INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Recombination between viral RNA genomes, first discovered in poliovirus (16, 23), is now known to be widespread among animal, plant, and bacterial viruses (reviewed in references 2, 7, 18, 22, and 39). It is generally believed that recombination and other covalent rearrangements in viral RNA genomes, such as deletions and insertions, occur during RNA replication as a result of template switching (17, 19, 26, 36). In the framework of this view, the elongation of a nascent RNA strand may slow down and prematurely terminate, for example, due to stable secondary structure elements (43, 47) or nucleotide misincorporations (32). Then, the dissociated 3' terminus anneals to another template or to another site of the same template, wherein the strand elongation resumes to produce a recombinant molecule. Recent studies of the conditions for the template-switch recombination between viral RNA genomes in cell-free systems (11, 27-29, 41) should greatly facilitate the elucidation of its mechanism(s).

The first indication of the existence of a nonreplicative transesterification mechanism for RNA recombination was recently obtained in the in vitro Q phage system which employed Q phage replicase to detect replicable RNA species generated from nonreplicable RNA fragments (7, 8). The goal of the present study was to assess whether viable recombinant viruses could be generated from nonreplicating and nontranslatable parts of a viral RNA genome. To this end, several pairs of the poliovirus RNA fragments have been designed. In each pair, one of the putative recombination partners lacked a segment encoding the polyprotein and the 3'-untranslated region (3UTR), whereas the other partner possessed lethal modifications in essential translational (and in one case also in replicative) cis elements of the 5'-untranslated region (5UTR). Numerous infectious clones with a variety of crossover points have been recovered after transfections of susceptible cells with mixtures of the noninfectious partners. The results suggest that a nonreplicative mechanism (as opposed to the replicative template-switch mode) might be involved in the generation of the recombinant RNAs in our system.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Construction of the 5' partners. Plasmid pT7PV1 (34) carrying the full-length poliovirus genome was linearized by EcoRI and, after blunting of the termini with the Klenow fragment, was fused to BglII linker(s) (Pharmacia). A segment containing the entire vector sequence, together with the T7 RNA polymerase promoter and 66 5'-terminal poliovirus bases, was excised from this construct by treatment with KpnI and BglII. This segment was fused to one of the three modified versions of the remaining part of the viral 5UTR. To obtain these versions, the pBM1 vector (34) was modified by insertion of two marker mutations (C₄₅₁AG and G₅₅₂AC). Appropriate fragments of mutated pBM1 were prepared by PCR by using sense primer (positions 59 to 79 of the poliovirus RNA) and one of the BglII site-containing antisense primers (GGAGCAGATCTAGCAAACAG [BG], TGAGATCTCACTTTCACCGG [BN], or TAGATCTCTAATGTCTCACTTTCAC [BY]), followed by treatment of the products with KpnI and BglII.

Construction of the 3' partners. Plasmid pBM1 with an additional BalI site (39) was digested with BalI followed by religation. A plasmid with an inverted BalI segment (nucleotides [nt] 635 to 727) was selected, and this inversion was introduced into the full-length viral genome. The inversion resulted in a decrease in the reproductive potential of the virus due to the appearance of two AUGs in the IRES/AUG₇₄₅ spacer (at positions 682' and 653'); a third AUG at position 729 was a result of the introduction of the BalI site (see text above). A large-plaque virus revertant was selected. It contained mutations A_682'G and G_651'U (changing two of the AUGs), as well as A_693'G. cDNA corresponding to the inverted portion of the revertant genome was obtained by reverse transcriptase PCR (RT-PCR), followed by the BalI treatment, and it was used to replace the corresponding segment in the pBM1 modified as described above. TTCCTTTT₅₆₇ was replaced by an oligo(dA) block of identical length to give the PA2 construct. PA2 was treated with BamHI, and fragment with coordinates 226 to 670' was deleted to generate construct BB. The modified 5UTRs were introduced into the full-length viral genomes. The L construct was prepared by ligation of the following three fragments: (i) a fragment containing the T7 promoter and the poliovirus segment with coordinates 101 to 987, generated by PCR with pT7PV1/PA2 (see above) with the sense primer TAATACGACTCACACTATAGGTAACTTAGACGC (T7 promoter and poliovirus sequence 101 to 113) and the antisense primer corresponding to positions 1058 to 1078, followed by digestion with ScaI; (ii) a fragment corresponding to poliovirus positions 988 to 5601, prepared by digestion of pT7PV1 by ScaI and BglII; and (iii) a fragment harboring the 3'-terminal portion of the poliovirus genome and vector sequences, prepared by digestion of pT7PV1 by BamHI, isolation of the appropriate segment, treatment with the Klenow enzyme, and digestion with BglII. The primary structures of all of the modified portions of the 5' and 3' partners were checked by sequencing.

Preparation of transcripts and transfection. For the generation of RNA transcripts, the plasmids were linearized with BglII (5' partners) or EcoRI (3' partners), and the transcription by T7 RNA polymerase was carried out as described earlier (34). The transcripts were purified by sucrose gradient centrifugation (5 to 20%, 4 h, and 40,000 rpm [Beckman SW41 rotor]). Ethanol-precipitated RNA was dissolved in water, and its concentrations were determined spectrophotometrically. DEAE-dextran-mediated transfection of AGMK cells was carried out as described previously (34) by using a mixture of the 5' and 3' fragments (1 µg of each; molar ratio of ~11:1). In some experiments, the fragments were premixed in 40 µl of 100 mM NaCl-10 mM EDTA-0.1% sodium dodecyl sulfate (SDS)-80 mM Tris-HCl (pH 7.5) and heated at 60°C for 10 min, followed by a slow cooling to 37°C and incubation at this temperature for 24 h. The RNA fragments were then twice precipitated with ethanol, redissolved in the same buffer without SDS, and used for transfections as previously described. In some experiments, transfection was carried out by using Lipofectin (Gibco) as recommended by the manufacturer. Partners preannealing and different transfection protocols did not result in any appreciable differences in either frequencies or localization of the crossovers.

Modification of the 5'-transcript termini. For the periodate oxidation, 22 µl of 40 mM NaIO₄ was added to 2 µg of RNA in 18 µl of a buffer (222 mM sodium acetate, pH 5.3; 22 mM EDTA). The mixture was incubated in the dark at room temperature for 30 min. The RNA was ethanol precipitated, washed with 70% ethanol, dried, dissolved in 50 µl of water, and again precipitated with ethanol. The treatment with aniline was performed as follows. First, 100 µl of 0.5 M aniline containing 10 mM sodium acetate (pH 5.0) was added to the RNA preparation dissolved in 100 µl of water. Then, after incubation at room temperature for 120 min in the dark, the RNA was twice precipitated with ethanol. The 3'-phosphorylated 5' partners were prepared as follows. First, 10 µl of a mix containing 4 µg of BN transcript, 0.5 mM (final concentration) pCp, 10 U of RNasin (Pharmacia), 1 mM ATP, and 2.5 U of T4 RNA ligase (Pharmacia) was incubated at 37°C for 60 min. The phosphorylated RNA was then thrice extracted with a phenol-chloroform mixture and twice precipitated with ethanol. The alkaline phosphatase treatment was carried out as described earlier (8), but the incubation was carried out at 37°C in the presence of 1 U of RNasin per µl.

Analysis of recombinant genomes. The material from a plaque was suspended in 1 ml of Earle's saline and subjected to RT-PCR (44) by using oligonucleotide primers corresponding to positions 1058 to 1078 (antisense) and 59 to 79 (sense) of the poliovirus RNA. After purification by agarose electrophoresis, the DNA product was sequenced by using Sequenase v.2.0 (U.S. Biochemicals) according to the manufacturer's protocol but in the presence of 10% dimethyl sulfoxide (33). If the PCR product exhibited heterogeneity, it was treated with KpnI and ScaI, and the 68-to-987 fragment was cloned into pBSM13() pretreated with KpnI and Ecl136II. At least three clones of each fragment were sequenced. The viral RNA was isolated and sequenced as described previously (44) by using avian myeloblastosis virus RT and primers corresponding to positions 744 to 759 and 877 to 894.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Design of the recombination partners. Since the nonreplicative recombination should not necessarily be homologous, the putative partners were designed in such a way that their joining could generate viable genomes even if the recombination was nonhomologous. The crossovers were targeted to a nonessential region of the poliovirus RNA, namely, to the spacer separating the internal ribosome entry site (IRES) from the initiator AUG₇₄₅. The spacer is known to tolerate diverse and profound modifications without significant phenotypic changes (15, 20, 34, 39). The 5' partners donating the leftward part of the putative recombinants were designed to lack the viral protein-coding capacity, whereas the 3' partners, serving as donors of the rightward part, harbored lethal lesions in the essential cis-acting elements of the 5UTR.

View larger version (16K): [in this window] [in a new window]   FIG. 1.   Schematic representation of the recombination partners. Solid lines correspond to segments of the poliovirus genome; the black bar denotes the inverted segment of the viral RNA (its coordinates are shown as n'). Cryptic (position 586) and initiator (position 743) AUG triplets are marked by open and solid stars, respectively. The intact and mutated (i.e., containing an oligoadenylate replacement) oligopyrimidine moieties of the essential OAT element are shown as solid and open diamonds, respectively. The silent marker mutations introduced into the 5' partners at positions 451 and 552 are indicated by black dots. The borders of the essential replicative (oriL) and translational (IRES) elements are given on the scheme of the 5' partners. The coordinates of the 3'-terminal nucleotides and the sequences of nonviral oligonucleotides fused to the 3' ends of the 5' partners, as well as the segments deleted in different 3' partners, are given in the tables. For other details, see the text.

Generation of recombinants and characterization of crossovers. When the transcripts corresponding to the 5' and 3' partners were mixed in pairs and transfected into AGMK cells, plaques were reproducibly developed at days 3 to 6, that is, 1 to 2 days slower than upon transfections with the wild-type transcripts. The yield of recovered viruses varied in different experiments but generally comprised several clones per microgram of the 3' partner (which was present in a 1:11 molar ratio to the 5' partner).

View larger version (33K): [in this window] [in a new window]   FIG. 2.   The location of crossover sites on the 5' partners (A) and 3' partners (B). The composite crossover maps showing the results obtained with different combinations of the partners are presented, but the crossovers downstream of position 648 are given separately for each of the three 5' partners. The crossover sites are denoted either by vertical bars (when the mapping was possible with a single-nucleotide accuracy) or triangles (when there was a short oligonucleotide identity in the recombining regions of the two partners). The nonviral (oligo)nucleotides found between the bodies of the 5' and 3' partners are shown to the right of the vertical bars corresponding to the terminal nucleotides in panel A. The position of the crossover of recombinant o22 on the 3' partner (nt 203 to 204) lies outside the genomic region shown. The UGAAA sequence, a component of the putative cryptic hammerhead ribozyme, is shadowed. The regions of identity in the 5' and 3' partners (positions 568 to 634) are in boldface. The nucleotides in the inverted regions of the 3' partners (positions 635 to 669 in BB and positions 635 to 727 in the PA2 and L partners) are denoted as n'. The regions of the 3' partners supposed to form heteroduplexes with the 5' partners are overlined (the longer overline corresponds to BG, whereas the shorter one corresponds to BN and BY partners). The recombinants obtained with oxidized (as well as oxidized and aniline-treated) or ligated with pCp 5' partners are marked by the prefixes o and p, respectively. The crosses between individual partners yielded the following recombinants: BG × PA2, 1, 3, 5, 8, 15, 21, 25, 31, 32, 35, 36, o3, o4, and o17 to o19; BG × BB, 26, 30, 33, 34, 37, and 38; BG × L, o16; BN × PA2, 2, 4, 6, 10, 11, 17, 22, 23, 27, 28, o1, o2, o5, o6, o8, o10, o13, o24, and o27; BN × BB, 7, 14, 18, 19, 29, and o22; BN × L, 9, 12, 13, o7, o9, o11, o12, o14, o15, o23, o25, o26, o28 to o33, and p1 to p19; BY × PA2, 24 and o20; BY × BB, 20, 39, and 40; BY × L, 16, and o21.

Effects of modification of the 3' end of 5' partners. Chetverin et al. (8) reported that periodate oxidation of the 3' terminus of the 5' partner dramatically suppressed recombination in the Q system. Surprisingly, a similar treatment of the poliovirus RNA-derived 5' partner was accompanied by a severalfold increase rather than decrease in the number of plaques generated and also in some shortening of the time of their appearance (Table 1). Furthermore, the recombinant genomes thus obtained exhibited a remarkable peculiarity. The entire 5' partner was fully incorporated into a significant proportion (more than one-third) of the recombinant genomes (Fig. 2; Table 2). Most of these recombinants contained also a short oligonucleotide insertion between the 3' end of the 5' partner and an internal nucleotide of the 3' partner. Aniline treatment (expected to remove the modified nucleoside and generate a 3'-phosphate terminus), did not markedly affect the recombinogenic properties of the oxidized 5' partners, whereas subsequent dephosphorylation by alkaline phosphatase resulted in an apparent return of the recombination frequency to the values typical of the nonoxidized fragment (Table 1). The generation of recombinants containing the entire 5' partner was also severely suppressed by the latter treatment (Table 2). These data suggested that the "activation" was probably due to generation of a 3'-phosphorylated form of the 5' partner (after elimination of the oxidized nucleoside). In line with this suggestion, essentially similar results (frequent incorporation of the full-length 5' partner, short "foreign" oligonucleotide insertions, and an apparent increase in the recombinogenic potential) were observed when the 3'-phosphate was introduced into the 5' partner by ligating it with pCp (Tables 1 and 2; Fig. 2).

Genetic stability of the recombinants. The recombinant nature of the rescued genomes was unambiguously substantiated in the preceding sections. Most of the crossover sites were identified by sequencing of the viral RNA species isolated from individual plaques. Eighteen recombinant viruses isolated from the plaques were subjected to two additional passages in vitro. Sequencing of the relevant regions of the viral RNAs isolated from 15 viruses demonstrated their complete identity to the plaque-derived material. The genomes of three viruses showed some heterogeneity. They were subjected to two further passages and plaque cloning. The heterogeneity was traced to the variability of the length of the oligoadenylate tract introduced into the PA2 and L 3' partners. The number of A residues varied in the range of 9 to 15, but no other changes, compared to the material from the primary plaques, could be detected. Thus, the recombinants proved to be genetically stable, at least under the conditions tested.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Nonreplicative recombination versus template switch. Numerous viable recombinants between noninfectious fragments of the poliovirus RNA were identified here. The recombination partners were designed to be unable to direct the synthesis of any viral proteins (RNA polymerase included) unless they are fused to each other. One may argue that the 3' partners with the intact open reading frame could have been translated, though inefficiently, thus producing the viral RNA polymerase. Hence, the generation of infectious progeny could have been a result of replicative recombination between the newly synthesized minus strand and the 5' partner. Were it so, the PA2 RNA, being full length, should be quasi-infectious. Indeed, it could have been readily converted into a viable form by a single extended deletion similar to those that occurred upon the pseudoreversion of pPV1/8 (15, 34). The PA2 transcript, however, proved to be completely dead in numerous appropriate assays, suggesting that this RNA was practically devoid of translation template activity. We consider this a strong argument for the notion that the recombinants have been generated by a mechanism other than the replicative template switch. There are also several other lines of indirect evidence against the template switch as the main cause of the recombination in our system. (i) The recombination "hot spots" did not preferentially map to regions of identity in the partners. (ii) The inverted segment of the 3' partners presumed to form heteroduplexes with the 5' partners contained very few crossover sites, whereas the heteroduplex-mediated template-switch mechanism predicted that such regions should be enriched in crossovers (25). It may be added that the crossovers within region 669' to 649' of the 3' partners (e.g., 20, o13, p3, etc.) were only observed with the shorter (BN or BY) 5' partner, which could not hybridize to that region. (iii) The entire 5' partner was preserved in a significant proportion of the recombinants. Having no complementarity to the 3' ends of the putative nascent negative strands (given the unlikely possibility that such strands could have been transcribed from the 3' partner prior to the recombination event), the 5' partner could hardly serve as an accepting template. (iv) The preservation (and even a significant enhancement) of the recombinogenic potential of the 5' partners upon the oxidation or phosphorylation of their 3' termini argues strongly against the possible use of these termini as primers for the synthesis of the positive strands (again under the unlikely assumption that the negative strands could somehow have already been generated). Moreover, this fact is difficult to reconcile with any template-switch mechanism.

Possible nonreplicative mechanisms of RNA recombination. A nonreplicative mode of recombination implies that recombining RNAs are cleaved at some points and the exposed termini are cross-ligated. There are two known enzyme-catalyzed chemical mechanisms, differing by the nature of the cleavage products, that can result in such RNA rearrangements. According to one mechanism, phosphodiester bonds are attacked by an external nucleophile (e.g., a water molecule) which exposes the 3'-hydroxyl and 5'-phosphate termini. Such termini can then be cross-ligated in a way that requires an activation (e.g., adenylylation) of the 5'-phosphate group (1). Alternatively, a direct transesterification reaction can occur in which the 3'-hydroxyl attacks a phosphodiester bond within an uncleaved partner molecule (6). The second mechanism of cleavage of putative partners of nonreplicative recombination includes an attack of a phosphodiester bond by the adjacent 2'-hydroxyl which plays the role of an internal nucleophile; this results in the 2',3'-cyclic phosphate and 5'-hydroxyl termini. Such termini can be cross-ligated in a transesterification reaction which is chemically equivalent to the reversal of the RNA cleavage (24, 46).

Possible contribution of cryptic ribozyme activities. Sequencing of the recombinant genomes has revealed several clusters of crossover sites (Fig. 2), suggesting that these sites are more reactive than others. The elevated reactivity might be due to a higher rate of RNA cleavage, a higher rate of ligation of the exposed termini, or both. Interestingly, some of the corresponding RNA segments can be folded into secondary structures similar to known ribozyme motifs.

View larger version (24K): [in this window] [in a new window]   FIG. 3.   A model invoking the involvement of a hammerhead-like ribozyme activity in the origin of a specific hot spot of crossover sites on the 5' partners. (A) The conserved nucleotides (boxed) and the consensus structure of hammerhead ribozymes. R, Y, and H represent a purine, pyrimidine, or any nucleotide except G, respectively. The cleavage site is shown by the arrow. (B) A hypothetical folding of the 5' partner, generating a consensus hammerhead ribozyme annealed to a segment of the 3' partner.

Incorporation of the entire 5' partner. The mechanism of generation of recombinants containing the full 5' partner in the present system appeared to be fundamentally different from that operating in the experiments of Chetverin et al. (8), since the oxidation (phosphorylation) of the 5' partner resulted in the activation or suppression of its recombinogenic potential in these two systems, respectively. In the present study, the incorporation of the entire 5' partner was usually accompanied by the appearance of nonviral oligonucleotides between the bodies of the 5' and 3' segments. These "foreign inserts" were most likely generated during the preparation of transcripts with T7 RNA polymerase. The enzyme is known to produce, during runoff transcription in vitro, variable extensions showing complementarity to regions near the 3' end of the correct transcript (resulting from self-priming) (45). Nearly all of the insertions observed in our recombinants did exhibit such a complementarity (Fig. 4).

View larger version (18K): [in this window] [in a new window]   FIG. 4.   A model explaining incorporation of the full-length 5' partner into the recombinant genomes. Foreign insertions, assumed to be added by T7 RNA polymerase, are shaded. Putative reacting nucleotides are boxed. The 3'-terminal nucleotide of the 5' partner is assumed to possess the 2',3'-cyclic phosphate group.

Biological significance. The existence of nonreplicative mechanisms of RNA recombination should not be interpreted to mean the negation of the template switch mode. Moreover, it is likely that the overwhelming majority of cases of homologous RNA recombination have been due to the replicative mechanisms, as suggested by the character and distribution of crossover sites and other evidence (see references 2, 12, 13, 19, 26, 29, and 47).