This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plafker, S. M.
Right arrow Articles by Gibson, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plafker, S. M.
Right arrow Articles by Gibson, W.

 Previous Article  |  Next Article 

Journal of Virology, November 1999, p. 9053-9062, Vol. 73, No. 11
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Phosphorylation of Simian Cytomegalovirus Assembly Protein Precursor (pAPNG.5) and Proteinase Precursor (pAPNG1): Multiple Attachment Sites Identified, Including Two Adjacent Serines in a Casein Kinase II Consensus Sequence

Scott M. Plafker,1,dagger Amina S. Woods,2 and Wade Gibson1,*

Virology Laboratories1 and Mid-Atlantic Mass Spectrometry Center,2 Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205

Received 13 May 1999/Accepted 30 July 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The assembly protein precursor (pAP) of cytomegalovirus (CMV), and its homologs in other herpesviruses, functions at several key steps during the process of capsid formation. This protein, and the genetically related maturational proteinase, is distinguished from the other capsid proteins by posttranslational modifications, including phosphorylation. The objective of this study was to identify sites at which pAP is phosphorylated so that the functional significance of this modification and the enzyme(s) responsible for it can be determined. In the work reported here, we used peptide mapping, mass spectrometry, and site-directed mutagenesis to identify two sets of pAP phosphorylation sites. One is a casein kinase II (CKII) consensus sequence that contains two adjacent serines, both of which are phosphorylated. The other site(s) is in a different domain of the protein, is phosphorylated less frequently than the CKII site, does not require preceding CKII-site phosphorylation, and causes an electrophoretic mobility shift when phosphorylated. Transfection/expression assays for proteolytic activity showed no gross effect of CKII-site phosphorylation on the enzymatic activity of the proteinase or on the substrate behavior of pAP. Evidence is presented that both the CKII sites and the secondary sites are phosphorylated in virus-infected cells and plasmid-transfected cells, indicating that these modifications can be made by a cellular enzyme(s). Apparent compartmental differences in phosphorylation of the CKII-site (cytoplasmic) and secondary-site (nuclear) serines suggest the involvement of more that one enzyme in these modifications.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Herpesvirus capsid assembly involves the coordinated interaction of at least five viral proteins. Three of these ultimately interact strongly to form the outer shell, and the other two are internal and interact more transiently with the outer shell and with each other to facilitate capsid formation. The internal proteins form a scaffolding array that is proteolytically freed from the outer shell and largely eliminated from the cavity of the capsid to enable DNA packaging. These internal proteins, in cytomegalovirus (CMV) called the assembly protein precursor (pAP) and proteinase precursor (pNP1), are genetically related and are distinguished from the other capsid proteins by posttranslational modifications (reviewed in references 10, 32, and 41).

CMV pAP and its homologs in other herpesviruses, most notably pVP22a in herpes simplex virus (HSV UL26.5 protein), has at least two important functions in capsid assembly. One is to escort the major capsid protein (MCP; human CMV UL86 protein) into the nucleus by serving as a nuclear localization signal (NLS)-bearing escort (29, 33, 48). Another is to act as a molecular scaffold in guiding formation of the procapsid shell within the nucleus (3, 17, 21). Once procapsid formation is complete, and possibly in conjunction with DNA packaging, pAP is freed from its interaction with MCP by proteolytic cleavage near its carboxyl end and eliminated from the capsid cavity (12, 17, 34). This cleavage is made by a genetically related proteinase that contains the entire pAP sequence as its carboxyl end (23, 31, 47). The proteinase is essential for the production of infectious virus (7, 30) and has received considerable attention as a potential antiviral target (11, 15).

Phosphorylation is a second modification that distinguishes the CMV pAP and its homologs in other herpesviruses (6, 8, 13, 16, 35). Although the significance of pAP phosphorylation and the nature of the modifying enzyme(s) is unknown, both are of interest mechanistically and as they may lead to new antiviral targets. The work described here represents an initial step in studying this modification. Our findings identify the principal phosphorylation site on the CMV pAP, show that smaller amounts of pAP isoforms are generated by phosphorylation at an additional site(s), and provide initial evidence that these modifications may be made by more than one enzyme.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cells and virus. Human foreskin fibroblasts were cultured, grown, and infected with simian cytomegalovirus (SCMV), strain Colburn, as described before (8). Human embryonic kidney (HEK) cells (line 293, ATCC CRL-1573) were grown in 35-mm-diameter wells (product no. 3001; Becton Dickinson, Lincoln Park, N.J.), each containing 3 ml of Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum.

Plasmids and cloning. Standard DNA techniques (36) were used to clone and propagate plasmids. Phosphorylation-site mutants of pAP were made from AW1, the pAP coding sequence in vector RSV.5neo (47). They were made by excising a wild-type sequence and replacing it with the appropriate mutant sequence.

Mutants pAP/S156A.RSV.5neo (SP20), pAP/S157A.RSV.5neo (SP21), pAP/S156A, S157A.RSV.5neo (SP22), pAP/S156A, E160A.RSV.5neo (SP23), and pAP/E159A, E160A.RSV.5neo (SP24) were all made by linearizing AW1 with MluI, digesting the linear plasmid with SmaI, and isolating the resulting 6,046-bp fragment by agarose gel electrophoresis. The 37-bp excised MluI/SmaI fragment was replaced with a mutation-encoding oligonucleotide (altered sequence is underlined), annealed to a complementary strand such that a 5' MluI overhang and 3' blunt end resulted. The S156A oligonucleotide was CGCGGCATCTGATGAAGAAGAAGACATGTCTTTTCCC; the S157A oligonucleotide was CGCGTCAGCTGATGAAGAAGAAGACATGTCTTTTCCC; the S156A,S157A oligonucleotide was CGCGGCAGCTGATGAAGAAGAAGACATGTCTTTTCCC; the S156A,E160A oligonucleotide was CGCGGCTTCGGATGAGGCTGAAGACATGAGTTTTCCC; and the E159A,E160A oligonucleotide was CGCGTCCTCGGATGCTGCTGAAGACATGAGTTTTCCC.

The S156A,S157A double mutation was also subcloned into the SCMV maturational proteinase (pNP1) expressed from AW4, the pNP1 coding sequence in vector RSV.5neo (47), and into an inactive serine nucleophile mutant (S118A) expressed from plasmid S118A.L.RSV.5neo (45), to give pNP1/CKII- and S118A/CKII-, respectively. This was done by replacing the BamHI/DraIII fragment of each with the corresponding fragment from SP22.

Transfections and immunoprecipitations. HEK cells (approx 106 cells/35-mm-diameter well) were transfected with 6.0 µg of plasmid per well by the calcium phosphate method (2), as before (14). Twenty-four hours later the culture medium was replaced with fresh medium, where appropriate, containing 32P (400 µCi/ml; Amersham, Arlington Heights, Ill.) or [35S]methionine (50 µCi/ml; ICN, Costa Mesa, Calif.). Two days later, cells were harvested and processed for immunoprecipitation by aspirating the medium from the dish, adding 200 µl of lysis buffer (0.5 M KCl, 1% NP-40, 0.5% deoxycholate, and 1 mM phenylmethylsulfonyl fluoride in phosphate-buffered saline (pH 7.4) to each dish, and scraping the lysate to an edge for transfer to a 500-µl tube. The resulting lysate was subjected to vortex mixing (four vigorous pulses) and clarified by centrifugation (16,000 × g, 10 min, 4°C), and the supernatant fraction was transferred to a new tube and either processed immediately or stored at -80°C until needed (typically not more than 1 week). Immunoprecipitation reactions were done with the rabbit antipeptide antisera specified in Results and protein A beads, as described before (45).

AP isolation from B-capsids by HPLC. Intranuclear B-capsids were recovered from infected human foreskin fibroblasts by freezing and thawing, essentially as described before (17). The particles were concentrated by pelleting (39,000 rpm, 90 min, 4°C, SW41 rotor) and either solubilized in preparation for polyacrylamide gel electrophoresis (PAGE) or disrupted by heating at 80°C for 3 min in a solution of aqueous 6 M guanidine and 1% beta -mercaptoethanol in preparation for reverse-phase high-performance liquid chromatography (RP-HPLC).

RP-HPLC was done by using an analytical (4.6-mm-diameter, 25-cm) C4 column (Vydak, Hesperia, Calif.) and an acetonitrile gradient in aqueous, 0.1% trifluoroacetic acid (TFA), essentially as described before (12) except that the acetonitrile gradient was increased by only 0.125% per min between 45 and 50% (i.e., the elution range of AP).

SDS-PAGE and Western immunoassays. Standard procedures were used for protein separation by SDS-PAGE, staining with Coomassie brilliant blue (CBB), and autoradiography; details have been described before (8, 35, 45). In preparation for SDS-PAGE, samples were solubilized in 2× protein sample buffer (4% SDS, 2.86 M beta -mercaptoethanol, 10% glycerol, 100 mM Tris [pH 7.0], 0.01% bromophenol blue). Resolving and stacking gels were 10 and 4% acrylamide, respectively; the ratio of acrylamide to methylene bisacrylamide was 28:0.735; SDS was from Bio-Rad (Richmond, Calif.; catalog no. 161-0300), and intensifying screens were Kodak Biomax MS in combination with Kodak Biomax MS film.

Western immunoassays were done, essentially as described by Towbin et al. (42) and detailed before (45), using the specified antipeptide antisera followed by [125I]protein A (no. IM144; Amersham) for detection.

Quantification of CBB-stained proteins was done from digital recordings prepared by scanning dried gels with reflected visible light in a UMax flat-bed scanner (UMax Technologies, Inc., Fremont, Calif.). Measurements were made only for bands determined to be within the linear response range (established with serial dilutions of bovine serum albumin). 32P incorporation was measured with a BAS1000 phosphorimager (Fuji Photo Film Co., Ltd., Tokyo, Japan). The Quant mode of the MacBAS (version 2.5) software (Fuji) was used to calculate band intensities from selected areas of the resulting images.

Thin-layer separation of phosphopeptides. Two-dimensional (2-D) separations of tryptic phosphopeptides on thin-layer cellulose (TLC) plates was done essentially as described before (12). Protein bands were located by CBB staining or by autoradiography, excised from the gel, treated with trypsin (Worthington Biochemical Corp., Freehold, N.J.), and subjected to electrophoresis at pH 1.9 followed by ascending chromatography. The chromatography buffer was isobutyric acid-butanol-pyridine-acetic acid-water (65:5:3:2:25) (38). Phosphopeptides were detected by fluorography using Biomax film and intensifying screens.

Peptide analysis by mass spectrometry. 32P-labeled AP (approx 25 µg) was prepared by RP-HPLC as described above and treated with 15 µg of trypsin (no. 1418475; Boehringer Mannheim) per sample overnight at room temperature; the resulting peptides were subjected to RP-HPLC using a Vydak C18 column eluted with a gradient of acetonitrile in aqueous 0.1% TFA, essentially as described before (49).

The 32P-labeled peptides eluted at approx 28% acetonitrile as a peak collected in seven fractions. A sample of the fraction containing the highest amount of 32P radioactivity was lyophilized; suspended in 20% acetonitrile-0.1% aqueous TFA; mixed with equal volumes of alpha -hydroxycinnamic acid (saturated solution in 50% ethanol) and ammonium sulfate (saturated solution in water); and analyzed, in both the positive and negative ion modes, in a Kompact MALDI4 matrix-assisted laser desorption-time-of-flight mass spectrometer (Kratos Analytical, Manchester, England), using a 337-nm N2 laser and a 20-kV extraction voltage.

Alkaline phosphatase treatment of pAP. 32P- or [35S]methionine-labeled pAP was immunoprecipitated from transfected HEK cells with anti-C1 (39) as described above. The bead-bound immune complexes were washed twice in calf intestinal alkaline phosphatase (CIAP) buffer (50 mM Tris-HCl, 0.1 mM EDTA [pH 8.5]) containing 1 mM phenylmethylsulfonyl fluoride, suspended in 200 µl of CIAP buffer (per 20 mg of beads), and aliquoted equally into five tubes. After pelleting the beads again and removing the supernatant, CIAP (10 U/tube, in final volume of 100 µl; Boehringer Mannheim, Indianapolis, Ind.) was added and allowed to react for the specified times. Mock-treated control samples were incubated in the same volume of reaction buffer with no CIAP. Nontreated control samples (time zero) were prepared by adding 2× protein sample buffer to the pelleted beads, instead of CIAP reaction buffer. Reactions were shaken at 37°C for the times indicated and spun for 30 s at 16,000 × g to pellet the bead-bound immune complexes, and the supernatant was removed. The beads were then suspended in an equal volume of 2× protein sample buffer and frozen at -80°C until analyzed, or immediately subjected to SDS-PAGE followed by autoradiography and phosphorimaging.

Detection of Pi. The method used has been described before (40). Following CIAP reactions, the bead-bound immune complexes were pelleted from the preparation by centrifugation (16,000 × g, 1 min, 4°C); the supernatant was subjected to trichloroacetic acid precipitation, followed by addition of KH2PO4 and extraction with isobutanol-toluene and ammonium molybdate. The upper phase resulting from centrifugation (12,000 × g, 5 min, room temperature) of the mixture was removed and analyzed for Cerenkov radiation in a scintillation spectrometer.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Identification of primary phosphopeptides of AP from CMV-infected cells. 32P-labeled AP was purified by HPLC from CMV B-capsids (Fig. 1A) and digested with trypsin, and the resulting peptides were resolved by HPLC. A major peak of 32P radioactivity was detected (Fig. 1B), and a sample of fraction 25 was subjected to mass spectrometry. Seven of the observed peaks correlate with three predicted AP tryptic fragments (Fig. 1C). The peak with the largest mass-to-charge ratio, 2,044, corresponds to the AP tryptic peptide, Gly 124 to Arg 141 (no phosphate). The peaks at 2,153, 2,232, and 2,314 correspond to the AP tryptic peptide, Asp 154 to Lys 173 (designated casein kinase IIa [CKIIa]; Fig. 1C, inset), in its non-, mono-, and diphosphorylated states, respectively. The peaks at 2,438, 2,517, and 2,602 correspond to an incompletely cleaved form of the same peptide, Glu 152 to Lys 173 (designated CKIIb; Fig. 1C, inset), in its respective non-, mono-, and diphosphorylated states. Because CKIIa is a limit tryptic peptide containing three serines, and CKIIb is an amino-terminal extension of CKIIa, these data localize the primary sites of phosphorylation to one or more of three serines (i.e., Ser156, Ser157, and Ser164; Fig. 1C, inset) in the carboxyl half of AP. Differential ionization properties (22, 49) of the di-, mono-, and nonphosphorylated forms of the peptides limit use of these data to qualitative interpretation only.


View larger version (31K):
[in this window]
[in a new window]
 
FIG. 1.   AP is phosphorylated at its CKII-site serines in CMV-infected fibroblasts. 32P-containing AP was purified by HPLC from nuclear B-capsids (A) and digested with trypsin, and the resulting phosphopeptides were resolved by HPLC (B) and analyzed by mass spectrometry (C), all as described in Materials and Methods. Shown are the distributions of 32P radioactivity in fractions collected from the chromatographic separations (A and B) and a mass spectrum obtained in the negative ion mode from a sample of panel B HPLC fraction 25 (C). Panel C (inset) also shows two pAP tryptic peptides, CKIIa (Asp154-Lys173) and CKIIb (Glu152-Lys173), that contain a CKII consensus sequence (underlined) and three serine residues (larger letters).

AP is similarly phosphorylated in virus-infected and plasmid-transfected cells. When 32P-labeled AP recovered from B-capsids was compared by 2-D peptide separation with 32P-labeled AP expressed by transfection (Fig. 2A and B, respectively), the patterns were essentially the same (e.g., mixture [Fig. 2C]). Two predominant (i.e., spots 1 and 2) and several minor (e.g., spots a, b, and c) phosphopeptides were present in both. Upon redigestion with trypsin, isolated peptide 1 was unchanged but about 50% of isolated peptide 2 was converted to peptide 1 (data not shown). These results are compatible with phosphopeptide 2 being an incomplete cleavage product, corresponding to the mono- and/or diphosphorylated CKIIb species detected by mass spectrometry, and peptide 1 being the mono- and/or diphosphorylated form of the limit tryptic peptide, CKIIa (additional evidence below). Thus, AP appears to be similarly phosphorylated whether recovered from B-capsids or transfected cells, indicating that these modifications can be made by a cellular enzyme.


View larger version (71K):
[in this window]
[in a new window]
 
FIG. 2.   Phosphopeptide patterns of AP from transfected and infected cells are the same. 32P-labeled AP recovered from infected (A) or transfected (B) cells was digested with trypsin, and the resulting hydrolysates, individually or in combination (C), were subjected to 2-D separation on TLC plates. Shown is a collage of autoradiographic images prepared from the resulting plates. The position of the origin (Ori) is indicated, electrophoresis was from left to right, and chromatography was from bottom to top. Phosphopeptide designations are described in the text. Radioactivity in the region of each plate containing the cluster of labeled spots was quantified following phosphorimaging; the photo-stimulated luminescence (psl) measured in panels A + B approximated that of the mixture on plate C.

Primary sites of pAP phosphorylation are within a CKII consensus sequence. Given that AP phosphorylation appears to be the same in plasmid-transfected cells as in CMV-infected cells (e.g., Fig. 2), we used the more amenable transfection system to fine map and further study AP phosphorylation. In the first experiment, each of the three serines in the CKIIa peptide was mutated to determine which is phosphorylated. The AP precursor, pAP (see Fig. 8B), was used for these and subsequent transfection/immunoprecipitation experiments because it could be more efficiently immunoprecipitated than AP, and its 2-D phosphopeptide pattern was indistinguishable from that of AP (data not shown).

The wild-type and mutant proteins were expressed in 32P-labeled transfected cells, immunoprecipitated, and analyzed by SDS-PAGE/CBB staining followed by phosphorimaging. Wild-type pAP showed as two bands (pAP and pAP*) by CBB staining (Fig. 3A, top window). The same two bands, plus an often weaker third band (pAP**), were detected by radiolabeling (Fig. 3A, middle window; also see Fig. 8A, lane 1). Mutation of Ser 164 had no effect on either the staining or radiolabeling pattern relative to wild-type pAP (data not shown). Mutation of Ser 156 or 157, or both, had no evident effect on the amount or relative abundance of the mutant proteins (Fig. 3A, top window) but reduced phosphorylation of the pAP band by 50 (S156-), 78 (S157-), and 100% (S156,S157-), respectively, compared with wild-type pAP (Fig. 3A, middle and bottom windows). The same mutations reduced, but did not eliminate, phosphorylation of the corresponding pAP* and pAP** bands (Fig. 3A, middle window), as illustrated most clearly by the S156,S157- double mutant (Fig. 3A, leftmost lane).


View larger version (47K):
[in this window]
[in a new window]
 
FIG. 3.   Substitution of CKII-site serines 156 and 157, or glutamic acids 159 and 160, reduced pAP phosphorylation. pAP was immunoprecipitated from cells that had been transfected with wild-type (wt) or mutant-encoding plasmids and grown in medium containing 32Pi. pAP immunoprecipitates were subjected to SDS-PAGE, the proteins were stained with CBB, and the gels were dried and autoradiographed. Shown are images of the CBB-stained proteins (top windows in panels A and B) and autoradiograms prepared from the dried gels (middle windows in panels A and B). The radioactivity/stain intensity of mutant pAP normalized to radioactivity/stain intensity of wild-type pAP is given (bottom windows) for the serine mutants in panel A and for the glutamic acid or serine/glutamic acid mutants in panel B. pAP* and pAP** are electrophoretically slower-moving isoforms of pAP, not included in specific activity calculations of pAP. Abbreviations for the mutant proteins: S156,S157- (pAP/S156A,S157A), S157- (pAP/S157A), S156- (pAP/S156A); S156,E160- (pAP/S156A,E160A); and E159,E160- (pAP/E159A,E160A).

These data indicate that (i) Ser 156 and 157, which are in a CKII phosphorylation motif (19), are both phosphorylated; (ii) Ser 157 is phosphorylated more often than Ser 156 (i.e., pAP-specific activity reduced more by mutation of S 157); (iii) only serines 156 and 157 are phosphorylated on the pAP isoform; (iv) these residues are also phosphorylated on the pAP* and pAP** isoforms (i.e., pAP* and pAP** intensity decreased in mutants relative to wild type; also see Fig. 6 and 7); and (v) pAP* and pAP** are phosphorylated at sites not modified in pAP (also see Fig. 6D).

Phosphorylation at serines 156 and 157 is influenced by key acidic residues predictive of CKII substrates. CKII phosphorylation sites characteristically have a specificity-determining acidic amino acid at the +3 position (28). Both Ser 156 and 157 have +3 position acidic residues (i.e., SSDE159E160ED), and these were mutated to test their influence on pAP phosphorylation (Fig. 3B). The mutant proteins were expressed in 32P-labeled cells, immunoprecipitated, and analyzed by SDS-PAGE/CBB staining followed by phosphorimaging. When both Glu 159 and 160 were mutated to alanines, pAP phosphorylation was reduced by 83% relative to wild-type pAP (Fig. 3B, mutant pAP/E159A,E160A, middle and bottom windows). When Glu 160 alone (i.e., +3 to S157) was changed to Ala, but in the pAP/S156A mutant to test its specific effect on phosphorylation of S157, phosphorylation in the double Ser156/Glu160 mutant was reduced approx 30% more than observed in the single S156A mutant (compare Fig. 3A, S156-, with Fig. 3B, S156,E160-). These predicted effects of the +3 acidic residues on phosphorylation of Ser 156 and 157 are consistent with the substrate specificity of CKII or a related enzyme.

Electrophoretic mobility isoforms of pAP due to differential phosphorylation. Eliminating CKII serines 156 and 157 abolished phosphorylation of the primary pAP band but did not eliminate phosphorylation of pAP* and pAP**, indicating that the slower-migrating species are phosphorylated at other sites. To determine whether these additional phosphorylations are responsible for the slower electrophoretic mobilities of pAP* and pAP**, preparations of immunoprecipitated 32P- or [35S]methionine-labeled pAP were treated with CIAP for 1, 2, or 3 h, and the products of the reactions were separated by SDS-PAGE (Fig. 4A) and quantified by phosphorimaging, or processed to measure CIAP-released 32P (Fig. 4B). Phosphatase treatment reduced the amount of 32P labeling of all three bands (Fig. 4A, 32P lanes; Fig. 4B, 32Pb). This loss is attributed to dephosphorylation, rather than proteolytic degradation, because (i) it correlated with an increased amount of released 32P (Fig. 4B, 32Pr) and (ii) the combined amount of [35S]methionine-labeled protein in the three bands remained nearly constant (Fig. 4A, 35S lanes; Fig. 4B, 35Sb).


View larger version (33K):
[in this window]
[in a new window]
 
FIG. 4.   Susceptibility of assembly protein phosphorylation to CIAP treatment. Parallel samples of [35S]methionine-labeled and 32P-labeled pAP were immunoprecipitated from transfected cells and subjected to treatment with 10 U of CIAP for 1, 2, or 3 h, and the resulting products were resolved by SDS-PAGE and analyzed by phosphorimaging. Shown is an autoradiographic image of the CBB-stained gel (A) and a graph (B) showing, for each time point, the bound 32P (32Pb) and 35S (35Sb) (both in units of photo-stimulated luminescence [psl]) in the combined three pAP isoforms, and the total 32P released (32Pr). Time-zero samples were nontreated starting material, and mock-treated samples (M) were incubated for 3 h in CIAP reaction buffer lacking the phosphatase, all as described in Materials and Methods.

Dephosphorylation of the pAP isoform, which is phosphorylated only at CKII serines 156 and 157 (Fig. 3A), was complete within 1 h and had no detected effect on its electrophoretic mobility (Fig. 4A; compare respective 32P and 35S lanes). The amount of 32P radioactivity in the pAP* and pAP** bands was also dramatically reduced after 1 h of phosphatase treatment (presumably due to removal of their CKII-site phosphates); however, in contrast to pAP, pAP* and pAP** were not completely dephosphorylated, even after treatment for 3 h (Fig. 4A, 32P lanes). The loss of [35S]methionine-labeled protein from the pAP* and pAP** bands following CIAP treatment (Fig. 4A, 35S lanes) in the absence of evidence for proteolytic degradation (Fig. 4B, 35Sb) indicates a conversion of pAP* and pAP** to pAP. However, the low level of radioactivity, combined with the close spacing of these bands in the gel, precluded measuring each independently to quantify this conversion.

Similar results were obtained when the experiment was repeated with the pAP/S156A,S157A mutant to eliminate the strong background contributed by CKII-site phosphorylation. As demonstrated in Fig. 3A, no phosphorylation of pAP is detected with this mutant (Fig. 5A, 32P lanes). Although not well resolved in this experiment, it can be seen that both 32P-labeled (Fig. 5A, 32P lanes) and 35S-labeled (Fig. 5A, 35S lanes) pAP* and pAP** decreased with time of phosphatase treatment; dephosphorylation of pAP* and pAP** was not complete after treatment for 3 h; and the combined 35S radioactivity of the three bands remained about constant (Fig. 5B), consistent with conversion of pAP* and pAP** to pAP. Dephosphorylation of these secondary sites was slower than that observed for the CKII-site-containing bands, and the increase of free 32P was correspondingly slower (compare Fig. 4 and 5).


View larger version (32K):
[in this window]
[in a new window]
 
FIG. 5.   pAP* and pAP** are differentially phosphorylated forms of pAP. Parallel samples of 35S-methionine- and 32P-labeled CKII-site mutant pAP/S156A,S157A were immunoprecipitated from transfected cells and subjected to treatment with 10 U of CIAP for 1, 2, or 3 h, and the resulting products were resolved by SDS-PAGE and analyzed by phosphorimaging. Shown is an autoradiographic image of the CBB-stained gel (A) and a graph (B) showing, for each time point, the bound 32P (32Pb) and 35S (35Sb); displaced downward approximately 70 psl for presentation) (both in units of photo-stimulated luminescence [psl]) in the combined three pAP isoforms, and the total 32P released (32Pr). Time-zero samples were nontreated starting material, and mock-treated samples (M) were incubated for 3 h in CIAP reaction buffer lacking the phosphatase, all as described in Materials and Methods.

The data presented in Fig. 3 to 5 are interpreted to show that (i) pAP is phosphorylated at CKII serines 156 and 157 only, and both of these are readily dephosphorylated by CIAP; (ii) pAP* and pAP** are phosphorylated at sites other than serines 156 and 157 (Fig. 3A; see also Fig. 6D), and these secondary-site phosphorylations are more resistant to dephosphorylation by CIAP than the CKII-site serines (Fig. 4 and 5); and (iii) dephosphorylation of the secondary sites converts pAP* and pAP** to pAP.

Although not yet substantiated by mass spectrometry, it is probable that the secondary-site phosphorylations are due to addition of orthophosphate, rather than some other group (e.g., phospholipid or nucleotide), because (i) initial phospho-amino acid analyses indicate the presence of phosphoserine in the combined pAP*/pAP** band (29a), (ii) CIAP is expected to hydrolyze only phosphomonoester linkages, and (iii) the assay used to measure CIAP-released phosphate is considered specific for orthophosphate (40).

Identification of pAP* phosphopeptides containing secondary phosphorylation sites. Phosphopeptide patterns of wild-type and CKII-site mutants of pAP* were compared to correlate the different phosphorylation sites with specific peptides. Respective 32P-labeled pAP* bands were identified following SDS-PAGE of transfected-cell lysates, cleaved with trypsin, and compared by 2-D peptide analysis. Wild-type pAP* contained two phosphopeptides with low mobility in the chromatography phase (Fig. 6A, spots 1 and 2; doublets, probably due to differential oxidation of Met 163 [43]) and a group of about three phosphopeptides with high chromatographic mobility (i, ii, and iii) (Fig. 6A). Peptides 1 and 2 contain CKII-site serines 156 and 157, as deduced from the data in Fig. 1 and 2 and illustrated by their changes in the mutant proteins. Loss of either Ser 156 and 157 alone caused peptides 1 and 2 to shift toward the cathode (right, relative to spot iii), consistent with the reduced negative charge that loss of a phosphate would cause (Fig. 6B and C). Peptides 1 and 2 were not phosphorylated in the mutant lacking both Ser 156 and 157, establishing that these peptides contain the CKII site.


View larger version (73K):
[in this window]
[in a new window]
 
FIG. 6.   Verification of CKII-site, and identification of secondary-site, tryptic phosphopeptides. 32P-labeled wild-type pAP, or pAP from three CKII-site mutants (S156A, S157A, and S156A,S157A), was separated by SDS-PAGE; the pAP* band from each was digested with trypsin; and the resulting phosphopeptides were resolved by two-dimensional separation on TLC plates. Shown is a collage of autoradiographic images prepared from each plate. The position of the origin is indicated (Ori), electrophoresis was from left to right, and chromatography was from bottom to top. Phosphopeptide designations are described in the text; lines in panels A to C help demonstrate shift of peptides 1 and 2 relative to i, ii, and iii.

All four pAP* patterns contain a group of at least three phosphopeptides (labeled i, ii, and iii in Fig. 6) that are not present in corresponding patterns of AP or pAP (data not shown) and were unaffected by the CKII mutations (i.e., essentially the same in Fig. 6A to D). These spots distinguish pAP* from pAP and are interpreted as corresponding to the peptides that contain at least one of the secondary phosphorylation sites.

Secondary sites of phosphorylation are the same in transfected and infected cells. AP in B-capsids isolated from infected cells also migrates as three bands when resolved by SDS-PAGE (17, 21). Phosphopeptide comparisons of AP from B-capsids and pAP from transfected cells showed that their patterns were essentially the same, with spots 1 and 2 being predominant (Fig. 2C and data not shown).

To compare the secondary phosphorylation sites of B-capsid AP* with those of transfected-cell pAP*, tryptic digests of each were prepared and subjected to 2-D separation. The resulting phosphopeptide pattern for B-capsid AP* (Fig. 7A) looked like that of transfected-cell pAP* (Fig. 7B), and a mixture of the two showed that they were essentially the same (Fig. 7C). The set of spots to the left of i, ii, and iii were from the AP** band (Fig. 7G to I), which was difficult to completely exclude from the AP* sample. Thus, the same CKII sites (spots 1 and 2) and secondary sites (spots i, ii, and iii) are phosphorylated in AP* and pAP*, whether from B-capsids or transfected cells.


View larger version (69K):
[in this window]
[in a new window]
 
FIG. 7.   Comparisons of secondary-site phosphopeptides from pAP and AP isoforms. 32P-labeled pAP isoforms immunoprecipitated from transfected HEK cells, and 32P-labeled AP isoforms from B-capsids, were separated by SDS-PAGE, and the two slower-moving isoforms from each were subjected to digestion with trypsin, followed by 2-D separations of the resulting peptides and fluorographic detection of the phosphopeptides. Shown are the patterns obtained for capsid AP* (A), transfection pAP* (B), and a mixture of the two (C); capsid AP** (D), transfection pAP** (E), and a mixture of the two (F); and capsid AP* (G), capsid AP** (H), and a mixture of the two (I). Some variation was observed between separations. The position of the origin (Ori), for each plate is indicated, electrophoresis was from left to right, and chromatography was from bottom to top. Phosphopeptide designations are described in the text.

In the same way, the corresponding AP** and pAP** bands from B-capsids and transfected cells were compared. Like those of AP* and pAP*, the phosphopeptide patterns of B-capsid AP** (Fig. 7D) and transfected-cell pAP** (Fig. 7E) were indistinguishable when separated as a mixture (Fig. 7F). The upper set of peptides was reproducibly closer to the anode (left), relative to spot 2, than spots i, ii, and iii in the pAP* and AP* patterns (Fig. 7A to C) and were therefore labeled alpha , beta , and gamma .

Confirmation that spots alpha , beta , and gamma  differed from i, ii, and iii, and that CKII-site peptides 1 and 2 are the same in pAP** and AP** as in pAP* and AP*, was obtained by subjecting a mixture of B-capsid AP* and AP** to 2-D peptide analysis. The AP* CKII-site peptides, 1 and 2 (Fig. 7G; also compare Fig. 6A and 6D), coseparated with peptides 1 and 2 of AP** (Fig. 7H) when mixed (Fig. 7I), but AP* spots i, ii, and iii (Fig. 7G) were not coincident with AP** spots alpha , beta , and gamma , respectively (Fig. 7I). Thus, B-capsid AP, AP*, and AP** all contain the CKII-site peptides 1 and 2, and AP* and AP** are distinguished from AP and from each other by secondary-site phosphorylations represented by peptide sets i, ii, iii and alpha , beta , gamma , respectively. The similarity in the electrophoretic and chromatographic migrations of peptides i, ii, and iii (Fig. 7G) and alpha , beta , and gamma  (Fig. 7H) suggests that the two sets of peptides are related, with alpha , beta , and gamma  being more acidic, as indicated by their relative displacement toward the anode (e.g., Fig. 7I).

Maturational proteinase is also phosphorylated at CKII-site serines. Considering that the entire pAP sequence is contained as the carboxyl half of the proteinase precursor, pNP1 (Fig. 8B), due to the 3'-coterminal, nested arrangement of their genes (46), we tested whether the corresponding CKII-site serines in pNP1 are also phosphorylated. This was done by 32P-labeling proteins in transfected cells, immunoprecipitating them, subjecting the immunoprecipitates to SDS-PAGE, and visualizing the bands by autoradiography. As observed before (Fig. 3A, left lane) and included here for reference, pAP resolved into three bands (pAP, pAP*, and pAP** [Fig. 8A, lane 1]), only the slower-migrating two being radiolabeled in the CKII-site mutant, pAP/S156A,S157A (Fig. 8A, lane 2).


View larger version (41K):
[in this window]
[in a new window]
 
FIG. 8.   Maturational proteinase, pNP1, is phosphorylated at its CKII-site serines. (A) 32P-labeled wild-type (lanes 3 and 4) or inactive (lanes 5 and 6) precursor proteinase bearing either S156 and S157 (lanes 3 and 5) or their alanine substitutions (lanes 4 and 6) were immunoprecipitated (anti-C1 for lanes 1, 2, 5, and 6; anti-N1 for lanes 3 and 4) from transfected HEK cells and separated by SDS-PAGE. Shown here is an autoradiographic image prepared from the resulting gel. Wild-type pAP (lane 1) and CKII-site mutant pAP/S156A,S157A (lane 2) were processed in parallel with the proteinase samples as controls. The asterisk denotes a faint band of NP1 in lane 3. The presence (+) or absence (-) of CKII-site serines 156 and 157 is indicated beneath each lane. Bars to the left of lanes 1, 3, and 5 indicate positions of the primary and two slower-migrating isoforms of pAP, NP1c, and pNP1, respectively. (B) Schematic showing the primary translation products, pNP1 (proteinase precursor) and pAP (assembly protein precursor), and their corresponding cleavage products: pNP1right-arrowNP1right-arrowNP1c + NP1n (assemblin); pAPright-arrowAP + Tail. M and R, maturational and release cleavage sites; ×, the inactivated serine nucleophile in mutant S118A; SS, CKII-site serines, 156 and 157; N1 (rectangle) and C1 (oval), locations of amino acid sequences used to prepare the anti-N1 and anti-C1 antipeptide antisera; filled circles, positions of NLS1 and NLS2.

Correspondingly, a proteolytically inactive mutant of the proteinase precursor, nucleophile mutant S118A (45), resolved into three closely spaced phosphorylated bands (Fig. 8A, lane 5), the fastest-migrating one corresponding to the noncleaved precursor, pNP1 (Fig. 8A, lane 5; Fig. 8B). When the S118A CKII-site serines were mutated (i.e., mutant S118A/CKII-), only the two slower-migrating bands (pNP1* and pNP1**) were phosphorylated, and their level of radiolabeling was reduced compared with S118A* and S118A** (Fig. 8A; compare lanes 5 and 6). These data indicate that phosphorylation of S118A is also restricted to the CKII site and that the two slower-migrating isoforms, S118A* and S118A**, are phosphorylated at additional secondary sites.

Wild-type proteinase was similarly tested. Little of the precursor, pNP1, remained uncleaved (Fig. 8A, lane 3), but three radiolabeled bands were present in the 45-kDa size range of NP1c, the carboxyl fragment that is produced by M- and R-site cleavage of pNP1 and that contains the entire AP sequence (Fig. 8B). Overall phosphorylation was reduced and limited primarily to the upper two of these bands in the CKII-site mutant, pNP1/CKII-, (Fig. 8A, lane 4). The trace amount of radioactivity detected at the position of NP1c in the CKII-site mutant is suspected to be due to a comigrating breakdown/background band, but this remains unproven. Thus, phosphorylation of the NP1c band is largely, if not exclusively, restricted to serines 156 and 157 and phosphorylation of the two slower-migrating bands, NP1c* and NP1c**, includes secondary sites.

We interpret these data as indicating that the proteinase precursor is phosphorylated at the same CKII and secondary sites as pAP (Fig. 8B). The absence of obvious differences between the 2-D phosphopeptide patterns of pAP*, NP1c*, and pNP1* (S118A) supports this interpretation (one experiment; data not shown).

Phosphorylation of the CKII serines is not required for enzymatic activity of pNP1 or for substrate suitability of pAP. The observed M- and R-site cleavage of CKII-site mutant, pNP1/CKII- (e.g., presence of NP1c* and NP1c** [Fig. 8A, lane 4]), demonstrated that CKII-site phosphorylation is not essential for the autoproteolytic activity of the enzyme. To test the possibility that this modification may have a more subtle effect on proteolytic activity, or on pAP as a substrate, we used Western immunoassays to reveal these reactions in more detail. Wild-type proteinase or its CKII mutant, pNP1/CKII-, was expressed alone or in combination with the corresponding wild-type or CKII-mutant form of pAP. Lysates of the transfected cells were subjected to SDS-PAGE followed by Western immunoassay using the anti-N1 antiserum (39), an antipeptide antiserum that recognizes all but two of the major pNP1 and pAP cleavage products (i.e., NP1n and Tail [Fig. 8B]).

No evidence was found that CKII-site phosphorylation affects any of the cleavages monitored: (i) the NP1 and NP1c products of M- and R-site cleavage of pNP1 were essentially the same for the wild-type proteinase (Fig. 9, lane 3) and its CKII-site mutant (Fig. 9, lane 4); (ii) wild-type substrate, pAP (Fig. 9, lane 7), was cleaved equally well to AP by the wild-type proteinase (Fig. 9, lane 5) and its CKII-site mutant (Fig. 9, lane 6); and (iii) the CKII-site mutant pAP (Fig. 9, lane 8) was also cleaved equally well to AP by the wild-type proteinase (Fig. 9, lane 9) and its CKII-site mutant (Fig. 9, lane 10). Cytoplasmic and nuclear fractions of virus-infected human fibroblasts (Fig. 9, lanes 1 and 2, respectively), included for comparison, show the coincidence of the respective NP1c, pAP, AP, AP*, and AP** bands in virus-infected versus plasmid-transfected cells, and also show that transfected cells contain more of the pAP* and pAP** isoforms, relative to pAP, than virus-infected cells (14).


View larger version (103K):
[in this window]
[in a new window]
 
FIG. 9.   Neither proteolytic activity nor substrate suitability is noticeably altered by CKII-site phosphorylation. Wild-type (wt; lanes 3, 5, and 9) and CKII-mutant (lanes 4, 6, and 10) proteinases were tested for self-cleavage (lanes 3 and 4) and processing of wild-type (lanes 5 and 6) and CKII-mutant substrate (lanes 9 and 10) by transfection assays. Cleavages were monitored by Western immunoassays with anti-N1 (Fig. 8B) and [125I]protein A as described in Materials and Methods. Shown is an autoradiographic image of the resulting blot. Bands of interest are indicated by abbreviations at the right; proteins expressed are specified at the bottom. Presence (+) or absence (-) of the CKII-site serines 156 and 157 in the proteinase tested (or pAP alone in lanes 7 and 8) is indicated below lanes 3 to 10. Wild-type pAP was coexpressed with the proteinase constructs in lanes 5 and 6; pAP lacking CKII serines 156 and 157 was coexpressed with the proteinase constructs in lanes 9 and 10. Asterisks indicate positions of AP, pAP, and NP1c isoforms. Cytoplasmic (C) and nuclear (N) fractions of virus-infected (Inf.) cells (lanes 1 and 2) are shown for reference. Dots to the left of lane 1 indicate bands coincident with NP1c, pAP, AP**, AP*, and AP (top to bottom).

Nuclear localization is not required for pNP1 phosphorylation. The proximity of the CKII motif to two flanking NLSs (Fig. 8B, NLS1 and NLS2; reference 29), suggested that nuclear transport and phosphorylation of these proteins might be interrelated. To test whether nuclear translocation was required for pNP1 phosphorylation, we compared the level of phosphorylation of NLS+ S118A (i.e., S118A; approx 64 kDa), which localizes to the nucleus, with that of NLS- S118A (i.e., S118A/NLS1,2-), which is restricted to the cytoplasm (29). This was done by expressing and 32P-labeling the proteins in transfected cells, lysing the cells and recovering the proteins by immunoprecipitation, and analyzing the immunoprecipitates by SDS-PAGE and autoradiography.

It can be seen that phosphorylation of the cytoplasmic NLS- mutant, S118A/NLS1,2- (Fig. 10, lane 4), was comparable to, if not greater than, that of NLS+ S118A (Fig. 10, lane 1) and two other NLS mutants of S118A (Fig. 10, lanes 2 and 3), all three of which accumulate predominantly in the nucleus (29). One notable difference, not well demonstrated here but reproduced in complementing Western immunoassays (16), is that the amounts of the electrophoretically slower-migrating isoforms, S118A* and S118A**, relative to that of the S118A band, are markedly reduced in the NLS- mutant (Fig. 10, lane 4).


View larger version (59K):
[in this window]
[in a new window]
 
FIG. 10.   Evidence for cytoplasmic CKII-site phosphorylation of NLS- pNP1. 32P-labeled, inactive precursor proteinase (S118A mutant) bearing either intact (NLS+; lane 1) or mutated (NLS-; lanes 2 to 4) NLS (29) were immunoprecipitated with anti-C1 (Fig. 8B) from transfected cells and separated by SDS-PAGE. Shown is an autoradiographic image of the resulting gel. 32P-labeled pAP (lane 5) and mock-transfected cell (lane 6) samples were processed in parallel as controls for expression and immunoprecipitation specificity, respectively.

These data indicate that the S118A/NLS- proteinase undergoes CKII-site phosphorylation in the cytoplasm and provide initial evidence that secondary-site phosphorylation may be a nuclear event. Similar results (data not shown) were found for pAP and NLS-deficient pAP (i.e., pAP/NLS1,2-), but their interpretation was complicated by the ability of pAP/NLS1,2- to diffuse into the nucleus due to its small size (i.e., 34 kDa) (29). We also found that mutants of the proteinase (i.e., S118A) or pAP that lack CKII serines 156 and 157 (i.e., S118A/S156A,S157A and pAP/S156A,S157A, respectively) still localize to the nucleus and promote nuclear translocation of MCP (immunofluorescence data not shown), demonstrating that CKII-site phosphorylation is not essential for these functions.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Phosphorylation is a distinguishing feature of the CMV capsid assembly protein (9, 16, 21, 35) and its homologs in other herpesviruses (1a, 6, 13) that may be of functional importance. As a first step in developing assays to study this modification, and to identify the protein kinase responsible for it, we have determined the primary sites of pAP phosphorylation. Two adjacent serines in a CKII consensus sequence were identified as the only residues phosphorylated in the predominant pAP isoform. Two less abundant isoforms were found to contain one or more secondary sites whose phosphorylation correlated with electrophoretic mobility shifts. Phosphorylated counterparts were identified for the proteinase precursor, pNP1, and its carboxyl cleavage product, NP1c, both of which contain the entire AP amino acid sequence (Fig. 8B and reference 46). Mutation of the CKII-site serines had no detected effect on the proteolytic activity of pNP1 or on the substrate behavior of pAP. Initial evidence that CKII- and secondary-site phosphorylations may happen in different compartments of the cell raises the possibility that they result from different enzymes. The justification and implications of these conclusions are discussed below.

CKII-site phosphorylation. Our main objective was to determine whether phosphorylation of pAP is limited to a small number of sites and, if so, to identify them. Our primary finding is that the only residues phosphorylated in the most abundant pAP isoform are two adjacent serines (Ser 156 and 157) in a CKII consensus sequence. Although the most compelling evidence for this conclusion came from transfection experiments showing that pAP phosphorylation was eliminated in a mutant lacking these residues (i.e., S156,S157- [Fig. 3A]), it was demonstrated by mass spectrometry (e.g., Fig. 1C) and 2-D phosphopeptide comparisons (Fig. 2 and 7) that the same CKII-site serines are also the primary phosphate acceptors on AP from infected cells.

It was apparent from mass spectrometry that phosphorylation of infected-cell AP at the CKII site is heterogeneous (e.g., Fig. 1C). However, the relative amounts of non-, mono-, and diphosphorylated AP present in CMV B-capsids could not be quantified accurately by this method due to potential differences in the ionization properties of the CKII peptide in its various phosphorylation states (22, 49). Such estimates were possible from CKII-site mutants of pAP expressed in transfected cells and indicated that Ser 157 is phosphorylated more frequently than Ser 156 (Fig. 3A). Conservation of these serines, strongest among the betaherpesvirus pAP homologs, in the context of a relatively acidic domain present in most pAP homologs (Table 1), suggests that their phosphorylation may reflect a betaherpesvirus group-specific requirement. We note without discussion that CKII-site phosphorylation of the betaherpesvirus pAP homologs increases the content of acidic residues between the highly conserved NLS1 and PGE sequences, on average, from 34% to 45% (Table 1)---a substantial change in electronegativity.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Acidic regions, including NLS1 and PGE motifs, in homologs of CMV pAPa

Secondary-site phosphorylation. A small amount of pAP is phosphorylated at additional sites, correlating with the formation of isoforms pAP* and pAP** (previously called 38- and 39-kDa proteins [17]), which have reduced electrophoretic mobilities. Although pAP* and pAP** are phosphorylated at their CKII serines (Fig. 6 and 7), this modification is not required either for secondary-site phosphorylation or for the mobility shift, as shown by pAP* and pAP** phosphorylation in the CKII-site mutant, pAP/S156A,S157A (Fig. 3A and 6D). Corresponding isoforms of the proteinase (i.e., pNP1* and pNP1**, and its cleavage products, NP1c* and NP1c**) were identified, indicating that it shares the same secondary-site modifications (Fig. 8, lanes 3 to 6).

Earlier work had localized the mobility-shifting sequence to the carboxyl half of AP, between Trp 139 (N-chlorosuccinimide cleavage site) and Ala 277 (C terminus of cleaved pAP) (39). Evidence presented here that pAP* and pAP** lose 32P and are converted to the pAP isoform by alkaline phosphatase treatment (Fig. 4 and 5) indicates that the mobility shifts are due to secondary-site phosphorylations. On the basis of phosphopeptide comparisons, it was concluded that these secondary-site phosphorylations are contained in a set of phosphopeptides that distinguish pAP* and pAP** from pAP (Fig. 6 and 7). Because the secondary-site phosphopeptides were unaffected by mutations that alter the behavior of CKII-site phosphopeptides 1 and 2 (Fig. 6), it was also concluded that the secondary site and CKII site are in different parts of the protein. Furthermore, the presence of multiple secondary-site phosphopeptides (e.g., i, ii, and iii in Fig. 6) indicates either that there are multiple secondary sites or that, like the CKII site (Fig. 1), the secondary site is located within a sequence that gives rise to a mixture of partial and limit cleavage products.

Although our data do not enable us to discriminate between several explanations for the origins of pAP* and pAP**, our working hypothesis is that pAP is converted to pAP* by the phosphorylation of one secondary-site residue contained within a sequence that gives rise to phosphopeptides i, ii, and iii. Phosphorylation of another secondary-site amino acid within the same sequence converts pAP* to pAP** and, correspondingly, phosphopeptides i, ii, and iii to alpha , beta , and gamma . If conversion of pAPright-arrowpAP*right-arrowpAP** is sequential, as suggested, pAP* is expected to be more acidic than pAP by one phosphate charge, and pAP** would be one phosphate more acidic than pAP*. Consistent with this prediction, charge/size separations of B-capsid proteins indicate that the pAP* and pAP** charge isomers are one and two increments, respectively, more acidic than those of pAP (10a).

A notable difference between AP expressed in transfected versus CMV-infected cells is that more of the secondary-site phosphorylated isoforms accumulate in transfected cells (Fig. 9; reference 14). This could be accounted for in several ways, including (i) removal of pAP from the substrate pool in CMV-infected cells by internalization into capsids; (ii) selective incorporation of the secondary-site phosphorylated isoforms into viable capsids, followed by their degradation or dephosphorylation during capsid maturation; (iii) depletion of the kinase responsible for secondary-site phosphorylation in CMV-infected cells; or (iv) selective dephosphorylation of the secondary site by a CMV-encoded phosphatase in virus-infected cells.

Enzyme(s) involved. It is likely that CKII or a CKII-like activity is responsible for phosphorylating the most abundant of the three pAP and AP isoforms. Phosphorylation of this predominant species is limited to serines 156 and 157 within a CKII consensus sequence, and site-directed mutagenesis of acidic residues +3 of the target serines reduced phosphorylation at these sites, as predicted for CKII (28, 37). Also consistent with these primary phosphorylations being made by CKII, normal (if not enhanced) phosphorylation was observed for a proteinase mutant (S118A/NLS-) that has no NLS and is consequently confined to the cytoplasm (Fig. 10)---the generally accepted location of CKII during cell cycle interphase (50). There are other examples of herpesvirus proteins phosphorylated by CKII or CKII-like activities (4, 18, 20, 24-27), and at least some of these modifications are known to be functionally important (5, 27).

A different activity may phosphorylate the secondary sites of pAP* and pAP**. By inference from the characteristics of secondary-site phosphorylation, this activity differs in at least three ways from the CKII-site activity. First, it phosphorylates a non-CKII-consensus sequence, since the CKII site is the only CKII consensus sequence in pAP, and the secondary site is not within it, based on the uncoupled behavior of phosphopeptides 1 and 2 (CKII site) and i, ii, and iii (secondary site) in the three CKII-site mutants (Fig. 6). Second, the addition (14) and removal (Fig. 4 and 5) of phosphate from the secondary sites is slower than from the CKII site, compatible with differences in the sites, the enzyme, the moiety added, or all three. And third, CKII-site phosphorylation occurs in the cytoplasm, whereas secondary-site phosphorylation appears to require nuclear translocation (Fig. 10; reference 28a).

The similar patterns of phosphopeptides observed for AP in transfected and CMV-infected cells (Fig. 7) indicate that cellular kinases can make both CKII- and secondary-site phosphorylations but does not rule out the possibility that a virus-encoded enzyme(s) makes these modifications during infection. Such functional mimicry has precedent in the thymidine kinase enzyme of HSV that is redundant with cellular thymidine kinase in cell culture infections but has, nevertheless, proven one of the most effective antiherpesvirus targets to date (44).

Function of AP phosphorylation? Our evidence that the CKII-site phosphorylations occur in the cytoplasm is compatible with their involvement in one or more of the earliest steps in the capsid assembly pathway, such as interaction of pAP with itself, pNP1 or MCP, or nuclear translocation of these complexes. Conversely, it could be dephosphorylation of these residues later in the assembly process that is important. We found no evidence for influences of CKII-site phosphorylation on the properties of these proteins that were tested, including proteolytic activity of pNP1 (Fig. 9), substrate effects on pNP1 or pAP (Fig. 9), interactions of pAP with itself and with MCP (1), and self-localization or MCP translocation to the nucleus (29, 48) by pNP1 (i.e., S118A/S156,S157-) or pAP (immunofluorescence data not shown). Our inability to demonstrate such differences, however, does not rule out the possibility of more subtle effects on these interactions (e.g., kinetic; conformational) that may have escaped detection by the assays used but, nevertheless, have important consequences in the context of other viral proteins and processes in CMV-infected cells.

Secondary-site phosphorylations, unlike CKII-site phosphorylations, correlate with mobility changes in pAP. This correlation indicates that these modifications have a more pronounced effect on the protein than CKII-site phosphorylation. Whether this effect is relevant to changes in protein-protein interactions associated with capsid formation or DNA packaging, or some other function, remains to be determined. However, the fact that pAP homologs in other herpesviruses, notably HSV pVP22a, have apparent counterpart phosphorylated isoforms (1a) indicates that this modification has been conserved and increases interest in the possibility that it may be of functional importance.


    ACKNOWLEDGMENTS

We thank M. Baxter for testing CKII-site mutants for interactions in the GAL4 two-hybrid assay, J. Bailey for constructing SP23 (pAP/S156A,E160A) and AP24 (pAP/E159A,E160A) and doing transfection/immunofluorescence studies with pAP/S156A,S157A, and C. Farrell for data from his pharmacology research rotation project on charge/size separations of B-capsid proteins. We also acknowledge the excellent technical assistance of Jenny Borchelt and Kendra Plafker in constructing SP23 (pAP/S156A,E160A) and AP24 (pAP/E159A,E160A).

S.M.P. was a student in the Pharmacology and Molecular Sciences training program and was supported by USPHS grant GM07626. This work was aided by USPHS research grants GM54882 to R.J.C. and AI13718 and AI32957 to W.G.


    FOOTNOTES

* Corresponding author. Mailing address: Virology Laboratories, Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, 725 N. Wolfe St., Baltimore, MD 21205. Phone: (410) 955-8680. Fax: (410) 955-3023. E-mail: wgibson{at}bs.jhmi.edu.

dagger Present address: Center for Cell Signaling, University of Virginia Health Sciences Center, Charlottesville, Va.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Baxter, M. GAL4 two-hybrid data not presented.
1a. Braun, D., B. Roizman, and L. Pereira. 1984. Characterization of posttranslational products of herpes simplex virus gene 35 proteins binding to the surfaces of full capsids but not empty capsids. J. Virol. 49:142-153[Abstract/Free Full Text].
1b. Brignole, E., and W. Gibson. Unpublished data.
2. Chen, C., and H. Okayama. 1987. High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7:2745-2752[Abstract/Free Full Text].
3. Desai, P., S. C. Watkins, and S. Person. 1994. The size and symmetry of B capsids of herpes simplex virus type 1 are determined by the gene products of the UL26 open reading frame. J. Virol. 68:5365-5374[Abstract/Free Full Text].
4. Elliot, G., D. O'Reilly, and P. O'Hare. 1996. Phosphorylation of the herpes simplex virus type 1 tegument protein VP22. Virology 226:140-145[Medline].
5. Fish, K. N., C. Soderberg-Naucler, and J. A. Nelson. 1998. Steady-state plasma membrane expression of human cytomegalovirus gB is determined by the phosphorylation state of Ser900. J. Virol. 72:6657-6664[Abstract/Free Full Text].
6. Friedrichs, W. E., and C. Grose. 1986. Varicella-zoster virus p32/p36 complex is present in both the viral capsid and the nuclear matrix of the infected cell. J. Virol. 57:155-164[Abstract/Free Full Text].
7. Gao, M., L. Matusick-Kuman, W. Hurlburt, S. F. DiTusa, W. W. Newcomb, J. C. Brown, P. J. McCann, I. Deckman, and R. J. Colonno. 1994. The protease of herpes simplex virus type 1 is essential for functional capsid formation and viral growth. J. Virol. 68:3702-3712[Abstract/Free Full Text].
8. Gibson, W. 1981. Structural and non structural proteins of strain Colburn cytomegalovirus. Virology 111:516-537[Medline].
9. Gibson, W. 1983. Protein counterparts of human and simian cytomegaloviruses. Virology 128:391-406[Medline].
10. Gibson, W. 1996. Structure and assembly of the virion. Intervirology 39:389-400[Medline].
10a. Gibson, W., and C. Farrell. Unpublished data from Western immunoassay.
11. Gibson, W., and M. R. T. Hall. 1997. Assemblin, an essential herpesvirus proteinase. Drug Des. Discov. 15:39-47[Medline].
12. Gibson, W., A. I. Marcy, J. C. Comolli, and J. Lee. 1990. Identification of precursor to cytomegalovirus capsid assembly protein and evidence that processing results in loss of its carboxy-terminal end. J. Virol. 64:1241-1249[Abstract/Free Full Text].
13. Gibson, W., and B. Roizman. 1974. Proteins specified by herpes simplex virus. X. Staining and radiolabeling properties of B capsid and virion proteins in polyacrylamide gels. J. Virol. 13:155-165[Abstract/Free Full Text].
14. Gibson, W., A. R. Welch, and J. Ludford. 1994. Transient transfection assay of the herpesvirus maturational proteinase, assemblin. Methods Enzymol. 244:399-411[Medline].
15. Holwerda, B. C. 1997. Herpesvirus proteases: targets for novel antiviral drugs. Antiviral Res. 35:1-21[Medline].
16. Irmiere, A., and W. Gibson. 1983. Isolation and characterization of a noninfectious virion-like particle released from cells infected with human strains of cytomegalovirus. Virology 130:118-133[Medline].
17. Irmiere, A., and W. Gibson. 1985. Isolation of human cytomegalovirus intranuclear capsids, characterization of their protein constituents, and demonstration that the B-capsid assembly protein is also abundant in noninfectious enveloped particles. J. Virol. 56:277-283[Abstract/Free Full Text].
18. Jakubowicz, T., and D. P. Leader. 1987. A major phosphoprotein of cells infected with pseudorabies virus is phosphorylated by cellular casein kinase II. J. Gen. Virol. 68:1159-1163[Abstract/Free Full Text].
19. Kennelly, P. J., and E. G. Krebs. 1991. Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases. J. Biol. Chem. 266:15555-15558[Free Full Text].
20. Kolman, J. L., N. Taylor, D. R. Marshak, and G. Miller. 1993. Serine-173 of the Epstein-Barr virus ZEBRA protein is required for DNA binding and is a target for casein kinase II phosphorylation. Proc. Natl. Acad. Sci. USA 90:10115-10119[Abstract/Free Full Text].
21. Lee, J. Y., A. Irmiere, and W. Gibson. 1988. Primate cytomegalovirus assembly: evidence that DNA packaging occurs subsequent to B capsid assembly. Virology 167:87-96[Medline].
22. Liao, P. C., and J. Allison. 1994. An approach to locate phosphorylation sites in a phosphoprotein: mass mapping by combining specific enzymatic degradation with matrix-assisted laser desorption/ionization mass spectrometry. Anal. Biochem. 19:9-20.
23. Liu, F., and B. Roizman. 1991. The herpes simplex virus 1 gene encoding a protease also contains within its coding domain the gene encoding the more abundant substrate. J. Virol. 65:5149-5156[Abstract/Free Full Text].
24. Mitchell, C., J. A. Blaho, A. L. McCormick, and B. Roizman. 1997. The nucleotidylation of herpes simplex virus I regulatory protein alpha 22 by human casein kinase II. J. Biol. Chem. 272:25394-25400[Abstract/Free Full Text].
25. Mitchell, C., J. A. Blaho, and B. Roizman. 1994. Casein kinase II specifically nucleotidylates in vitro the amino acid sequence of the protein encoded by the alpha 22 gene of herpes simplex virus 1. Proc. Natl. Acad. Sci. USA 91:11864-11868[Abstract/Free Full Text].
26. Norais, N., J. A. Hall, L. Gross, D. Tang, S. Kaur, S. H. Chamberlain, R. L. Burke, and F. Marcus. 1996. Evidence for phosphorylation site in cytomegalovirus glycoprotein gB. J. Virol. 70:5716-5719[Abstract/Free Full Text].
27. O'Reilly, D., O. Hanscombe, and P. O'Hare. 1997. A single serine residue at position 375 of VP16 is critical for complex assembly with Oct-1 and HCF and is a target of phosphorylation by casein kinase II. EMBO J. 16:2420-2430[Medline].
28. Pinna, L. A. 1990. Casein kinase 2: an `eminence grise' in cellular regulation? Biochim. Biophys. Acta 1054:267-284[Medline].
28a. Plafker, S., E. Brignole, and W. Gibson. Unpublished data.
29. Plafker, S. M., and W. Gibson. 1998. Cytomegalovirus assembly protein precursor and proteinase precursor contain two nuclear localization signals that mediate their own nuclear translocation and that of the major capsid protein. J. Virol. 72:7722-7732[Abstract/Free Full Text].
29a. Plafker, S., and W. Gibson. Unpublished data.
30. Preston, V. G., J. A. Coates, and F. J. Rixon. 1983. Identification and characterization of a herpes simplex virus gene product required for encapsidation of virus DNA. J. Virol. 45:1056-1064[Abstract/Free Full Text].
31. Preston, V. G., F. J. Rixon, I. M. McDougall, M. McGregor, and M. F. Al Kobaisi. 1992. Processing of the herpes simplex virus assembly protein ICP35 near its carboxy terminal end requires the product of the whole of the UL26 reading frame. Virology 186:87-98[Medline].
32. Rixon, F. J. 1993. Structure and assembly of herpesviruses. Semin. Virol. 4:135-144.
33. Rixon, F. J., C. Addison, A. McGregor, S. L. Macnab, P. Nicholson, V. G. Preston, and J. D. Tatman. 1996. Multiple interactions control the intracellular localization of the herpes simplex virus type 1 capsid proteins. J. Gen. Virol. 77:2251-2260[Abstract/Free Full Text].
34. Rixon, F. J., A. M. Cross, C. Addison, and V. G. Preston. 1988. The products of the herpes simplex virus type I gene UL26 which are involved in DNA packaging are strongly associated with empty but not with full capsids. J. Gen. Virol. 69:2879-2891[Abstract/Free Full Text].
35. Roby, C., and W. Gibson. 1986. Characterization of phosphoproteins and protein kinase activity of virions, noninfectious enveloped particles, and dense bodies of human cytomegalovirus. J. Virol. 59:714-727[Abstract/Free Full Text].
36. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
37. Sarno, S., P. Vaglio, O. Marin, O.-G. Issinger, K. Ruffato, and L. A. Pinna. 1997. Mutational analysis of residues implicated in the interaction between protein kinase CK2 and peptide substrates. Biochemistry 36:11717-11724[Medline].
38. Scheidtmann, K.-H., E. Birgit, and W. Gernot. 1982. Simian virus 40 large T antigen is phosphorylated at multiple sites clustered in two separate regions. J. Virol. 44:116-133[Abstract/Free Full Text].
39. Schenk, P., A. S. Woods, and W. Gibson. 1991. The 45-kDa protein of cytomegalovirus (Colburn) B-capsids is an amino-terminal extension form of the assembly protein. J. Virol. 65:1525-1529[Abstract/Free Full Text].
40. Shenolikar, S., and T. S. Ingebritsen. 1984. Protein (serine and threonine) phosphate phosphatases. Methods Enzymol. 107:102-109[Medline].
41. Steven, A. C., and P. G. Spear. 1997. Herpesvirus capsid assembly and envelopment, p. 312-351. In R. Burnett, W. Chiu, and R. Garcea (ed.), Structural biology of viruses. Oxford University Press, New York, N.Y.
42. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354[Abstract/Free Full Text].
43. van der Geer, P., K. Luo, B. Sefton, and T. Hunter. 1993. Phosphopeptide mapping and phosphoamino acid analysis on cellulose thin-layer plates, p. 31-58. In D. G. Hardie (ed.), Protein phosphorylation: a practical approach. Oxford University Press, Oxford, England.
44. Watkins, A. M., P. J. Dunford, A. M. Moffatt, P. Wong-Kai-In, M. J. Holland, D. S. Pole, G. M. Thomas, J. Martin, N. A. Roberts, and M. J. Mulqueen. 1998. Inhibition of virus-encoded thymidine kinase suppresses herpes simplex virus replication in vitro and in vivo. Antiviral Chem. Chemother. 9:9-18. [Medline]
45. Welch, A. R., L. M. McNally, M. R. T. Hall, and W. Gibson. 1993. Herpesvirus proteinase: site-directed mutagenesis used to study maturational, release, and inactivation cleavage sites of precursor and to identify a possible catalytic site serine and histidine. J. Virol. 67:7360-7372[Abstract/Free Full Text].
46. Welch, A. R., L. M. McNally, and W. Gibson. 1991. Cytomegalovirus assembly protein nested gene family: four 3'-coterminal transcripts encode four in-frame, overlapping proteins. J. Virol. 65:4091-4100[Abstract/Free Full Text].
47. Welch, A. R., A. S. Woods, L. M. McNally, R. J. Cotter, and W. Gibson. 1991. A herpesvirus maturational protease, assemblin: identification of its gene, putative active site domain, and cleavage site. Proc. Natl. Acad. Sci. USA 88:10792-10796[Abstract/Free Full Text].
48. Wood, L. J., M. K. Baxter, S. M. Plafker, and W. Gibson. 1997. Human cytomegalovirus capsid assembly protein precursor (pUL80.5) interacts with itself and with the major capsid protein (pUL86) through two different domains. J. Virol. 71:179-190[Abstract].
49. Woods, A. S., W. Gibson, and R. J. Cotter. 1994. Protein processing in herpes viruses, p. 190-210. In R. J. Cotter (ed.), Time-of-flight mass spectrometry. American Chemical Society, Washington, D.C.
50. Yu, I. J., D. L. Spector, Y. S. Bae, and D. R. Marshak. 1991. Immunocytochemical localization of casein kinase II during interphase and mitosis. J. Cell Biol. 114:1217-1232[Abstract/Free Full Text].


Journal of Virology, November 1999, p. 9053-9062, Vol. 73, No. 11
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Loveland, A. N., Nguyen, N. L., Brignole, E. J., Gibson, W. (2007). The Amino-Conserved Domain of Human Cytomegalovirus UL80a Proteins Is Required for Key Interactions during Early Stages of Capsid Formation and Virus Production. J. Virol. 81: 620-628 [Abstract] [Full Text]  
  • McCartney, S. A., Brignole, E. J., Kolegraff, K. N., Loveland, A. N., Ussin, L. M., Gibson, W. (2005). Chemical Rescue of I-site Cleavage in Living Cells and in Vitro Discriminates between the Cytomegalovirus Protease, Assemblin, and Its Precursor, pUL80a. J. Biol. Chem. 280: 33206-33212 [Abstract] [Full Text]  
  • Casaday, R. J., Bailey, J. R., Kalb, S. R., Brignole, E. J., Loveland, A. N., Cotter, R. J., Gibson, W. (2004). Assembly Protein Precursor (pUL80.5 Homolog) of Simian Cytomegalovirus Is Phosphorylated at a Glycogen Synthase Kinase 3 Site and Its Downstream "Priming" Site: Phosphorylation Affects Interactions of Protein with Itself and with Major Capsid Protein. J. Virol. 78: 13501-13511 [Abstract] [Full Text]  
  • MEGGIO, F., PINNA, L. A. (2003). One-thousand-and-one substrates of protein kinase CK2?. FASEB J. 17: 349-368 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plafker, S. M.
Right arrow Articles by Gibson, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plafker, S. M.
Right arrow Articles by Gibson, W.