assembly site and potentially be
incorporated. Although the results of previous analyses had suggested
that the presence of a long heterologous C terminus per se would
sterically inhibit incorporation, the possibility should now be
considered that this may not, or may only partially, be the case.
Further experiments should be aimed at distinguishing between the role
of C-terminal regions in mediating distinct subcellular localizations
as compared to direct steric inhibition at the viral assembly site. On
the more practical side, these ongoing analyses provide information
relevant to achieving incorporation of targeting molecules of interest
into retroviral particles and indicate also that incorporation of those
molecules, whose function may depend on a long cytoplasmic region, may
be possible.
 |
ACKNOWLEDGMENTS |
We thank Khashayarsha Khazaie for supplying human EGFR DNA and
EGFR antibody and Michael Pawlita and Thomas Wilk for fruitful discussions.
This work was supported by grant 01-KI-9412 from the Bundesministerium
für Bildung, Wissenschaft, Forschung und Technologie.
 |
FOOTNOTES |
*
Corresponding author. Mailing address:
Forschungsschwerpunkt Angewandte Tumorvirologie, F0200, Deutsches
Krebsforschungszentrum, Im Neuenheimer Feld 242, D-69120
Heidelberg, Germany. Phone: (0)6221-424948. Fax: (0)6221-424932.
E-mail: v.bosch{at}dkfz-heidelberg.de.
 |
REFERENCES |
| 1.
|
Bastiani, L.,
S. Laal,
M. Kim, and S. Zolla-Pazner.
1997.
Host cell-dependent alterations in envelope components of human immunodeficiency virus type 1 virions.
J. Virol.
71:3444-3450[Abstract].
|
| 2.
|
Bosch, V., and R. T. Schwarz.
1984.
Processing of gPr92env, the precursor to the glycoproteins of Rous sarcoma virus: use of inhibitors of oligosaccharide trimming and glycoprotein transport.
Virology
132:95-109[Medline].
|
| 3.
|
Conte, M., and S. Matthews.
1998.
Retroviral matrix proteins: a structural perspective.
Virology
246:191-198[Medline].
|
| 4.
|
Cosson, P.
1996.
Direct interaction between the envelope and matrix protein of HIV-1.
EMBO J.
15:5783-5788[Medline].
|
| 5.
|
Dettenhofer, M., and X. F. Yu.
1999.
Highly purified human immunodeficiency virus type 1 reveals a virtual absence of Vif in virions.
J. Virol.
73:1460-1470[Abstract/Free Full Text].
|
| 6.
|
Dong, J.,
M. G. Roth, and E. Hunter.
1992.
A chimeric avian retrovirus containing the influenza virus hemagglutinin gene has an expanded host range.
J. Virol.
66:7374-7382[Abstract/Free Full Text].
|
| 7.
|
Endres, M. J.,
S. Jaffer,
B. Haggerty,
J. D. Turner,
B. J. Doranz,
P. J. O'Brian,
D. L. Kolson, and J. A. Hoxie.
1997.
Targeting of HIV- and SIV-infected cells by CD4-chemokine receptor pseudotypes.
Science
278:1462-1464[Abstract/Free Full Text].
|
| 8.
|
Freed, E. O., and M. A. Martin.
1995.
Virion incorporation of envelope glycoproteins with long but not short cytoplasmic tails is blocked by specific, single amino acid substitutions in the human immunodeficiency virus type 1 matrix.
J. Virol.
69:1984-1989[Abstract].
|
| 9.
|
Henriksson, P., and V. Bosch.
1998.
Inhibition of cellular glycoprotein incorporation into human immunodeficiency virus-like particles by coexpression of additional cellular interaction partner.
Virology
251:16-21[Medline].
|
| 10.
|
Indraccolo, S.,
S. Minuzzo,
F. Feroli,
F. Mammano,
F. Calderazzo,
L. Chieco-Bianchi, and A. Amadori.
1998.
Pseudotyping of Moloney leukemia virus-based retroviral vectors with simian immunodeficiency virus envelope leads to targeted infection of human CD4+ lymphoid cells.
Gene Ther.
5:209-217[Medline].
|
| 11.
|
Johnson, J. E.,
W. Rodgers, and J. K. Rose.
1998.
A plasma membrane localisation signal in the HIV-1 envelope cytoplasmic domain prevents localisation at sites of vesicular stomatitis virus budding and incorporation into VSV virions.
Virology
251:244-252[Medline].
|
| 12.
|
Kräusslich, H.-G.,
C. Ochsenbauer,
A.-M. Traencker,
K. Mergener,
M. Fäcke,
H. R. Gelderblom, and V. Bosch.
1993.
Analysis of protein expression and virus-like particle formation in mammalian cells lines stably expressing HIV-1 gag and env gene products with or without active HIV proteinase.
Virology
192:605-617[Medline].
|
| 13.
|
Mammano, F.,
E. Kondo,
J. Sodroski,
A. Bukovsky, and H. G. Göttlinger.
1995.
Rescue of human immunodeficiency virus type 1 matrix protein mutants by envelope glycoproteins with short cytoplasmic domains.
J. Virol.
69:3824-3830[Abstract].
|
| 14.
|
Mammano, F.,
F. Salvatori,
S. Indraccolo,
A. De Rossi,
L. Chieco-Bianchi, and H. Göttlinger.
1997.
Truncation of the human immunodeficiency virus type 1 envelope glycoprotein allows efficient pseudotyping of Moloney murine leukemia virus particles and gene transfer into CD4+ cells.
J. Virol.
71:3341-3345[Abstract].
|
| 15.
|
Mebatsion, T.,
S. Finke,
F. Weiland, and K.-K. Conzelmann.
1997.
A CXCR4/CD4 pseudotype rhabdovirus that selectively infects HIV-1 envelope protein-expressing cells.
Cell
90:841-847[Medline].
|
| 16.
|
Naldini, L.,
U. Blömer,
P. Gallay,
D. Ory,
R. Mulligan,
F. H. Gage,
I. M. Verma, and D. Trono.
1996.
In vivo gene delivery and stable transduction of non-dividing cells by a lentiviral vector.
Science
272:263-267[Abstract].
|
| 17.
|
Pfeiffer, T.,
H. Zentgraf,
B. Freyaldenhoven, and V. Bosch.
1997.
Transfer of endoplasmic reticulum and Golgi retention signals to human immunodeficiency virus type 1 gp160 inhibits intracellular transport and proteolytic processing of viral glycoprotein but does not influence the cellular site of virus particle budding.
J. Gen. Virol.
78:1745-1753[Abstract].
|
| 18.
|
Rao, T.,
A. S. Belyaev,
E. Fry,
P. Roy,
I. M. Jones, and D. I. Stuart.
1995.
Crystal structure of SIV matrix antigen and implications for virus assembly.
Nature
378:743-747[Medline].
|
| 19.
|
Resh, M. D., and R. L. Erikson.
1985.
Highly specific antibody to Rous sarcoma virus src gene product recognises a novel population of pp60v-src and pp60c-src molecules.
J. Cell. Biol.
100:409-417[Abstract/Free Full Text].
|
| 20.
|
Rittner, C.,
H. Stöppler,
M. Pawlita, and G. Sczakiel.
1991.
Versatile eucaryotic vectors for strong and constitutive transient and stable gene expression.
Methods Mol. Cell. Biol.
2:176-181.
|
| 21.
|
Rolls, M. M.,
P. Webster,
N. H. Balba, and J. K. Rose.
1994.
Novel infectious particles generated by expression of the vesicular stomatitis virus glycoprotein from a self-replicating RNA.
Cell
79:497-506[Medline].
|
| 22.
|
Schnell, M. J.,
J. E. Johnson,
L. Buonocore, and J. K. Rose.
1997.
Construction of a novel virus that targets HIV-1 infected cells and controls HIV-1 infection.
Cell
90:849-857[Medline].
|
| 23.
|
Schnierle, B. S.,
J. Stitz,
V. Bosch,
F. Nocken,
H. Merget-Millitzer,
M. Engelstädter,
R. Kurth,
B. Groner, and K. Cichutek.
1997.
Pseudotyping of murine leukemia virus with the envelope glycoproteins of HIV generates a retroviral vector with specificity of infection for CD4-expressing cells.
Proc. Natl. Acad. Sci. USA
94:8640-8645[Abstract/Free Full Text].
|
| 24.
|
Ullrich, A.,
L. Coussens,
J. S. Hayflick,
T. J. Dull,
A. Gray,
A. W. Tam,
J. Lee,
Y. Yarden,
T. A. Libermann,
J. Sclessinger,
J. Downward,
E. L. Mayes,
N. Whittle,
M. D. Waterfield, and P. H. Seeburg.
1984.
Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells.
Nature
309:418-425[Medline].
|
| 25.
|
Waterfield, M. D.,
E. L. Mayes,
P. Stroobant,
P. L. Bennet,
S. Young,
P. N. Goodfellow,
G. S. Banting, and B. Ozanne.
1982.
A monoclonal antibody to the human epidermal growth factor receptor.
J. Cell. Biochem.
20:149-161[Medline].
|
| 26.
|
Wilk, T.,
T. Pfeiffer, and V. Bosch.
1992.
Retained in vitro infectivity and cytopathogenicity of HIV-1 despite truncation of the C-terminal tail of the env gene product.
Virology
189:167-177[Medline].
|
| 27.
|
Wilk, T.,
T. Pfeiffer,
A. Bukovsky,
G. Moldenhauer, and V. Bosch.
1996.
Glycoprotein incorporation and HIV-1 infectivity despite exchange of the gp160 membrane-spanning domain.
Virology
218:269-274[Medline].
|
| 28.
|
Young, J. A. T.,
P. Bates,
K. Willert, and H. E. Varmus.
1990.
Efficient incorporation of human CD4 protein into avian leukosis virus particles.
Science
250:1421-1423[Abstract/Free Full Text].
|
Journal of Virology, November 1999, p. 9294-9302, Vol. 73, No. 11
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jorgenson, R. L., Vogt, V. M., Johnson, M. C.
(2009). Foreign Glycoproteins Can Be Actively Recruited to Virus Assembly Sites during Pseudotyping. J. Virol.
83: 4060-4067
[Abstract]
[Full Text]
-
Beausejour, Y., Tremblay, M. J.
(2004). Interaction between the Cytoplasmic Domain of ICAM-1 and Pr55Gag Leads to Acquisition of Host ICAM-1 by Human Immunodeficiency Virus Type 1. J. Virol.
78: 11916-11925
[Abstract]
[Full Text]
-
Bosch, V., Kramer, B., Pfeiffer, T., Starck, L., Steinhauer, D. A.
(2001). Inhibition of release of lentivirus particles with incorporated human influenza virus haemagglutinin by binding to sialic acid-containing cellular receptors. J. Gen. Virol.
82: 2485-2494
[Abstract]
[Full Text]
-
Zeilfelder, U., Bosch, V.
(2001). Properties of Wild-Type, C-Terminally Truncated, and Chimeric Maedi-Visna Virus Glycoprotein and Putative Pseudotyping of Retroviral Vector Particles. J. Virol.
75: 548-555
[Abstract]
[Full Text]
-
Hoffman, T. L., Canziani, G., Jia, L., Rucker, J., Doms, R. W.
(2000). A biosensor assay for studying ligand-membrane receptor interactions: Binding of antibodies and HIV-1 Env to chemokine receptors. Proc. Natl. Acad. Sci. USA
10.1073/pnas.190274097v1
[Abstract]
[Full Text]
-
Yap, M. W., Kingsman, S. M., Kingsman, A. J.
(2000). Effects of stoichiometry of retroviral components on virus production. J. Gen. Virol.
81: 2195-2202
[Abstract]
[Full Text]
-
Hoffman, T. L., Canziani, G., Jia, L., Rucker, J., Doms, R. W.
(2000). A biosensor assay for studying ligand-membrane receptor interactions: Binding of antibodies and HIV-1 Env to chemokine receptors. Proc. Natl. Acad. Sci. USA
97: 11215-11220
[Abstract]
[Full Text]