Previous Article | Next Article 
Journal of Virology, November 1999, p. 9053-9062, Vol. 73, No. 11
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Phosphorylation of Simian Cytomegalovirus Assembly
Protein Precursor (pAPNG.5) and Proteinase Precursor (pAPNG1): Multiple
Attachment Sites Identified, Including Two Adjacent Serines in a Casein
Kinase II Consensus Sequence
Scott M.
Plafker,1,
Amina S.
Woods,2 and
Wade
Gibson1,*
Virology Laboratories1
and Mid-Atlantic Mass Spectrometry
Center,2 Department of Pharmacology and
Molecular Sciences, Johns Hopkins University School of Medicine,
Baltimore, Maryland 21205
Received 13 May 1999/Accepted 30 July 1999
 |
ABSTRACT |
The assembly protein precursor (pAP) of cytomegalovirus (CMV), and
its homologs in other herpesviruses, functions at several key steps
during the process of capsid formation. This protein, and the
genetically related maturational proteinase, is distinguished from the
other capsid proteins by posttranslational modifications, including
phosphorylation. The objective of this study was to identify sites at
which pAP is phosphorylated so that the functional significance of this
modification and the enzyme(s) responsible for it can be determined. In
the work reported here, we used peptide mapping, mass spectrometry, and
site-directed mutagenesis to identify two sets of pAP phosphorylation
sites. One is a casein kinase II (CKII) consensus sequence that
contains two adjacent serines, both of which are phosphorylated. The
other site(s) is in a different domain of the protein, is
phosphorylated less frequently than the CKII site, does not require
preceding CKII-site phosphorylation, and causes an electrophoretic
mobility shift when phosphorylated. Transfection/expression assays for
proteolytic activity showed no gross effect of CKII-site
phosphorylation on the enzymatic activity of the proteinase or on the
substrate behavior of pAP. Evidence is presented that both the CKII
sites and the secondary sites are phosphorylated in virus-infected
cells and plasmid-transfected cells, indicating that these
modifications can be made by a cellular enzyme(s). Apparent
compartmental differences in phosphorylation of the CKII-site
(cytoplasmic) and secondary-site (nuclear) serines suggest the
involvement of more that one enzyme in these modifications.
 |
INTRODUCTION |
Herpesvirus capsid assembly involves
the coordinated interaction of at least five viral proteins. Three of
these ultimately interact strongly to form the outer shell, and the
other two are internal and interact more transiently with the outer
shell and with each other to facilitate capsid formation. The internal
proteins form a scaffolding array that is proteolytically freed from
the outer shell and largely eliminated from the cavity of the capsid to
enable DNA packaging. These internal proteins, in cytomegalovirus (CMV)
called the assembly protein precursor (pAP) and proteinase precursor
(pNP1), are genetically related and are distinguished from the other
capsid proteins by posttranslational modifications (reviewed in
references 10, 32, and 41).
CMV pAP and its homologs in other herpesviruses, most notably pVP22a in
herpes simplex virus (HSV UL26.5 protein), has at least two important
functions in capsid assembly. One is to escort the major capsid protein
(MCP; human CMV UL86 protein) into the nucleus by serving as a nuclear
localization signal (NLS)-bearing escort (29, 33, 48).
Another is to act as a molecular scaffold in guiding formation of the
procapsid shell within the nucleus (3, 17, 21). Once
procapsid formation is complete, and possibly in conjunction with DNA
packaging, pAP is freed from its interaction with MCP by proteolytic
cleavage near its carboxyl end and eliminated from the capsid cavity
(12, 17, 34). This cleavage is made by a genetically related
proteinase that contains the entire pAP sequence as its carboxyl end
(23, 31, 47). The proteinase is essential for the production
of infectious virus (7, 30) and has received considerable
attention as a potential antiviral target (11, 15).
Phosphorylation is a second modification that distinguishes the CMV pAP
and its homologs in other herpesviruses (6, 8, 13, 16, 35).
Although the significance of pAP phosphorylation and the nature of the
modifying enzyme(s) is unknown, both are of interest mechanistically
and as they may lead to new antiviral targets. The work described here
represents an initial step in studying this modification. Our findings
identify the principal phosphorylation site on the CMV pAP, show that
smaller amounts of pAP isoforms are generated by phosphorylation at an
additional site(s), and provide initial evidence that these
modifications may be made by more than one enzyme.
 |
MATERIALS AND METHODS |
Cells and virus.
Human foreskin fibroblasts were cultured,
grown, and infected with simian cytomegalovirus (SCMV), strain Colburn,
as described before (8). Human embryonic kidney (HEK) cells
(line 293, ATCC CRL-1573) were grown in 35-mm-diameter wells (product
no. 3001; Becton Dickinson, Lincoln Park, N.J.), each containing 3 ml
of Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum.
Plasmids and cloning.
Standard DNA techniques
(36) were used to clone and propagate plasmids.
Phosphorylation-site mutants of pAP were made from AW1, the pAP coding
sequence in vector RSV.5neo (47). They were made by excising
a wild-type sequence and replacing it with the appropriate mutant sequence.
Mutants pAP/S156A.RSV.5neo (SP20),
pAP/S157A.RSV.5neo (SP21), pAP/S156A,
S157A.RSV.5neo (SP22), pAP/S156A,
E160A.RSV.5neo (SP23), and pAP/E159A,
E160A.RSV.5neo (SP24) were all made by linearizing AW1 with
MluI, digesting the linear plasmid with SmaI, and
isolating the resulting 6,046-bp fragment by agarose gel
electrophoresis. The 37-bp excised MluI/SmaI
fragment was replaced with a mutation-encoding oligonucleotide (altered
sequence is underlined), annealed to a complementary strand such that a
5' MluI overhang and 3' blunt end resulted. The
S156A oligonucleotide was
CGCGGCATCTGATGAAGAAGAAGACATGTCTTTTCCC; the
S157A oligonucleotide was
CGCGTCAGCTGATGAAGAAGAAGACATGTCTTTTCCC; the
S156A,S157A oligonucleotide was
CGCGGCAGCTGATGAAGAAGAAGACATGTCTTTTCCC; the
S156A,E160A oligonucleotide was
CGCGGCTTCGGATGAGGCTGAAGACATGAGTTTTCCC; and the E159A,E160A oligonucleotide was
CGCGTCCTCGGATGCTGCTGAAGACATGAGTTTTCCC.
The S
156A,S
157A double mutation was also
subcloned into the SCMV maturational proteinase (pNP1) expressed from
AW4, the pNP1
coding sequence in vector RSV.5neo (
47), and
into an inactive
serine nucleophile mutant (S
118A)
expressed from plasmid S118A.L.RSV.5neo
(
45), to give
pNP1/CKII

and S
118A/CKII

,
respectively. This was done by replacing the
BamHI/
DraIII fragment
of each with the
corresponding fragment from
SP22.
Transfections and immunoprecipitations.
HEK cells
(
106 cells/35-mm-diameter well) were transfected with
6.0 µg of plasmid per well by the calcium phosphate method (2), as before (14). Twenty-four hours later the
culture medium was replaced with fresh medium, where appropriate,
containing 32P (400 µCi/ml; Amersham, Arlington Heights,
Ill.) or [35S]methionine (50 µCi/ml; ICN, Costa Mesa,
Calif.). Two days later, cells were harvested and processed for
immunoprecipitation by aspirating the medium from the dish, adding 200 µl of lysis buffer (0.5 M KCl, 1% NP-40, 0.5% deoxycholate, and 1 mM phenylmethylsulfonyl fluoride in phosphate-buffered saline (pH 7.4)
to each dish, and scraping the lysate to an edge for transfer to a
500-µl tube. The resulting lysate was subjected to vortex mixing
(four vigorous pulses) and clarified by centrifugation (16,000 × g, 10 min, 4°C), and the supernatant fraction was
transferred to a new tube and either processed immediately or stored at
80°C until needed (typically not more than 1 week).
Immunoprecipitation reactions were done with the rabbit antipeptide
antisera specified in Results and protein A beads, as described before
(45).
AP isolation from B-capsids by HPLC.
Intranuclear B-capsids
were recovered from infected human foreskin fibroblasts by freezing and
thawing, essentially as described before (17). The particles
were concentrated by pelleting (39,000 rpm, 90 min, 4°C, SW41 rotor)
and either solubilized in preparation for polyacrylamide gel
electrophoresis (PAGE) or disrupted by heating at 80°C for 3 min in a
solution of aqueous 6 M guanidine and 1%
-mercaptoethanol in
preparation for reverse-phase high-performance liquid chromatography
(RP-HPLC).
RP-HPLC was done by using an analytical (4.6-mm-diameter, 25-cm)
C
4 column (Vydak, Hesperia, Calif.) and an acetonitrile
gradient
in aqueous, 0.1% trifluoroacetic acid (TFA), essentially as
described
before (
12) except that the acetonitrile gradient
was increased
by only 0.125% per min between 45 and 50% (i.e., the
elution range
of
AP).
SDS-PAGE and Western immunoassays.
Standard procedures were
used for protein separation by SDS-PAGE, staining with Coomassie
brilliant blue (CBB), and autoradiography; details have been described
before (8, 35, 45). In preparation for SDS-PAGE, samples
were solubilized in 2× protein sample buffer (4% SDS, 2.86 M
-mercaptoethanol, 10% glycerol, 100 mM Tris [pH 7.0], 0.01%
bromophenol blue). Resolving and stacking gels were 10 and 4%
acrylamide, respectively; the ratio of acrylamide to methylene
bisacrylamide was 28:0.735; SDS was from Bio-Rad (Richmond, Calif.;
catalog no. 161-0300), and intensifying screens were Kodak Biomax MS in
combination with Kodak Biomax MS film.
Western immunoassays were done, essentially as described by Towbin et
al. (
42) and detailed before (
45), using the
specified
antipeptide antisera followed by [
125I]protein
A (no. IM144; Amersham) for
detection.
Quantification of CBB-stained proteins was done from digital recordings
prepared by scanning dried gels with reflected visible
light in a UMax
flat-bed scanner (UMax Technologies, Inc., Fremont,
Calif.).
Measurements were made only for bands determined to be
within the
linear response range (established with serial dilutions
of bovine
serum albumin).
32P incorporation was measured with a
BAS1000 phosphorimager (Fuji
Photo Film Co., Ltd., Tokyo, Japan). The
Quant mode of the MacBAS
(version 2.5) software (Fuji) was used to
calculate band intensities
from selected areas of the resulting
images.
Thin-layer separation of phosphopeptides.
Two-dimensional
(2-D) separations of tryptic phosphopeptides on thin-layer cellulose
(TLC) plates was done essentially as described before (12).
Protein bands were located by CBB staining or by autoradiography,
excised from the gel, treated with trypsin (Worthington Biochemical
Corp., Freehold, N.J.), and subjected to electrophoresis at pH 1.9 followed by ascending chromatography. The chromatography buffer was
isobutyric acid-butanol-pyridine-acetic acid-water (65:5:3:2:25)
(38). Phosphopeptides were detected by fluorography using
Biomax film and intensifying screens.
Peptide analysis by mass spectrometry.
32P-labeled AP (
25 µg) was prepared by RP-HPLC as
described above and treated with 15 µg of trypsin (no. 1418475;
Boehringer Mannheim) per sample overnight at room temperature; the
resulting peptides were subjected to RP-HPLC using a Vydak
C18 column eluted with a gradient of acetonitrile in
aqueous 0.1% TFA, essentially as described before (49).
The
32P-labeled peptides eluted at

28% acetonitrile as
a peak collected in seven fractions. A sample of the fraction
containing
the highest amount of
32P radioactivity was
lyophilized; suspended in 20% acetonitrile-0.1%
aqueous TFA; mixed
with equal volumes of

-hydroxycinnamic acid
(saturated solution in
50% ethanol) and ammonium sulfate (saturated
solution in water); and
analyzed, in both the positive and negative
ion modes, in a Kompact
MALDI4 matrix-assisted laser desorption-time-of-flight
mass
spectrometer (Kratos Analytical, Manchester, England), using
a 337-nm
N
2 laser and a 20-kV extraction
voltage.
Alkaline phosphatase treatment of pAP.
32P- or
[35S]methionine-labeled pAP was immunoprecipitated from
transfected HEK cells with anti-C1 (39) as described above. The bead-bound immune complexes were washed twice in calf intestinal alkaline phosphatase (CIAP) buffer (50 mM Tris-HCl, 0.1 mM EDTA [pH
8.5]) containing 1 mM phenylmethylsulfonyl fluoride, suspended in 200 µl of CIAP buffer (per 20 mg of beads), and aliquoted equally into
five tubes. After pelleting the beads again and removing the
supernatant, CIAP (10 U/tube, in final volume of 100 µl; Boehringer Mannheim, Indianapolis, Ind.) was added and allowed to react for the
specified times. Mock-treated control samples were incubated in the
same volume of reaction buffer with no CIAP. Nontreated control samples
(time zero) were prepared by adding 2× protein sample buffer to the
pelleted beads, instead of CIAP reaction buffer. Reactions were shaken
at 37°C for the times indicated and spun for 30 s at 16,000 × g to pellet the bead-bound immune complexes, and the
supernatant was removed. The beads were then suspended in an equal
volume of 2× protein sample buffer and frozen at
80°C until
analyzed, or immediately subjected to SDS-PAGE followed by
autoradiography and phosphorimaging.
Detection of Pi.
The method used has been
described before (40). Following CIAP reactions, the
bead-bound immune complexes were pelleted from the preparation by
centrifugation (16,000 × g, 1 min, 4°C); the
supernatant was subjected to trichloroacetic acid precipitation, followed by addition of KH2PO4 and extraction
with isobutanol-toluene and ammonium molybdate. The upper phase
resulting from centrifugation (12,000 × g, 5 min, room
temperature) of the mixture was removed and analyzed for Cerenkov
radiation in a scintillation spectrometer.
 |
RESULTS |
Identification of primary phosphopeptides of AP from
CMV-infected cells.
32P-labeled AP was purified by
HPLC from CMV B-capsids (Fig. 1A) and
digested with trypsin, and the resulting peptides were resolved by
HPLC. A major peak of 32P radioactivity was detected (Fig.
1B), and a sample of fraction 25 was subjected to mass spectrometry.
Seven of the observed peaks correlate with three predicted AP tryptic
fragments (Fig. 1C). The peak with the largest mass-to-charge ratio,
2,044, corresponds to the AP tryptic peptide, Gly 124 to Arg 141 (no
phosphate). The peaks at 2,153, 2,232, and 2,314 correspond to the AP
tryptic peptide, Asp 154 to Lys 173 (designated casein kinase IIa
[CKIIa]; Fig. 1C, inset), in its non-, mono-, and diphosphorylated
states, respectively. The peaks at 2,438, 2,517, and 2,602 correspond to an incompletely cleaved form of the same peptide, Glu 152 to Lys 173 (designated CKIIb; Fig. 1C, inset), in its respective non-, mono-, and
diphosphorylated states. Because CKIIa is a limit tryptic peptide
containing three serines, and CKIIb is an amino-terminal extension of
CKIIa, these data localize the primary sites of phosphorylation to one
or more of three serines (i.e., Ser156, Ser157, and Ser164; Fig. 1C,
inset) in the carboxyl half of AP. Differential ionization properties
(22, 49) of the di-, mono-, and nonphosphorylated forms of
the peptides limit use of these data to qualitative interpretation only.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
AP is phosphorylated at its CKII-site serines in
CMV-infected fibroblasts. 32P-containing AP was purified by
HPLC from nuclear B-capsids (A) and digested with trypsin, and the
resulting phosphopeptides were resolved by HPLC (B) and analyzed by
mass spectrometry (C), all as described in Materials and Methods. Shown
are the distributions of 32P radioactivity in fractions
collected from the chromatographic separations (A and B) and a mass
spectrum obtained in the negative ion mode from a sample of panel B
HPLC fraction 25 (C). Panel C (inset) also shows two pAP tryptic
peptides, CKIIa (Asp154-Lys173) and CKIIb
(Glu152-Lys173), that contain a CKII consensus
sequence (underlined) and three serine residues (larger letters).
|
|
AP is similarly phosphorylated in virus-infected and
plasmid-transfected cells.
When 32P-labeled AP
recovered from B-capsids was compared by 2-D peptide separation with
32P-labeled AP expressed by transfection (Fig. 2A and
B, respectively), the patterns were
essentially the same (e.g., mixture [Fig. 2C]). Two predominant
(i.e., spots 1 and 2) and several minor (e.g., spots a, b, and c)
phosphopeptides were present in both. Upon redigestion with trypsin,
isolated peptide 1 was unchanged but about 50% of isolated peptide 2 was converted to peptide 1 (data not shown). These results are
compatible with phosphopeptide 2 being an incomplete cleavage product,
corresponding to the mono- and/or diphosphorylated CKIIb species
detected by mass spectrometry, and peptide 1 being the mono- and/or
diphosphorylated form of the limit tryptic peptide, CKIIa (additional
evidence below). Thus, AP appears to be similarly phosphorylated
whether recovered from B-capsids or transfected cells, indicating that
these modifications can be made by a cellular enzyme.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 2.
Phosphopeptide patterns of AP from transfected and
infected cells are the same. 32P-labeled AP recovered from
infected (A) or transfected (B) cells was digested with trypsin, and
the resulting hydrolysates, individually or in combination (C), were
subjected to 2-D separation on TLC plates. Shown is a collage of
autoradiographic images prepared from the resulting plates. The
position of the origin (Ori) is indicated, electrophoresis was from
left to right, and chromatography was from bottom to top.
Phosphopeptide designations are described in the text. Radioactivity in
the region of each plate containing the cluster of labeled spots was
quantified following phosphorimaging; the photo-stimulated luminescence
(psl) measured in panels A + B approximated that of the mixture on
plate C.
|
|
Primary sites of pAP phosphorylation are within a CKII consensus
sequence.
Given that AP phosphorylation appears to be the same in
plasmid-transfected cells as in CMV-infected cells (e.g., Fig. 2), we
used the more amenable transfection system to fine map and further
study AP phosphorylation. In the first experiment, each of the three
serines in the CKIIa peptide was mutated to determine which is
phosphorylated. The AP precursor, pAP (see Fig. 8B), was used for these
and subsequent transfection/immunoprecipitation experiments because it
could be more efficiently immunoprecipitated than AP, and its 2-D
phosphopeptide pattern was indistinguishable from that of AP (data not shown).
The wild-type and mutant proteins were expressed in
32P-labeled transfected cells, immunoprecipitated, and
analyzed by SDS-PAGE/CBB
staining followed by phosphorimaging.
Wild-type pAP showed as
two bands (pAP and pAP*) by CBB staining (Fig.
3A, top window).
The same two bands, plus
an often weaker third band (pAP**), were
detected by radiolabeling
(Fig.
3A, middle window; also see Fig.
8A, lane 1). Mutation of Ser 164 had no effect on either the staining
or radiolabeling pattern relative
to wild-type pAP (data not shown).
Mutation of Ser 156 or 157, or both,
had no evident effect on
the amount or relative abundance of the mutant
proteins (Fig.
3A, top window) but reduced phosphorylation of the pAP
band by
50 (S
156
), 78 (S
157
), and 100%
(S
156,S
157
), respectively,
compared with wild-type pAP (Fig.
3A, middle
and bottom windows). The
same mutations reduced, but did not eliminate,
phosphorylation of the
corresponding pAP* and pAP** bands (Fig.
3A, middle window), as
illustrated most clearly by the
S
156,S
157
double mutant (Fig.
3A,
leftmost lane).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Substitution of CKII-site serines 156 and 157, or
glutamic acids 159 and 160, reduced pAP phosphorylation. pAP was
immunoprecipitated from cells that had been transfected with wild-type
(wt) or mutant-encoding plasmids and grown in medium containing
32Pi. pAP immunoprecipitates were subjected to
SDS-PAGE, the proteins were stained with CBB, and the gels were dried
and autoradiographed. Shown are images of the CBB-stained proteins (top
windows in panels A and B) and autoradiograms prepared from the dried
gels (middle windows in panels A and B). The radioactivity/stain
intensity of mutant pAP normalized to radioactivity/stain intensity of
wild-type pAP is given (bottom windows) for the serine mutants in panel
A and for the glutamic acid or serine/glutamic acid mutants in panel B. pAP* and pAP** are electrophoretically slower-moving isoforms of pAP,
not included in specific activity calculations of pAP. Abbreviations
for the mutant proteins: S156,S157
(pAP/S156A,S157A), S157
(pAP/S157A), S156 (pAP/S156A);
S156,E160 (pAP/S156A,E160A); and
E159,E160 (pAP/E159A,E160A).
|
|
These data indicate that (i) Ser 156 and 157, which are in a CKII
phosphorylation motif (
19), are both phosphorylated; (ii)
Ser 157 is phosphorylated more often than Ser 156 (i.e., pAP-specific
activity reduced more by mutation of S 157); (iii) only serines
156 and
157 are phosphorylated on the pAP isoform; (iv) these
residues are also
phosphorylated on the pAP* and pAP** isoforms
(i.e., pAP* and pAP**
intensity decreased in mutants relative
to wild type; also see Fig.
6
and
7); and (v) pAP* and pAP** are
phosphorylated at sites not modified
in pAP (also see Fig.
6D).
Phosphorylation at serines 156 and 157 is influenced by key acidic
residues predictive of CKII substrates.
CKII phosphorylation sites
characteristically have a specificity-determining acidic amino acid at
the +3 position (28). Both Ser 156 and 157 have +3 position
acidic residues (i.e.,
SSDE159E160ED), and these were
mutated to test their influence on pAP phosphorylation (Fig. 3B). The
mutant proteins were expressed in 32P-labeled cells,
immunoprecipitated, and analyzed by SDS-PAGE/CBB staining followed by
phosphorimaging. When both Glu 159 and 160 were mutated to alanines,
pAP phosphorylation was reduced by 83% relative to wild-type pAP (Fig.
3B, mutant pAP/E159A,E160A, middle and bottom
windows). When Glu 160 alone (i.e., +3 to S157) was changed to Ala, but
in the pAP/S156A mutant to test its specific effect on
phosphorylation of S157, phosphorylation in the double Ser156/Glu160 mutant was reduced
30% more
than observed in the single S156A mutant (compare Fig. 3A,
S156
, with Fig. 3B,
S156,E160
). These predicted
effects of the +3 acidic residues on phosphorylation of Ser 156 and 157 are consistent with the substrate specificity of CKII or a related enzyme.
Electrophoretic mobility isoforms of pAP due to differential
phosphorylation.
Eliminating CKII serines 156 and 157 abolished
phosphorylation of the primary pAP band but did not eliminate
phosphorylation of pAP* and pAP**, indicating that the slower-migrating
species are phosphorylated at other sites. To determine whether these additional phosphorylations are responsible for the slower
electrophoretic mobilities of pAP* and pAP**, preparations of
immunoprecipitated 32P- or
[35S]methionine-labeled pAP were treated with CIAP for 1, 2, or 3 h, and the products of the reactions were separated by
SDS-PAGE (Fig. 4A) and quantified by
phosphorimaging, or processed to measure CIAP-released 32P
(Fig. 4B). Phosphatase treatment reduced the amount of 32P
labeling of all three bands (Fig. 4A, 32P lanes; Fig. 4B,
32Pb). This loss is attributed to
dephosphorylation, rather than proteolytic degradation, because (i) it
correlated with an increased amount of released 32P (Fig.
4B, 32Pr) and (ii) the combined amount of
[35S]methionine-labeled protein in the three bands
remained nearly constant (Fig. 4A, 35S lanes; Fig. 4B,
35Sb).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 4.
Susceptibility of assembly protein phosphorylation to
CIAP treatment. Parallel samples of
[35S]methionine-labeled and 32P-labeled pAP
were immunoprecipitated from transfected cells and subjected to
treatment with 10 U of CIAP for 1, 2, or 3 h, and the resulting
products were resolved by SDS-PAGE and analyzed by phosphorimaging.
Shown is an autoradiographic image of the CBB-stained gel (A) and a
graph (B) showing, for each time point, the bound 32P
(32Pb) and 35S
(35Sb) (both in units of photo-stimulated
luminescence [psl]) in the combined three pAP isoforms, and the total
32P released (32Pr). Time-zero
samples were nontreated starting material, and mock-treated samples (M)
were incubated for 3 h in CIAP reaction buffer lacking the
phosphatase, all as described in Materials and Methods.
|
|
Dephosphorylation of the pAP isoform, which is phosphorylated only at
CKII serines 156 and 157 (Fig.
3A), was complete within
1 h and
had no detected effect on its electrophoretic mobility
(Fig.
4A;
compare respective
32P and
35S lanes). The
amount of
32P radioactivity in the pAP* and pAP** bands was
also dramatically
reduced after 1 h of phosphatase treatment
(presumably due to
removal of their CKII-site phosphates); however, in
contrast to
pAP, pAP* and pAP** were not completely dephosphorylated,
even
after treatment for 3 h (Fig.
4A,
32P lanes). The
loss of [
35S]methionine-labeled protein from the pAP* and
pAP** bands following
CIAP treatment (Fig.
4A,
35S lanes)
in the absence of evidence for proteolytic degradation
(Fig.
4B,
35S
b) indicates a conversion of pAP* and pAP**
to pAP. However,
the low level of radioactivity, combined with the
close spacing
of these bands in the gel, precluded measuring each
independently
to quantify this
conversion.
Similar results were obtained when the experiment was repeated with the
pAP/S
156A,S
157A mutant to eliminate the strong
background
contributed by CKII-site phosphorylation. As demonstrated in
Fig.
3A, no phosphorylation of pAP is detected with this mutant (Fig.
5A,
32P lanes). Although not
well resolved in this experiment, it can
be seen that both
32P-labeled (Fig.
5A,
32P lanes) and
35S-labeled (Fig.
5A,
35S lanes) pAP* and pAP**
decreased with time of phosphatase treatment;
dephosphorylation of pAP*
and pAP** was not complete after treatment
for 3 h; and the
combined
35S radioactivity of the three bands remained
about constant (Fig.
5B), consistent with conversion of pAP* and pAP**
to pAP. Dephosphorylation
of these secondary sites was slower than that
observed for the
CKII-site-containing bands, and the increase of free
32P was correspondingly slower (compare Fig.
4 and
5).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 5.
pAP* and pAP** are differentially phosphorylated forms
of pAP. Parallel samples of 35S-methionine- and
32P-labeled CKII-site mutant
pAP/S156A,S157A were immunoprecipitated from
transfected cells and subjected to treatment with 10 U of CIAP for 1, 2, or 3 h, and the resulting products were resolved by SDS-PAGE
and analyzed by phosphorimaging. Shown is an autoradiographic image of
the CBB-stained gel (A) and a graph (B) showing, for each time point,
the bound 32P (32Pb) and
35S (35Sb); displaced downward
approximately 70 psl for presentation) (both in units of
photo-stimulated luminescence [psl]) in the combined three pAP
isoforms, and the total 32P released
(32Pr). Time-zero samples were nontreated
starting material, and mock-treated samples (M) were incubated for
3 h in CIAP reaction buffer lacking the phosphatase, all as
described in Materials and Methods.
|
|
The data presented in Fig.
3 to
5 are interpreted to show that (i) pAP
is phosphorylated at CKII serines 156 and 157 only,
and both of these
are readily dephosphorylated by CIAP; (ii) pAP*
and pAP** are
phosphorylated at sites other than serines 156 and
157 (Fig.
3A; see
also Fig.
6D), and these secondary-site phosphorylations
are more
resistant to dephosphorylation by CIAP than the CKII-site
serines (Fig.
4 and
5); and (iii) dephosphorylation of the secondary
sites converts
pAP* and pAP** to
pAP.
Although not yet substantiated by mass spectrometry, it is probable
that the secondary-site phosphorylations are due to addition
of
orthophosphate, rather than some other group (e.g., phospholipid
or
nucleotide), because (i) initial phospho-amino acid analyses
indicate
the presence of phosphoserine in the combined pAP*/pAP**
band
(
29a), (ii) CIAP is expected to hydrolyze only
phosphomonoester
linkages, and (iii) the assay used to measure
CIAP-released phosphate
is considered specific for orthophosphate
(
40).
Identification of pAP* phosphopeptides containing secondary
phosphorylation sites.
Phosphopeptide patterns of wild-type and
CKII-site mutants of pAP* were compared to correlate the different
phosphorylation sites with specific peptides. Respective
32P-labeled pAP* bands were identified following SDS-PAGE
of transfected-cell lysates, cleaved with trypsin, and compared by 2-D
peptide analysis. Wild-type pAP* contained two phosphopeptides with low
mobility in the chromatography phase (Fig.
6A, spots 1 and 2; doublets, probably due
to differential oxidation of Met 163 [43]) and a group
of about three phosphopeptides with high chromatographic mobility (i,
ii, and iii) (Fig. 6A). Peptides 1 and 2 contain CKII-site serines 156 and 157, as deduced from the data in Fig. 1 and 2 and illustrated by
their changes in the mutant proteins. Loss of either Ser 156 and 157 alone caused peptides 1 and 2 to shift toward the cathode (right,
relative to spot iii), consistent with the reduced negative charge that
loss of a phosphate would cause (Fig. 6B and C). Peptides 1 and 2 were
not phosphorylated in the mutant lacking both Ser 156 and 157, establishing that these peptides contain the CKII site.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 6.
Verification of CKII-site, and identification of
secondary-site, tryptic phosphopeptides. 32P-labeled
wild-type pAP, or pAP from three CKII-site mutants (S156A,
S157A, and S156A,S157A), was
separated by SDS-PAGE; the pAP* band from each was digested with
trypsin; and the resulting phosphopeptides were resolved by
two-dimensional separation on TLC plates. Shown is a collage of
autoradiographic images prepared from each plate. The position of the
origin is indicated (Ori), electrophoresis was from left to right, and
chromatography was from bottom to top. Phosphopeptide designations are
described in the text; lines in panels A to C help demonstrate shift of
peptides 1 and 2 relative to i, ii, and iii.
|
|
All four pAP* patterns contain a group of at least three
phosphopeptides (labeled i, ii, and iii in Fig.
6) that are not present
in corresponding patterns of AP or pAP (data not shown) and were
unaffected by the CKII mutations (i.e., essentially the same in
Fig.
6A
to D). These spots distinguish pAP* from pAP and are interpreted
as
corresponding to the peptides that contain at least one of
the
secondary phosphorylation
sites.
Secondary sites of phosphorylation are the same in transfected and
infected cells.
AP in B-capsids isolated from infected cells also
migrates as three bands when resolved by SDS-PAGE (17, 21).
Phosphopeptide comparisons of AP from B-capsids and pAP from
transfected cells showed that their patterns were essentially the same,
with spots 1 and 2 being predominant (Fig. 2C and data not shown).
To compare the secondary phosphorylation sites of B-capsid AP* with
those of transfected-cell pAP*, tryptic digests of each
were prepared
and subjected to 2-D separation. The resulting phosphopeptide
pattern
for B-capsid AP* (Fig.
7A) looked like
that of transfected-cell
pAP* (Fig.
7B), and a mixture of the two
showed that they were
essentially the same (Fig.
7C). The set of spots
to the left of
i, ii, and iii were from the AP** band (Fig.
7G to I),
which was
difficult to completely exclude from the AP* sample. Thus,
the
same CKII sites (spots 1 and 2) and secondary sites (spots i,
ii,
and iii) are phosphorylated in AP* and pAP*, whether from
B-capsids or
transfected cells.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 7.
Comparisons of secondary-site phosphopeptides from pAP
and AP isoforms. 32P-labeled pAP isoforms
immunoprecipitated from transfected HEK cells, and
32P-labeled AP isoforms from B-capsids, were separated by
SDS-PAGE, and the two slower-moving isoforms from each were subjected
to digestion with trypsin, followed by 2-D separations of the resulting
peptides and fluorographic detection of the phosphopeptides. Shown are
the patterns obtained for capsid AP* (A), transfection pAP* (B), and a
mixture of the two (C); capsid AP** (D), transfection pAP** (E), and a
mixture of the two (F); and capsid AP* (G), capsid AP** (H), and a
mixture of the two (I). Some variation was observed between
separations. The position of the origin (Ori), for each plate is
indicated, electrophoresis was from left to right, and chromatography
was from bottom to top. Phosphopeptide designations are described in
the text.
|
|
In the same way, the corresponding AP** and pAP** bands from B-capsids
and transfected cells were compared. Like those of
AP* and pAP*, the
phosphopeptide patterns of B-capsid AP** (Fig.
7D) and transfected-cell
pAP** (Fig.
7E) were indistinguishable
when separated as a mixture
(Fig.
7F). The upper set of peptides
was reproducibly closer to the
anode (left), relative to spot
2, than spots i, ii, and iii in the pAP*
and AP* patterns (Fig.
7A to C) and were therefore labeled

,

,
and

.
Confirmation that spots

,

, and

differed from i, ii, and iii,
and that CKII-site peptides 1 and 2 are the same in pAP**
and AP** as
in pAP* and AP*, was obtained by subjecting a mixture
of B-capsid AP*
and AP** to 2-D peptide analysis. The AP* CKII-site
peptides, 1 and 2 (Fig.
7G; also compare Fig.
6A and
6D), coseparated
with peptides 1 and
2 of AP** (Fig.
7H) when mixed (Fig.
7I),
but AP* spots i, ii, and iii
(Fig.
7G) were not coincident with
AP** spots

,

, and

,
respectively (Fig.
7I). Thus, B-capsid
AP, AP*, and AP** all contain
the CKII-site peptides 1 and 2,
and AP* and AP** are distinguished from
AP and from each other
by secondary-site phosphorylations represented
by peptide sets
i, ii, iii and

,

,

, respectively. The
similarity in the electrophoretic
and chromatographic migrations of
peptides i, ii, and iii (Fig.
7G) and

,

, and

(Fig.
7H)
suggests that the two sets of peptides
are related, with

,

, and

being more acidic, as indicated
by their relative displacement
toward the anode (e.g., Fig.
7I).
Maturational proteinase is also phosphorylated at CKII-site
serines.
Considering that the entire pAP sequence is contained as
the carboxyl half of the proteinase precursor, pNP1 (Fig.
8B), due to the 3'-coterminal, nested
arrangement of their genes (46), we tested whether the
corresponding CKII-site serines in pNP1 are also phosphorylated. This
was done by 32P-labeling proteins in transfected cells,
immunoprecipitating them, subjecting the immunoprecipitates to
SDS-PAGE, and visualizing the bands by autoradiography. As observed
before (Fig. 3A, left lane) and included here for reference, pAP
resolved into three bands (pAP, pAP*, and pAP** [Fig. 8A, lane 1]),
only the slower-migrating two being radiolabeled in the CKII-site
mutant, pAP/S156A,S157A (Fig. 8A, lane 2).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 8.
Maturational proteinase, pNP1, is phosphorylated at its
CKII-site serines. (A) 32P-labeled wild-type (lanes 3 and
4) or inactive (lanes 5 and 6) precursor proteinase bearing either S156
and S157 (lanes 3 and 5) or their alanine substitutions (lanes 4 and 6)
were immunoprecipitated (anti-C1 for lanes 1, 2, 5, and 6; anti-N1 for
lanes 3 and 4) from transfected HEK cells and separated by SDS-PAGE.
Shown here is an autoradiographic image prepared from the resulting
gel. Wild-type pAP (lane 1) and CKII-site mutant
pAP/S156A,S157A (lane 2) were processed in
parallel with the proteinase samples as controls. The asterisk denotes
a faint band of NP1 in lane 3. The presence (+) or absence ( ) of
CKII-site serines 156 and 157 is indicated beneath each lane. Bars to
the left of lanes 1, 3, and 5 indicate positions of the primary and two
slower-migrating isoforms of pAP, NP1c, and pNP1,
respectively. (B) Schematic showing the primary translation products,
pNP1 (proteinase precursor) and pAP (assembly protein precursor), and
their corresponding cleavage products:
pNP1 NP1 NP1c + NP1n (assemblin);
pAP AP + Tail. M and R, maturational and release cleavage sites;
×, the inactivated serine nucleophile in mutant S118A; SS,
CKII-site serines, 156 and 157; N1 (rectangle) and C1 (oval), locations
of amino acid sequences used to prepare the anti-N1 and anti-C1
antipeptide antisera; filled circles, positions of NLS1 and NLS2.
|
|
Correspondingly, a proteolytically inactive mutant of the proteinase
precursor, nucleophile mutant S
118A (
45),
resolved
into three closely spaced phosphorylated bands (Fig.
8A, lane
5), the fastest-migrating one corresponding to the noncleaved
precursor, pNP1 (Fig.
8A, lane 5; Fig.
8B). When the S
118A
CKII-site
serines were mutated (i.e., mutant
S
118A/CKII

), only the two slower-migrating
bands (pNP1* and pNP1**) were
phosphorylated, and their level of
radiolabeling was reduced compared
with S
118A* and
S
118A** (Fig.
8A; compare lanes 5 and 6). These
data
indicate that phosphorylation of S
118A is also restricted
to the CKII site and that the two slower-migrating isoforms,
S
118A*
and S
118A**, are phosphorylated at
additional secondary
sites.
Wild-type proteinase was similarly tested. Little of the precursor,
pNP1, remained uncleaved (Fig.
8A, lane 3), but three
radiolabeled
bands were present in the 45-kDa size range of NP1
c,
the
carboxyl fragment that is produced by M- and R-site cleavage
of pNP1
and that contains the entire AP sequence (Fig.
8B). Overall
phosphorylation was reduced and limited primarily to the upper
two of
these bands in the CKII-site mutant, pNP1/CKII

, (Fig.
8A,
lane 4). The trace amount of radioactivity detected
at the position of
NP1
c in the CKII-site mutant is suspected to
be due to a
comigrating breakdown/background band, but this remains
unproven. Thus,
phosphorylation of the NP1
c band is largely, if
not
exclusively, restricted to serines 156 and 157 and phosphorylation
of
the two slower-migrating bands, NP1
c* and
NP1
c**, includes
secondary
sites.
We interpret these data as indicating that the proteinase precursor is
phosphorylated at the same CKII and secondary sites
as pAP (Fig.
8B).
The absence of obvious differences between the
2-D phosphopeptide
patterns of pAP*, NP1
c*, and pNP1* (S
118A)
supports this interpretation (one experiment; data not
shown).
Phosphorylation of the CKII serines is not required for enzymatic
activity of pNP1 or for substrate suitability of pAP.
The observed
M- and R-site cleavage of CKII-site mutant, pNP1/CKII
(e.g., presence of NP1c* and NP1c** [Fig. 8A,
lane 4]), demonstrated that CKII-site phosphorylation is not essential
for the autoproteolytic activity of the enzyme. To test the possibility
that this modification may have a more subtle effect on proteolytic
activity, or on pAP as a substrate, we used Western immunoassays to
reveal these reactions in more detail. Wild-type proteinase or its CKII
mutant, pNP1/CKII
, was expressed alone or in combination
with the corresponding wild-type or CKII-mutant form of pAP. Lysates of
the transfected cells were subjected to SDS-PAGE followed by Western
immunoassay using the anti-N1 antiserum (39), an antipeptide
antiserum that recognizes all but two of the major pNP1 and pAP
cleavage products (i.e., NP1n and Tail [Fig. 8B]).
No evidence was found that CKII-site phosphorylation affects any of the
cleavages monitored: (i) the NP1 and NP1
c products
of M-
and R-site cleavage of pNP1 were essentially the same for
the wild-type
proteinase (Fig.
9, lane 3) and its
CKII-site mutant
(Fig.
9, lane 4); (ii) wild-type substrate, pAP (Fig.
9, lane
7), was cleaved equally well to AP by the wild-type proteinase
(Fig.
9, lane 5) and its CKII-site mutant (Fig.
9, lane 6); and
(iii)
the CKII-site mutant pAP (Fig.
9, lane 8) was also cleaved
equally well
to AP by the wild-type proteinase (Fig.
9, lane 9)
and its CKII-site
mutant (Fig.
9, lane 10). Cytoplasmic and nuclear
fractions of
virus-infected human fibroblasts (Fig.
9, lanes 1
and 2, respectively),
included for comparison, show the coincidence
of the respective
NP1
c, pAP, AP, AP*, and AP** bands in virus-infected
versus
plasmid-transfected cells, and also show that transfected
cells contain
more of the pAP* and pAP** isoforms, relative to
pAP, than
virus-infected cells (
14).

View larger version (103K):
[in this window]
[in a new window]
|
FIG. 9.
Neither proteolytic activity nor substrate suitability
is noticeably altered by CKII-site phosphorylation. Wild-type (wt;
lanes 3, 5, and 9) and CKII-mutant (lanes 4, 6, and 10) proteinases
were tested for self-cleavage (lanes 3 and 4) and processing of
wild-type (lanes 5 and 6) and CKII-mutant substrate (lanes 9 and 10) by
transfection assays. Cleavages were monitored by Western immunoassays
with anti-N1 (Fig. 8B) and [125I]protein A as described
in Materials and Methods. Shown is an autoradiographic image of the
resulting blot. Bands of interest are indicated by abbreviations at the
right; proteins expressed are specified at the bottom. Presence (+) or
absence ( ) of the CKII-site serines 156 and 157 in the proteinase
tested (or pAP alone in lanes 7 and 8) is indicated below lanes 3 to
10. Wild-type pAP was coexpressed with the proteinase constructs in
lanes 5 and 6; pAP lacking CKII serines 156 and 157 was coexpressed
with the proteinase constructs in lanes 9 and 10. Asterisks indicate
positions of AP, pAP, and NP1c isoforms. Cytoplasmic (C)
and nuclear (N) fractions of virus-infected (Inf.) cells (lanes 1 and
2) are shown for reference. Dots to the left of lane 1 indicate bands
coincident with NP1c, pAP, AP**, AP*, and AP (top to
bottom).
|
|
Nuclear localization is not required for pNP1 phosphorylation.
The proximity of the CKII motif to two flanking NLSs (Fig. 8B, NLS1 and
NLS2; reference 29), suggested that nuclear
transport and phosphorylation of these proteins might be interrelated.
To test whether nuclear translocation was required for pNP1
phosphorylation, we compared the level of phosphorylation of
NLS+ S118A (i.e., S118A;
64
kDa), which localizes to the nucleus, with that of NLS
S118A (i.e., S118A/NLS1,2
), which
is restricted to the cytoplasm (29). This was done by
expressing and 32P-labeling the proteins in transfected
cells, lysing the cells and recovering the proteins by
immunoprecipitation, and analyzing the immunoprecipitates by SDS-PAGE
and autoradiography.
It can be seen that phosphorylation of the cytoplasmic
NLS

mutant, S
118A/NLS1,2

(Fig.
10, lane 4), was comparable to, if not
greater than, that
of NLS
+ S
118A (Fig.
10, lane
1) and two other NLS mutants of S
118A (Fig.
10, lanes 2 and
3), all three of which accumulate predominantly
in the nucleus
(
29). One notable difference, not well demonstrated
here but
reproduced in complementing Western immunoassays (
16),
is
that the amounts of the electrophoretically slower-migrating
isoforms,
S
118A* and S
118A**, relative to that of the
S
118A band,
are markedly reduced in the NLS

mutant (Fig.
10, lane 4).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 10.
Evidence for cytoplasmic CKII-site phosphorylation of
NLS pNP1. 32P-labeled, inactive precursor
proteinase (S118A mutant) bearing either intact
(NLS+; lane 1) or mutated (NLS ; lanes 2 to 4)
NLS (29) were immunoprecipitated with anti-C1 (Fig. 8B) from
transfected cells and separated by SDS-PAGE. Shown is an
autoradiographic image of the resulting gel. 32P-labeled
pAP (lane 5) and mock-transfected cell (lane 6) samples were processed
in parallel as controls for expression and immunoprecipitation
specificity, respectively.
|
|
These data indicate that the S
118A/NLS

proteinase undergoes CKII-site phosphorylation in the cytoplasm and
provide initial
evidence that secondary-site phosphorylation may be a
nuclear
event. Similar results (data not shown) were found for pAP and
NLS-deficient pAP (i.e., pAP/NLS1,2

), but their
interpretation was complicated by the ability of
pAP/NLS1,2

to diffuse into the nucleus due to its small
size (i.e., 34 kDa)
(
29). We also found that mutants of the
proteinase (i.e., S
118A)
or pAP that lack CKII serines 156 and 157 (i.e., S
118A/S
156A,S
157A
and pAP/S
156A,S
157A, respectively) still
localize to the nucleus
and promote nuclear translocation of MCP
(immunofluorescence data
not shown), demonstrating that CKII-site
phosphorylation is not
essential for these
functions.
 |
DISCUSSION |
Phosphorylation is a distinguishing feature of the CMV capsid
assembly protein (9, 16, 21, 35) and its homologs in other
herpesviruses (1a, 6, 13) that may be of functional importance. As a first step in developing assays to study this modification, and to identify the protein kinase responsible for it, we
have determined the primary sites of pAP phosphorylation. Two adjacent
serines in a CKII consensus sequence were identified as the only
residues phosphorylated in the predominant pAP isoform. Two less
abundant isoforms were found to contain one or more secondary sites
whose phosphorylation correlated with electrophoretic mobility shifts.
Phosphorylated counterparts were identified for the proteinase precursor, pNP1, and its carboxyl cleavage product, NP1c,
both of which contain the entire AP amino acid sequence (Fig. 8B and reference 46). Mutation of the CKII-site serines had
no detected effect on the proteolytic activity of pNP1 or on the
substrate behavior of pAP. Initial evidence that CKII- and
secondary-site phosphorylations may happen in different compartments of
the cell raises the possibility that they result from different
enzymes. The justification and implications of these conclusions are
discussed below.
CKII-site phosphorylation.
Our main objective was to determine
whether phosphorylation of pAP is limited to a small number of sites
and, if so, to identify them. Our primary finding is that the only
residues phosphorylated in the most abundant pAP isoform are two
adjacent serines (Ser 156 and 157) in a CKII consensus sequence.
Although the most compelling evidence for this conclusion came from
transfection experiments showing that pAP phosphorylation was
eliminated in a mutant lacking these residues (i.e.,
S156,S157
[Fig. 3A]), it was
demonstrated by mass spectrometry (e.g., Fig. 1C) and 2-D
phosphopeptide comparisons (Fig. 2 and 7) that the same CKII-site
serines are also the primary phosphate acceptors on AP from infected cells.
It was apparent from mass spectrometry that phosphorylation of
infected-cell AP at the CKII site is heterogeneous (e.g., Fig.
1C).
However, the relative amounts of non-, mono-, and diphosphorylated
AP
present in CMV B-capsids could not be quantified accurately
by this
method due to potential differences in the ionization
properties of the
CKII peptide in its various phosphorylation
states (
22,
49).
Such estimates were possible from CKII-site
mutants of pAP expressed in
transfected cells and indicated that
Ser 157 is phosphorylated more
frequently than Ser 156 (Fig.
3A).
Conservation of these serines,
strongest among the betaherpesvirus
pAP homologs, in the context of a
relatively acidic domain present
in most pAP homologs (Table
1), suggests that their phosphorylation
may reflect a betaherpesvirus group-specific requirement. We note
without discussion that CKII-site phosphorylation of the
betaherpesvirus
pAP homologs increases the content of acidic residues
between
the highly conserved NLS1 and PGE sequences, on average, from
34% to 45% (Table
1)

a substantial change in electronegativity.
Secondary-site phosphorylation.
A small amount of pAP is
phosphorylated at additional sites, correlating with the formation of
isoforms pAP* and pAP** (previously called 38- and 39-kDa proteins
[17]), which have reduced electrophoretic mobilities.
Although pAP* and pAP** are phosphorylated at their CKII serines (Fig.
6 and 7), this modification is not required either for secondary-site
phosphorylation or for the mobility shift, as shown by pAP* and pAP**
phosphorylation in the CKII-site mutant,
pAP/S156A,S157A (Fig. 3A and 6D).
Corresponding isoforms of the proteinase (i.e., pNP1* and pNP1**,
and its cleavage products, NP1c* and
NP1c**) were identified, indicating that it shares the same
secondary-site modifications (Fig. 8, lanes 3 to 6).
Earlier work had localized the mobility-shifting sequence to the
carboxyl half of AP, between Trp 139 (
N-chlorosuccinimide
cleavage site) and Ala 277 (C terminus of cleaved pAP) (
39).
Evidence presented here that pAP* and pAP** lose
32P and
are converted to the pAP isoform by alkaline phosphatase
treatment
(Fig.
4 and
5) indicates that the mobility shifts are
due to
secondary-site phosphorylations. On the basis of phosphopeptide
comparisons, it was concluded that these secondary-site
phosphorylations
are contained in a set of phosphopeptides that
distinguish pAP*
and pAP** from pAP (Fig.
6 and
7). Because the
secondary-site
phosphopeptides were unaffected by mutations that alter
the behavior
of CKII-site phosphopeptides 1 and 2 (Fig.
6), it was also
concluded
that the secondary site and CKII site are in different parts
of
the protein. Furthermore, the presence of multiple secondary-site
phosphopeptides (e.g., i, ii, and iii in Fig.
6) indicates either
that
there are multiple secondary sites or that, like the CKII
site (Fig.
1), the secondary site is located within a sequence
that gives
rise to a mixture of partial and limit cleavage
products.
Although our data do not enable us to discriminate between several
explanations for the origins of pAP* and pAP**, our working
hypothesis
is that pAP is converted to pAP* by the phosphorylation
of one
secondary-site residue contained within a sequence that
gives rise to
phosphopeptides i, ii, and iii. Phosphorylation
of another
secondary-site amino acid within the same sequence
converts pAP* to
pAP** and, correspondingly, phosphopeptides i,
ii, and iii to

,

,
and

. If conversion of pAP

pAP*

pAP** is
sequential, as
suggested, pAP* is expected to be more acidic than
pAP by one phosphate
charge, and pAP** would be one phosphate
more acidic than pAP*.
Consistent with this prediction, charge/size
separations of B-capsid
proteins indicate that the pAP* and pAP**
charge isomers are one and
two increments, respectively, more
acidic than those of pAP
(
10a).
A notable difference between AP expressed in transfected versus
CMV-infected cells is that more of the secondary-site phosphorylated
isoforms accumulate in transfected cells (Fig.
9; reference
14).
This could be accounted for in several ways,
including (i) removal
of pAP from the substrate pool in CMV-infected
cells by internalization
into capsids; (ii) selective incorporation of
the secondary-site
phosphorylated isoforms into viable capsids,
followed by their
degradation or dephosphorylation during capsid
maturation; (iii)
depletion of the kinase responsible for
secondary-site phosphorylation
in CMV-infected cells; or (iv) selective
dephosphorylation of
the secondary site by a CMV-encoded phosphatase in
virus-infected
cells.
Enzyme(s) involved.
It is likely that CKII or a CKII-like
activity is responsible for phosphorylating the most abundant of the
three pAP and AP isoforms. Phosphorylation of this predominant species
is limited to serines 156 and 157 within a CKII consensus sequence, and
site-directed mutagenesis of acidic residues +3 of the target serines
reduced phosphorylation at these sites, as predicted for CKII (28,
37). Also consistent with these primary phosphorylations being
made by CKII, normal (if not enhanced) phosphorylation was observed for
a proteinase mutant (S118A/NLS
) that has no
NLS and is consequently confined to the cytoplasm (Fig. 10)
the
generally accepted location of CKII during cell cycle interphase
(50). There are other examples of herpesvirus proteins phosphorylated by CKII or CKII-like activities (4, 18, 20, 24-27), and at least some of these modifications are known to be functionally important (5, 27).
A different activity may phosphorylate the secondary sites of pAP* and
pAP**. By inference from the characteristics of secondary-site
phosphorylation, this activity differs in at least three ways
from the
CKII-site activity. First, it phosphorylates a non-CKII-consensus
sequence, since the CKII site is the only CKII consensus sequence
in
pAP, and the secondary site is not within it, based on the
uncoupled
behavior of phosphopeptides 1 and 2 (CKII site) and
i, ii, and iii
(secondary site) in the three CKII-site mutants
(Fig.
6). Second, the
addition (
14) and removal (Fig.
4 and
5) of phosphate from
the secondary sites is slower than from the
CKII site, compatible with
differences in the sites, the enzyme,
the moiety added, or all three.
And third, CKII-site phosphorylation
occurs in the cytoplasm, whereas
secondary-site phosphorylation
appears to require nuclear translocation
(Fig.
10; reference
28a).
The similar patterns of phosphopeptides observed for AP in transfected
and CMV-infected cells (Fig.
7) indicate that cellular
kinases can make
both CKII- and secondary-site phosphorylations
but does not rule out
the possibility that a virus-encoded enzyme(s)
makes these
modifications during infection. Such functional mimicry
has
precedent in the thymidine kinase enzyme of HSV that is redundant
with
cellular thymidine kinase in cell culture infections but
has,
nevertheless, proven one of the most effective antiherpesvirus
targets
to date (
44).
Function of AP phosphorylation?
Our evidence that the
CKII-site phosphorylations occur in the cytoplasm is compatible with
their involvement in one or more of the earliest steps in the capsid
assembly pathway, such as interaction of pAP with itself, pNP1 or MCP,
or nuclear translocation of these complexes. Conversely, it could be
dephosphorylation of these residues later in the assembly process that
is important. We found no evidence for influences of CKII-site
phosphorylation on the properties of these proteins that were tested,
including proteolytic activity of pNP1 (Fig. 9), substrate effects on
pNP1 or pAP (Fig. 9), interactions of pAP with itself and with MCP (1), and self-localization or MCP translocation to the
nucleus (29, 48) by pNP1 (i.e.,
S118A/S156,S157
) or
pAP (immunofluorescence data not shown). Our inability to demonstrate
such differences, however, does not rule out the possibility of more
subtle effects on these interactions (e.g., kinetic; conformational) that may have escaped detection by the assays used but, nevertheless, have important consequences in the context of other viral proteins and
processes in CMV-infected cells.
Secondary-site phosphorylations, unlike CKII-site phosphorylations,
correlate with mobility changes in pAP. This correlation
indicates that
these modifications have a more pronounced effect
on the protein than
CKII-site phosphorylation. Whether this effect
is relevant to changes
in protein-protein interactions associated
with capsid formation or DNA
packaging, or some other function,
remains to be determined. However,
the fact that pAP homologs
in other herpesviruses, notably HSV pVP22a,
have apparent counterpart
phosphorylated isoforms (
1a)
indicates that this modification
has been conserved and increases
interest in the possibility that
it may be of functional
importance.
 |
ACKNOWLEDGMENTS |
We thank M. Baxter for testing CKII-site mutants for
interactions in the GAL4 two-hybrid assay, J. Bailey for constructing SP23 (pAP/S156A,E160A) and AP24
(pAP/E159A,E160A) and doing
transfection/immunofluorescence studies with
pAP/S156A,S157A, and C. Farrell for data from
his pharmacology research rotation project on charge/size separations of B-capsid proteins. We also acknowledge the excellent technical assistance of Jenny Borchelt and Kendra Plafker in constructing SP23 (pAP/S156A,E160A) and AP24
(pAP/E159A,E160A).
S.M.P. was a student in the Pharmacology and Molecular Sciences
training program and was supported by USPHS grant GM07626. This work
was aided by USPHS research grants GM54882 to R.J.C. and AI13718 and
AI32957 to W.G.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Virology
Laboratories, Department of Pharmacology and Molecular Sciences, Johns
Hopkins University School of Medicine, 725 N. Wolfe St., Baltimore, MD 21205. Phone: (410) 955-8680. Fax: (410) 955-3023. E-mail:
wgibson{at}bs.jhmi.edu.
Present address: Center for Cell Signaling, University of Virginia
Health Sciences Center, Charlottesville, Va.
 |
REFERENCES |
| 1.
| Baxter, M. GAL4 two-hybrid data not
presented.
|
| 1a.
|
Braun, D.,
B. Roizman, and L. Pereira.
1984.
Characterization of posttranslational products of herpes simplex virus gene 35 proteins binding to the surfaces of full capsids but not empty capsids.
J. Virol.
49:142-153[Abstract/Free Full Text].
|
| 1b.
| Brignole, E., and W. Gibson. Unpublished data.
|
| 2.
|
Chen, C., and H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:2745-2752[Abstract/Free Full Text].
|
| 3.
|
Desai, P.,
S. C. Watkins, and S. Person.
1994.
The size and symmetry of B capsids of herpes simplex virus type 1 are determined by the gene products of the UL26 open reading frame.
J. Virol.
68:5365-5374[Abstract/Free Full Text].
|
| 4.
|
Elliot, G.,
D. O'Reilly, and P. O'Hare.
1996.
Phosphorylation of the herpes simplex virus type 1 tegument protein VP22.
Virology
226:140-145[Medline].
|
| 5.
|
Fish, K. N.,
C. Soderberg-Naucler, and J. A. Nelson.
1998.
Steady-state plasma membrane expression of human cytomegalovirus gB is determined by the phosphorylation state of Ser900.
J. Virol.
72:6657-6664[Abstract/Free Full Text].
|
| 6.
|
Friedrichs, W. E., and C. Grose.
1986.
Varicella-zoster virus p32/p36 complex is present in both the viral capsid and the nuclear matrix of the infected cell.
J. Virol.
57:155-164[Abstract/Free Full Text].
|
| 7.
|
Gao, M.,
L. Matusick-Kuman,
W. Hurlburt,
S. F. DiTusa,
W. W. Newcomb,
J. C. Brown,
P. J. McCann,
I. Deckman, and R. J. Colonno.
1994.
The protease of herpes simplex virus type 1 is essential for functional capsid formation and viral growth.
J. Virol.
68:3702-3712[Abstract/Free Full Text].
|
| 8.
|
Gibson, W.
1981.
Structural and non structural proteins of strain Colburn cytomegalovirus.
Virology
111:516-537[Medline].
|
| 9.
|
Gibson, W.
1983.
Protein counterparts of human and simian cytomegaloviruses.
Virology
128:391-406[Medline].
|
| 10.
|
Gibson, W.
1996.
Structure and assembly of the virion.
Intervirology
39:389-400[Medline].
|
| 10a.
| Gibson, W., and C. Farrell. Unpublished data from
Western immunoassay.
|
| 11.
|
Gibson, W., and M. R. T. Hall.
1997.
Assemblin, an essential herpesvirus proteinase.
Drug Des. Discov.
15:39-47[Medline].
|
| 12.
|
Gibson, W.,
A. I. Marcy,
J. C. Comolli, and J. Lee.
1990.
Identification of precursor to cytomegalovirus capsid assembly protein and evidence that processing results in loss of its carboxy-terminal end.
J. Virol.
64:1241-1249[Abstract/Free Full Text].
|
| 13.
|
Gibson, W., and B. Roizman.
1974.
Proteins specified by herpes simplex virus. X. Staining and radiolabeling properties of B capsid and virion proteins in polyacrylamide gels.
J. Virol.
13:155-165[Abstract/Free Full Text].
|
| 14.
|
Gibson, W.,
A. R. Welch, and J. Ludford.
1994.
Transient transfection assay of the herpesvirus maturational proteinase, assemblin.
Methods Enzymol.
244:399-411[Medline].
|
| 15.
|
Holwerda, B. C.
1997.
Herpesvirus proteases: targets for novel antiviral drugs.
Antiviral Res.
35:1-21[Medline].
|
| 16.
|
Irmiere, A., and W. Gibson.
1983.
Isolation and characterization of a noninfectious virion-like particle released from cells infected with human strains of cytomegalovirus.
Virology
130:118-133[Medline].
|
| 17.
|
Irmiere, A., and W. Gibson.
1985.
Isolation of human cytomegalovirus intranuclear capsids, characterization of their protein constituents, and demonstration that the B-capsid assembly protein is also abundant in noninfectious enveloped particles.
J. Virol.
56:277-283[Abstract/Free Full Text].
|
| 18.
|
Jakubowicz, T., and D. P. Leader.
1987.
A major phosphoprotein of cells infected with pseudorabies virus is phosphorylated by cellular casein kinase II.
J. Gen. Virol.
68:1159-1163[Abstract/Free Full Text].
|
| 19.
|
Kennelly, P. J., and E. G. Krebs.
1991.
Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases.
J. Biol. Chem.
266:15555-15558[Free Full Text].
|
| 20.
|
Kolman, J. L.,
N. Taylor,
D. R. Marshak, and G. Miller.
1993.
Serine-173 of the Epstein-Barr virus ZEBRA protein is required for DNA binding and is a target for casein kinase II phosphorylation.
Proc. Natl. Acad. Sci. USA
90:10115-10119[Abstract/Free Full Text].
|
| 21.
|
Lee, J. Y.,
A. Irmiere, and W. Gibson.
1988.
Primate cytomegalovirus assembly: evidence that DNA packaging occurs subsequent to B capsid assembly.
Virology
167:87-96[Medline].
|
| 22.
|
Liao, P. C., and J. Allison.
1994.
An approach to locate phosphorylation sites in a phosphoprotein: mass mapping by combining specific enzymatic degradation with matrix-assisted laser desorption/ionization mass spectrometry.
Anal. Biochem.
19:9-20.
|
| 23.
|
Liu, F., and B. Roizman.
1991.
The herpes simplex virus 1 gene encoding a protease also contains within its coding domain the gene encoding the more abundant substrate.
J. Virol.
65:5149-5156[Abstract/Free Full Text].
|
| 24.
|
Mitchell, C.,
J. A. Blaho,
A. L. McCormick, and B. Roizman.
1997.
The nucleotidylation of herpes simplex virus I regulatory protein 22 by human casein kinase II.
J. Biol. Chem.
272:25394-25400[Abstract/Free Full Text].
|
| 25.
|
Mitchell, C.,
J. A. Blaho, and B. Roizman.
1994.
Casein kinase II specifically nucleotidylates in vitro the amino acid sequence of the protein encoded by the 22 gene of herpes simplex virus 1.
Proc. Natl. Acad. Sci. USA
91:11864-11868[Abstract/Free Full Text].
|
| 26.
|
Norais, N.,
J. A. Hall,
L. Gross,
D. Tang,
S. Kaur,
S. H. Chamberlain,
R. L. Burke, and F. Marcus.
1996.
Evidence for phosphorylation site in cytomegalovirus glycoprotein gB.
J. Virol.
70:5716-5719[Abstract/Free Full Text].
|
| 27.
|
O'Reilly, D.,
O. Hanscombe, and P. O'Hare.
1997.
A single serine residue at position 375 of VP16 is critical for complex assembly with Oct-1 and HCF and is a target of phosphorylation by casein kinase II.
EMBO J.
16:2420-2430[Medline].
|
| 28.
|
Pinna, L. A.
1990.
Casein kinase 2: an `eminence grise' in cellular regulation?
Biochim. Biophys. Acta
1054:267-284[Medline].
|
| 28a.
| Plafker, S., E. Brignole, and W. Gibson. Unpublished
data.
|
| 29.
|
Plafker, S. M., and W. Gibson.
1998.
Cytomegalovirus assembly protein precursor and proteinase precursor contain two nuclear localization signals that mediate their own nuclear translocation and that of the major capsid protein.
J. Virol.
72:7722-7732[Abstract/Free Full Text].
|
| 29a.
| Plafker, S., and W. Gibson. Unpublished data.
|
| 30.
|
Preston, V. G.,
J. A. Coates, and F. J. Rixon.
1983.
Identification and characterization of a herpes simplex virus gene product required for encapsidation of virus DNA.
J. Virol.
45:1056-1064[Abstract/Free Full Text].
|
| 31.
|
Preston, V. G.,
F. J. Rixon,
I. M. McDougall,
M. McGregor, and M. F. Al Kobaisi.
1992.
Processing of the herpes simplex virus assembly protein ICP35 near its carboxy terminal end requires the product of the whole of the UL26 reading frame.
Virology
186:87-98[Medline].
|
| 32.
|
Rixon, F. J.
1993.
Structure and assembly of herpesviruses.
Semin. Virol.
4:135-144.
|
| 33.
|
Rixon, F. J.,
C. Addison,
A. McGregor,
S. L. Macnab,
P. Nicholson,
V. G. Preston, and J. D. Tatman.
1996.
Multiple interactions control the intracellular localization of the herpes simplex virus type 1 capsid proteins.
J. Gen. Virol.
77:2251-2260[Abstract/Free Full Text].
|
| 34.
|
Rixon, F. J.,
A. M. Cross,
C. Addison, and V. G. Preston.
1988.
The products of the herpes simplex virus type I gene UL26 which are involved in DNA packaging are strongly associated with empty but not with full capsids.
J. Gen. Virol.
69:2879-2891[Abstract/Free Full Text].
|
| 35.
|
Roby, C., and W. Gibson.
1986.
Characterization of phosphoproteins and protein kinase activity of virions, noninfectious enveloped particles, and dense bodies of human cytomegalovirus.
J. Virol.
59:714-727[Abstract/Free Full Text].
|
| 36.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 37.
|
Sarno, S.,
P. Vaglio,
O. Marin,
O.-G. Issinger,
K. Ruffato, and L. A. Pinna.
1997.
Mutational analysis of residues implicated in the interaction between protein kinase CK2 and peptide substrates.
Biochemistry
36:11717-11724[Medline].
|
| 38.
|
Scheidtmann, K.-H.,
E. Birgit, and W. Gernot.
1982.
Simian virus 40 large T antigen is phosphorylated at multiple sites clustered in two separate regions.
J. Virol.
44:116-133[Abstract/Free Full Text].
|
| 39.
|
Schenk, P.,
A. S. Woods, and W. Gibson.
1991.
The 45-kDa protein of cytomegalovirus (Colburn) B-capsids is an amino-terminal extension form of the assembly protein.
J. Virol.
65:1525-1529[Abstract/Free Full Text].
|
| 40.
|
Shenolikar, S., and T. S. Ingebritsen.
1984.
Protein (serine and threonine) phosphate phosphatases.
Methods Enzymol.
107:102-109[Medline].
|
| 41.
|
Steven, A. C., and P. G. Spear.
1997.
Herpesvirus capsid assembly and envelopment, p. 312-351.
In
R. Burnett, W. Chiu, and R. Garcea (ed.), Structural biology of viruses. Oxford University Press, New York, N.Y.
|
| 42.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 43.
|
van der Geer, P.,
K. Luo,
B. Sefton, and T. Hunter.
1993.
Phosphopeptide mapping and phosphoamino acid analysis on cellulose thin-layer plates, p. 31-58.
In
D. G. Hardie (ed.), Protein phosphorylation: a practical approach. Oxford University Press, Oxford, England.
|
| 44.
|
Watkins, A. M.,
P. J. Dunford,
A. M. Moffatt,
P. Wong-Kai-In,
M. J. Holland,
D. S. Pole,
G. M. Thomas,
J. Martin,
N. A. Roberts, and M. J. Mulqueen.
1998.
Inhibition of virus-encoded thymidine kinase suppresses herpes simplex virus replication in vitro and in vivo.
Antiviral Chem. Chemother.
9:9-18.
[Medline] |
| 45.
|
Welch, A. R.,
L. M. McNally,
M. R. T. Hall, and W. Gibson.
1993.
Herpesvirus proteinase: site-directed mutagenesis used to study maturational, release, and inactivation cleavage sites of precursor and to identify a possible catalytic site serine and histidine.
J. Virol.
67:7360-7372[Abstract/Free Full Text].
|
| 46.
|
Welch, A. R.,
L. M. McNally, and W. Gibson.
1991.
Cytomegalovirus assembly protein nested gene family: four 3'-coterminal transcripts encode four in-frame, overlapping proteins.
J. Virol.
65:4091-4100[Abstract/Free Full Text].
|
| 47.
|
Welch, A. R.,
A. S. Woods,
L. M. McNally,
R. J. Cotter, and W. Gibson.
1991.
A herpesvirus maturational protease, assemblin: identification of its gene, putative active site domain, and cleavage site.
Proc. Natl. Acad. Sci. USA
88:10792-10796[Abstract/Free Full Text].
|
| 48.
|
Wood, L. J.,
M. K. Baxter,
S. M. Plafker, and W. Gibson.
1997.
Human cytomegalovirus capsid assembly protein precursor (pUL80.5) interacts with itself and with the major capsid protein (pUL86) through two different domains.
J. Virol.
71:179-190[Abstract].
|
| 49.
|
Woods, A. S.,
W. Gibson, and R. J. Cotter.
1994.
Protein processing in herpes viruses, p. 190-210.
In
R. J. Cotter (ed.), Time-of-flight mass spectrometry. American Chemical Society, Washington, D.C.
|
| 50.
|
Yu, I. J.,
D. L. Spector,
Y. S. Bae, and D. R. Marshak.
1991.
Immunocytochemical localization of casein kinase II during interphase and mitosis.
J. Cell Biol.
114:1217-1232[Abstract/Free Full Text].
|
Journal of Virology, November 1999, p. 9053-9062, Vol. 73, No. 11
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Loveland, A. N., Nguyen, N. L., Brignole, E. J., Gibson, W.
(2007). The Amino-Conserved Domain of Human Cytomegalovirus UL80a Proteins Is Required for Key Interactions during Early Stages of Capsid Formation and Virus Production. J. Virol.
81: 620-628
[Abstract]
[Full Text]
-
McCartney, S. A., Brignole, E. J., Kolegraff, K. N., Loveland, A. N., Ussin, L. M., Gibson, W.
(2005). Chemical Rescue of I-site Cleavage in Living Cells and in Vitro Discriminates between the Cytomegalovirus Protease, Assemblin, and Its Precursor, pUL80a. J. Biol. Chem.
280: 33206-33212
[Abstract]
[Full Text]
-
Casaday, R. J., Bailey, J. R., Kalb, S. R., Brignole, E. J., Loveland, A. N., Cotter, R. J., Gibson, W.
(2004). Assembly Protein Precursor (pUL80.5 Homolog) of Simian Cytomegalovirus Is Phosphorylated at a Glycogen Synthase Kinase 3 Site and Its Downstream "Priming" Site: Phosphorylation Affects Interactions of Protein with Itself and with Major Capsid Protein. J. Virol.
78: 13501-13511
[Abstract]
[Full Text]
-
MEGGIO, F., PINNA, L. A.
(2003). One-thousand-and-one substrates of protein kinase CK2?. FASEB J.
17: 349-368
[Abstract]
[Full Text]