This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gmyl, A. P.
Right arrow Articles by Agol, V. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gmyl, A. P.
Right arrow Articles by Agol, V. I.

 Previous Article  |  Next Article 

Journal of Virology, November 1999, p. 8958-8965, Vol. 73, No. 11
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Nonreplicative RNA Recombination in Poliovirus

Anatoly P. Gmyl,1 Evgeny V. Belousov,1,2 Svetlana V. Maslova,1 Elena V. Khitrina,1 Alexander B. Chetverin,3 and Vadim I. Agol1,2,*

Institute of Poliomyelitis and Viral Encephalitides, Russian Academy of Medical Sciences, Moscow Region 142782,1 Moscow State University, Moscow 119899,2 and Institute of Protein Research, Russian Academy of Sciences, Pushchino, Moscow Region 142292,3 Russia

Received 7 April 1999/Accepted 23 July 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Current models of recombination between viral RNAs are based on replicative template-switch mechanisms. The existence of nonreplicative RNA recombination in poliovirus is demonstrated in the present study by the rescue of viable viruses after cotransfections with different pairs of genomic RNA fragments with suppressed translatable and replicating capacities. Approximately 100 distinct recombinant genomes have been identified. The majority of crossovers occurred between nonhomologous segments of the partners and might have resulted from transesterification reactions, not necessarily involving an enzymatic activity. Some of the crossover loci are clustered. The origin of some of these "hot spots" could be explained by invoking structures similar to known ribozymes. A significant proportion of recombinant RNAs contained the entire 5' partner, if its 3' end was oxidized or phosphorylated prior to being mixed with the 3' partner. All of these observations are consistent with a mechanism that involves intermediary formation of the 2',3'-cyclic phosphate and 5'-hydroxyl termini. It is proposed that nonreplicative RNA recombination may contribute to evolutionarily significant RNA rearrangements.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Recombination between viral RNA genomes, first discovered in poliovirus (16, 23), is now known to be widespread among animal, plant, and bacterial viruses (reviewed in references 2, 7, 18, 22, and 39). It is generally believed that recombination and other covalent rearrangements in viral RNA genomes, such as deletions and insertions, occur during RNA replication as a result of template switching (17, 19, 26, 36). In the framework of this view, the elongation of a nascent RNA strand may slow down and prematurely terminate, for example, due to stable secondary structure elements (43, 47) or nucleotide misincorporations (32). Then, the dissociated 3' terminus anneals to another template or to another site of the same template, wherein the strand elongation resumes to produce a recombinant molecule. Recent studies of the conditions for the template-switch recombination between viral RNA genomes in cell-free systems (11, 27-29, 41) should greatly facilitate the elucidation of its mechanism(s).

The first indication of the existence of a nonreplicative transesterification mechanism for RNA recombination was recently obtained in the in vitro Qbeta phage system which employed Qbeta phage replicase to detect replicable RNA species generated from nonreplicable RNA fragments (7, 8). The goal of the present study was to assess whether viable recombinant viruses could be generated from nonreplicating and nontranslatable parts of a viral RNA genome. To this end, several pairs of the poliovirus RNA fragments have been designed. In each pair, one of the putative recombination partners lacked a segment encoding the polyprotein and the 3'-untranslated region (3UTR), whereas the other partner possessed lethal modifications in essential translational (and in one case also in replicative) cis elements of the 5'-untranslated region (5UTR). Numerous infectious clones with a variety of crossover points have been recovered after transfections of susceptible cells with mixtures of the noninfectious partners. The results suggest that a nonreplicative mechanism (as opposed to the replicative template-switch mode) might be involved in the generation of the recombinant RNAs in our system.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Construction of the 5' partners. Plasmid pT7PV1 (34) carrying the full-length poliovirus genome was linearized by EcoRI and, after blunting of the termini with the Klenow fragment, was fused to BglII linker(s) (Pharmacia). A segment containing the entire vector sequence, together with the T7 RNA polymerase promoter and 66 5'-terminal poliovirus bases, was excised from this construct by treatment with KpnI and BglII. This segment was fused to one of the three modified versions of the remaining part of the viral 5UTR. To obtain these versions, the pBM1 vector (34) was modified by insertion of two marker mutations (C451right-arrowAG and G552right-arrowAC). Appropriate fragments of mutated pBM1 were prepared by PCR by using sense primer (positions 59 to 79 of the poliovirus RNA) and one of the BglII site-containing antisense primers (GGAGCAGATCTAGCAAACAG [BG], TGAGATCTCACTTTCACCGG [BN], or TAGATCTCTAATGTCTCACTTTCAC [BY]), followed by treatment of the products with KpnI and BglII.

Construction of the 3' partners. Plasmid pBM1 with an additional BalI site (39) was digested with BalI followed by religation. A plasmid with an inverted BalI segment (nucleotides [nt] 635 to 727) was selected, and this inversion was introduced into the full-length viral genome. The inversion resulted in a decrease in the reproductive potential of the virus due to the appearance of two AUGs in the IRES/AUG745 spacer (at positions 682' and 653'); a third AUG at position 729 was a result of the introduction of the BalI site (see text above). A large-plaque virus revertant was selected. It contained mutations A682'right-arrowG and G651'right-arrowU (changing two of the AUGs), as well as A693'right-arrowG. cDNA corresponding to the inverted portion of the revertant genome was obtained by reverse transcriptase PCR (RT-PCR), followed by the BalI treatment, and it was used to replace the corresponding segment in the pBM1 modified as described above. TTCCTTTT567 was replaced by an oligo(dA) block of identical length to give the PA2 construct. PA2 was treated with BamHI, and fragment with coordinates 226 to 670' was deleted to generate construct Delta BB. The modified 5UTRs were introduced into the full-length viral genomes. The Delta L construct was prepared by ligation of the following three fragments: (i) a fragment containing the T7 promoter and the poliovirus segment with coordinates 101 to 987, generated by PCR with pT7PV1/PA2 (see above) with the sense primer TAATACGACTCACACTATAGGTAACTTAGACGC (T7 promoter and poliovirus sequence 101 to 113) and the antisense primer corresponding to positions 1058 to 1078, followed by digestion with ScaI; (ii) a fragment corresponding to poliovirus positions 988 to 5601, prepared by digestion of pT7PV1 by ScaI and BglII; and (iii) a fragment harboring the 3'-terminal portion of the poliovirus genome and vector sequences, prepared by digestion of pT7PV1 by BamHI, isolation of the appropriate segment, treatment with the Klenow enzyme, and digestion with BglII. The primary structures of all of the modified portions of the 5' and 3' partners were checked by sequencing.

Preparation of transcripts and transfection. For the generation of RNA transcripts, the plasmids were linearized with BglII (5' partners) or EcoRI (3' partners), and the transcription by T7 RNA polymerase was carried out as described earlier (34). The transcripts were purified by sucrose gradient centrifugation (5 to 20%, 4 h, and 40,000 rpm [Beckman SW41 rotor]). Ethanol-precipitated RNA was dissolved in water, and its concentrations were determined spectrophotometrically. DEAE-dextran-mediated transfection of AGMK cells was carried out as described previously (34) by using a mixture of the 5' and 3' fragments (1 µg of each; molar ratio of ~11:1). In some experiments, the fragments were premixed in 40 µl of 100 mM NaCl-10 mM EDTA-0.1% sodium dodecyl sulfate (SDS)-80 mM Tris-HCl (pH 7.5) and heated at 60°C for 10 min, followed by a slow cooling to 37°C and incubation at this temperature for 24 h. The RNA fragments were then twice precipitated with ethanol, redissolved in the same buffer without SDS, and used for transfections as previously described. In some experiments, transfection was carried out by using Lipofectin (Gibco) as recommended by the manufacturer. Partners preannealing and different transfection protocols did not result in any appreciable differences in either frequencies or localization of the crossovers.

Modification of the 5'-transcript termini. For the periodate oxidation, 22 µl of 40 mM NaIO4 was added to 2 µg of RNA in 18 µl of a buffer (222 mM sodium acetate, pH 5.3; 22 mM EDTA). The mixture was incubated in the dark at room temperature for 30 min. The RNA was ethanol precipitated, washed with 70% ethanol, dried, dissolved in 50 µl of water, and again precipitated with ethanol. The treatment with aniline was performed as follows. First, 100 µl of 0.5 M aniline containing 10 mM sodium acetate (pH 5.0) was added to the RNA preparation dissolved in 100 µl of water. Then, after incubation at room temperature for 120 min in the dark, the RNA was twice precipitated with ethanol. The 3'-phosphorylated 5' partners were prepared as follows. First, 10 µl of a mix containing 4 µg of BN transcript, 0.5 mM (final concentration) pCp, 10 U of RNasin (Pharmacia), 1 mM ATP, and 2.5 U of T4 RNA ligase (Pharmacia) was incubated at 37°C for 60 min. The phosphorylated RNA was then thrice extracted with a phenol-chloroform mixture and twice precipitated with ethanol. The alkaline phosphatase treatment was carried out as described earlier (8), but the incubation was carried out at 37°C in the presence of 1 U of RNasin per µl.

Analysis of recombinant genomes. The material from a plaque was suspended in 1 ml of Earle's saline and subjected to RT-PCR (44) by using oligonucleotide primers corresponding to positions 1058 to 1078 (antisense) and 59 to 79 (sense) of the poliovirus RNA. After purification by agarose electrophoresis, the DNA product was sequenced by using Sequenase v.2.0 (U.S. Biochemicals) according to the manufacturer's protocol but in the presence of 10% dimethyl sulfoxide (33). If the PCR product exhibited heterogeneity, it was treated with KpnI and ScaI, and the 68-to-987 fragment was cloned into pBSM13(-) pretreated with KpnI and Ecl136II. At least three clones of each fragment were sequenced. The viral RNA was isolated and sequenced as described previously (44) by using avian myeloblastosis virus RT and primers corresponding to positions 744 to 759 and 877 to 894.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Design of the recombination partners. Since the nonreplicative recombination should not necessarily be homologous, the putative partners were designed in such a way that their joining could generate viable genomes even if the recombination was nonhomologous. The crossovers were targeted to a nonessential region of the poliovirus RNA, namely, to the spacer separating the internal ribosome entry site (IRES) from the initiator AUG745. The spacer is known to tolerate diverse and profound modifications without significant phenotypic changes (15, 20, 34, 39). The 5' partners donating the leftward part of the putative recombinants were designed to lack the viral protein-coding capacity, whereas the 3' partners, serving as donors of the rightward part, harbored lethal lesions in the essential cis-acting elements of the 5UTR.

The recombination partners used in this study are schematically depicted in Fig. 1. All the three 5' partners were composed of a truncated portion of the 5UTR retaining all of its essential replicative and translational cis elements. They had a trimmed spacer (somewhat varying in length) that separates the IRES and the initiator AUG745. The constructs ended with different short nonviral oligonucleotides. Finally, the leftward partners contained two marker mutations at positions 451 and 552, which did not affect the viral phenotype (not shown).


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1.   Schematic representation of the recombination partners. Solid lines correspond to segments of the poliovirus genome; the black bar denotes the inverted segment of the viral RNA (its coordinates are shown as n'). Cryptic (position 586) and initiator (position 743) AUG triplets are marked by open and solid stars, respectively. The intact and mutated (i.e., containing an oligoadenylate replacement) oligopyrimidine moieties of the essential OAT element are shown as solid and open diamonds, respectively. The silent marker mutations introduced into the 5' partners at positions 451 and 552 are indicated by black dots. The borders of the essential replicative (oriL) and translational (IRES) elements are given on the scheme of the 5' partners. The coordinates of the 3'-terminal nucleotides and the sequences of nonviral oligonucleotides fused to the 3' ends of the 5' partners, as well as the segments deleted in different 3' partners, are given in the tables. For other details, see the text.

On the other hand, the polyprotein reading frame and the 3'-terminal replicative element oriR (35), as well as the poly(A) stretch, were preserved in the 3' partners, but one or more of the essential cis-acting elements of their 5UTR were either deleted or mutated. The Delta BB construct lacked the entire IRES, as well as the adjoining oligopyrimidine-AUG tandem (OAT), an element essential for the cap-independent internal initiation of poliovirus RNA translation (30, 31, 34). In the PA2 RNA, the oligopyrimidine moiety of OAT was inactivated by converting UUCCUUUU567 into an (A)8 stretch, a change resulting in a lethal phenotype and an apparently complete suppression of the in vitro translational template activity of the poliovirus RNA (not shown). The same OAT-inactivating mutation was introduced also into Delta L RNA, but this construct also lacked 100 5'-terminal nucleotides corresponding to the essential replicative "clover-leaf" element oriL (3). Furthermore, portions of the IRES/AUG745 spacer (positions 635 to 669 in Delta BB or positions 635 to 727 in PA2 and Delta L) in the 3' partners were inverted to facilitate generation of heteroduplexes with the 5' partners.

None of the six RNA constructs shown in Fig. 1 could by themselves generate any detectable infectious progeny when introduced into primary African green monkey kidney (AGMK) cell cultures by using the DEAE-dextran or Lipofectin transfection techniques. When the poliovirus 5UTR with the OAT modified as in constructs PA2 and Delta L was fused to the luciferase gene and the HeLa cells were transfected with the resulting construct, no luminescence above the background level was generated (not shown).

Generation of recombinants and characterization of crossovers. When the transcripts corresponding to the 5' and 3' partners were mixed in pairs and transfected into AGMK cells, plaques were reproducibly developed at days 3 to 6, that is, 1 to 2 days slower than upon transfections with the wild-type transcripts. The yield of recovered viruses varied in different experiments but generally comprised several clones per microgram of the 3' partner (which was present in a 1:11 molar ratio to the 5' partner).

The relevant regions of the 5UTR (~250 nt upstream of the initiator AUG745) of the viral RNA isolated from the plaques were sequenced. The overwhelming majority of the sequenced genomes corresponded to distinct recombinants (Fig. 2). The recombinant nature of the RNAs was unambiguously demonstrated by the simultaneous presence of the sequences uniquely donated by a 3' partner and those originating from a 5' partner. All the recombinants but one retained the two silent mutations that tag positions 452 and 552 of the 5' partners. The only exception concerned recombinant o8 retaining the latter but not the former tags. Most likely, this was a result of more than one recombination event.


View larger version (33K):
[in this window]
[in a new window]
 
FIG. 2.   The location of crossover sites on the 5' partners (A) and 3' partners (B). The composite crossover maps showing the results obtained with different combinations of the partners are presented, but the crossovers downstream of position 648 are given separately for each of the three 5' partners. The crossover sites are denoted either by vertical bars (when the mapping was possible with a single-nucleotide accuracy) or triangles (when there was a short oligonucleotide identity in the recombining regions of the two partners). The nonviral (oligo)nucleotides found between the bodies of the 5' and 3' partners are shown to the right of the vertical bars corresponding to the terminal nucleotides in panel A. The position of the crossover of recombinant o22 on the 3' partner (nt 203 to 204) lies outside the genomic region shown. The UGAAA sequence, a component of the putative cryptic hammerhead ribozyme, is shadowed. The regions of identity in the 5' and 3' partners (positions 568 to 634) are in boldface. The nucleotides in the inverted regions of the 3' partners (positions 635 to 669 in Delta BB and positions 635 to 727 in the PA2 and Delta L partners) are denoted as n'. The regions of the 3' partners supposed to form heteroduplexes with the 5' partners are overlined (the longer overline corresponds to BG, whereas the shorter one corresponds to BN and BY partners). The recombinants obtained with oxidized (as well as oxidized and aniline-treated) or ligated with pCp 5' partners are marked by the prefixes o and p, respectively. The crosses between individual partners yielded the following recombinants: BG × PA2, 1, 3, 5, 8, 15, 21, 25, 31, 32, 35, 36, o3, o4, and o17 to o19; BG × Delta BB, 26, 30, 33, 34, 37, and 38; BG × Delta L, o16; BN × PA2, 2, 4, 6, 10, 11, 17, 22, 23, 27, 28, o1, o2, o5, o6, o8, o10, o13, o24, and o27; BN × Delta BB, 7, 14, 18, 19, 29, and o22; BN × Delta L, 9, 12, 13, o7, o9, o11, o12, o14, o15, o23, o25, o26, o28 to o33, and p1 to p19; BY × PA2, 24 and o20; BY × Delta BB, 20, 39, and 40; BY × Delta L, 16, and o21.

The crossover points were distributed over ~110- and ~220-nt segments in the 5' and 3' partners, respectively, all but a few mapping to the IRES/AUG745 spacer. There appeared to be several clusters ("hot spots") of crossovers in both partners (Fig. 2). When several recombinants had identical crossover sites on the 5' partner, their crossover sites on the 3' partner often differed and vice versa. In most cases, the location of crossovers could be determined with a high precision, since the length of the identical oligonucleotide stretches in the crossover regions of two recombining partners varied from 0 to 7 nt, being predominantly equal to 0 to 2 nt. In a small subset of recombinants (altogether, 14 of 105 sequenced), the crossovers occurred within a 67-nt region shared by the both partners (positions 568 to 634). The precise mapping of crossovers in these cases was impossible, and such recombinants are not shown in Fig. 2.

Effects of modification of the 3' end of 5' partners. Chetverin et al. (8) reported that periodate oxidation of the 3' terminus of the 5' partner dramatically suppressed recombination in the Qbeta system. Surprisingly, a similar treatment of the poliovirus RNA-derived 5' partner was accompanied by a severalfold increase rather than decrease in the number of plaques generated and also in some shortening of the time of their appearance (Table 1). Furthermore, the recombinant genomes thus obtained exhibited a remarkable peculiarity. The entire 5' partner was fully incorporated into a significant proportion (more than one-third) of the recombinant genomes (Fig. 2; Table 2). Most of these recombinants contained also a short oligonucleotide insertion between the 3' end of the 5' partner and an internal nucleotide of the 3' partner. Aniline treatment (expected to remove the modified nucleoside and generate a 3'-phosphate terminus), did not markedly affect the recombinogenic properties of the oxidized 5' partners, whereas subsequent dephosphorylation by alkaline phosphatase resulted in an apparent return of the recombination frequency to the values typical of the nonoxidized fragment (Table 1). The generation of recombinants containing the entire 5' partner was also severely suppressed by the latter treatment (Table 2). These data suggested that the "activation" was probably due to generation of a 3'-phosphorylated form of the 5' partner (after elimination of the oxidized nucleoside). In line with this suggestion, essentially similar results (frequent incorporation of the full-length 5' partner, short "foreign" oligonucleotide insertions, and an apparent increase in the recombinogenic potential) were observed when the 3'-phosphate was introduced into the 5' partner by ligating it with pCp (Tables 1 and 2; Fig. 2).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Effects of modifications of the 5' partner's 3' end on recombinationa


                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Effects of modifications of the 5' partner's 3' end on incorporation of the full-length 5' partners into recombinant genomesa

Genetic stability of the recombinants. The recombinant nature of the rescued genomes was unambiguously substantiated in the preceding sections. Most of the crossover sites were identified by sequencing of the viral RNA species isolated from individual plaques. Eighteen recombinant viruses isolated from the plaques were subjected to two additional passages in vitro. Sequencing of the relevant regions of the viral RNAs isolated from 15 viruses demonstrated their complete identity to the plaque-derived material. The genomes of three viruses showed some heterogeneity. They were subjected to two further passages and plaque cloning. The heterogeneity was traced to the variability of the length of the oligoadenylate tract introduced into the PA2 and Delta L 3' partners. The number of A residues varied in the range of 9 to 15, but no other changes, compared to the material from the primary plaques, could be detected. Thus, the recombinants proved to be genetically stable, at least under the conditions tested.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Nonreplicative recombination versus template switch. Numerous viable recombinants between noninfectious fragments of the poliovirus RNA were identified here. The recombination partners were designed to be unable to direct the synthesis of any viral proteins (RNA polymerase included) unless they are fused to each other. One may argue that the 3' partners with the intact open reading frame could have been translated, though inefficiently, thus producing the viral RNA polymerase. Hence, the generation of infectious progeny could have been a result of replicative recombination between the newly synthesized minus strand and the 5' partner. Were it so, the PA2 RNA, being full length, should be quasi-infectious. Indeed, it could have been readily converted into a viable form by a single extended deletion similar to those that occurred upon the pseudoreversion of pPV1/Delta 8 (15, 34). The PA2 transcript, however, proved to be completely dead in numerous appropriate assays, suggesting that this RNA was practically devoid of translation template activity. We consider this a strong argument for the notion that the recombinants have been generated by a mechanism other than the replicative template switch. There are also several other lines of indirect evidence against the template switch as the main cause of the recombination in our system. (i) The recombination "hot spots" did not preferentially map to regions of identity in the partners. (ii) The inverted segment of the 3' partners presumed to form heteroduplexes with the 5' partners contained very few crossover sites, whereas the heteroduplex-mediated template-switch mechanism predicted that such regions should be enriched in crossovers (25). It may be added that the crossovers within region 669' to 649' of the 3' partners (e.g., 20, o13, p3, etc.) were only observed with the shorter (BN or BY) 5' partner, which could not hybridize to that region. (iii) The entire 5' partner was preserved in a significant proportion of the recombinants. Having no complementarity to the 3' ends of the putative nascent negative strands (given the unlikely possibility that such strands could have been transcribed from the 3' partner prior to the recombination event), the 5' partner could hardly serve as an accepting template. (iv) The preservation (and even a significant enhancement) of the recombinogenic potential of the 5' partners upon the oxidation or phosphorylation of their 3' termini argues strongly against the possible use of these termini as primers for the synthesis of the positive strands (again under the unlikely assumption that the negative strands could somehow have already been generated). Moreover, this fact is difficult to reconcile with any template-switch mechanism.

The existing data do not allow us to discriminate between the extracellular and intracellular origin of the nonreplicative recombinants. Nor can it be ruled out that a certain proportion of recombinants (e.g., those with identical or similar sequences in the crossover regions of the both partners) could have arisen through secondary intermolecular or intramolecular template-switching involving primary nonreplicative recombinants. This could have occurred when the primary recombination had generated viruses with a low level of fitness. Generation of unfit viruses seemed unlikely for the recombinants with the primary crossover sites within the IRES/AUG745 spacer because this spacer is known to be nonessential and highly promiscuous with regard to the primary structure (15, 20, 34, 39). However, primary recombination events could have also involved more upstream sites. In such cases, the recombination might result in viruses with a reproductive potential lowered for a variety of reasons (e.g., an AUG between the IRES and the initiator codon, excessive secondary structure, or genome length, etc.). As a consequence, the restoration of viral fitness could have resulted from a secondary template-switch recombination accompanied by the deletion of a deleterious genomic segment.

Thus, we conclude that at least the majority of the recombinants described here were generated by reactions other than template switching.

Possible nonreplicative mechanisms of RNA recombination. A nonreplicative mode of recombination implies that recombining RNAs are cleaved at some points and the exposed termini are cross-ligated. There are two known enzyme-catalyzed chemical mechanisms, differing by the nature of the cleavage products, that can result in such RNA rearrangements. According to one mechanism, phosphodiester bonds are attacked by an external nucleophile (e.g., a water molecule) which exposes the 3'-hydroxyl and 5'-phosphate termini. Such termini can then be cross-ligated in a way that requires an activation (e.g., adenylylation) of the 5'-phosphate group (1). Alternatively, a direct transesterification reaction can occur in which the 3'-hydroxyl attacks a phosphodiester bond within an uncleaved partner molecule (6). The second mechanism of cleavage of putative partners of nonreplicative recombination includes an attack of a phosphodiester bond by the adjacent 2'-hydroxyl which plays the role of an internal nucleophile; this results in the 2',3'-cyclic phosphate and 5'-hydroxyl termini. Such termini can be cross-ligated in a transesterification reaction which is chemically equivalent to the reversal of the RNA cleavage (24, 46).

Chetverin et al. (8) reported that, in the presence of Qbeta replicase and no other enzyme, the 5' partner was entirely incorporated into a recombinant molecule if it possessed hydroxyls at the 3' end. This finding suggested that RNA recombination occurred by a direct attack of the 3'-hydroxyl at internucleotide bonds within the 3' partner. The presence of Qbeta replicase was essential for this reaction to occur (9). In the experiments reported here, the transcriptionally generated 5' partners possessed free 3'-hydroxyls, but the entire 5' partner was never observed to be incorporated into the recombinants unless its 3' terminus was modified. Thus, the first mechanism apparently was not operating in our system.

The second mechanism, involving the 2',3'-cyclic phosphate and 5'-hydroxyl termini, might operate provided that appropriate ribonucleases and ligases were available in the transfected cells. It is also possible that the second mechanism could operate without any enzyme. Of course, recombination requires that the generated 2',3'-cyclic phosphate and 5'-hydroxyl termini belonging to different partners should be ligated and, hence, that they should be brought into a close proximity to each other in one of several possible RNA foldings.

Possible contribution of cryptic ribozyme activities. Sequencing of the recombinant genomes has revealed several clusters of crossover sites (Fig. 2), suggesting that these sites are more reactive than others. The elevated reactivity might be due to a higher rate of RNA cleavage, a higher rate of ligation of the exposed termini, or both. Interestingly, some of the corresponding RNA segments can be folded into secondary structures similar to known ribozyme motifs.

One of these clusters is located on the 5' partners ca. 12 nt downstream of a UGAAA sequence (Fig. 2). It is possible to draw structures corresponding to the consensus hammerhead ribozyme (Fig. 3A; reference 5) by base-pairing of a segment surrounding this sequence to another region of the same or an identical molecule (Fig. 3B). These structures, if formed, might well exhibit enzymatic properties characteristic of hammerhead ribozymes, generating 2',3'-cyclic phosphate termini corresponding to some of the observed crossover sites on the 5' partner. Recombination requires, of course, one more cleavage generating a counterpart 5'-hydroxyl terminus at the other partner. Although the existing data do not allow us to draw ribozyme-like structures for the counterparts, it is clear that an increased production of either of the termini to be ligated would result in the overall recombination enhancement.


View larger version (24K):
[in this window]
[in a new window]
 
FIG. 3.   A model invoking the involvement of a hammerhead-like ribozyme activity in the origin of a specific hot spot of crossover sites on the 5' partners. (A) The conserved nucleotides (boxed) and the consensus structure of hammerhead ribozymes. R, Y, and H represent a purine, pyrimidine, or any nucleotide except G, respectively. The cleavage site is shown by the arrow. (B) A hypothetical folding of the 5' partner, generating a consensus hammerhead ribozyme annealed to a segment of the 3' partner.

In many of the above cases, more or less stable heteroduplexes could be drawn in which the putative 5'-hydroxyl of the 3' partner and the 2',3'-cyclic phosphate on the 5' partner are juxtaposed by base-pairing the corresponding RNA segments to a complementary "guiding" sequence (not shown). Formation of such structures is a prerequisite for efficient RNA ligation by a number of protein or ribozyme catalysts (4, 10, 21, 37, 42).

It is obvious that active ribozyme structures able to cleave and ligate RNA molecules, if they do not serve specific purposes, as in small plant pathogenic RNAs (40) or hepatitis delta  virus (42), should be selected against during viral evolution. However, if the activity could only be expressed in a negligible proportion of the viral genomes, it may persist unnoticed by the negative selection mechanisms. In this sense, the cryptic ribozyme activities proposed above appear to be biologically neutral.

Incorporation of the entire 5' partner. The mechanism of generation of recombinants containing the full 5' partner in the present system appeared to be fundamentally different from that operating in the experiments of Chetverin et al. (8), since the oxidation (phosphorylation) of the 5' partner resulted in the activation or suppression of its recombinogenic potential in these two systems, respectively. In the present study, the incorporation of the entire 5' partner was usually accompanied by the appearance of nonviral oligonucleotides between the bodies of the 5' and 3' segments. These "foreign inserts" were most likely generated during the preparation of transcripts with T7 RNA polymerase. The enzyme is known to produce, during runoff transcription in vitro, variable extensions showing complementarity to regions near the 3' end of the correct transcript (resulting from self-priming) (45). Nearly all of the insertions observed in our recombinants did exhibit such a complementarity (Fig. 4).


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 4.   A model explaining incorporation of the full-length 5' partner into the recombinant genomes. Foreign insertions, assumed to be added by T7 RNA polymerase, are shaded. Putative reacting nucleotides are boxed. The 3'-terminal nucleotide of the 5' partner is assumed to possess the 2',3'-cyclic phosphate group.

Since the consequences of phosphorylation and oxidation of the 5' partners were the same (a significant increase in the recombinogenic potential and generation of recombinant RNAs containing the entire 5' fragment), we assumed that the chemical natures of the molecules involved were also identical, being represented by a 3'-phosphorylated 5' partner (for the oxidized molecule, this could be a result of elimination of the oxidized nucleoside due to its reaction with cellular amines).

It is difficult to imaging how the 3' phosphate group could by itself accelerate the joining of the 5' partner to the 3' partner. However, the cellular RNA 3'-terminal phosphate cyclase (14) could convert this group into the 2',3'-cyclic phosphate, which could then react with the exposed 5'-hydroxyl of a cleaved 3' partner, provided that the reacting groups happen to be next to each other. Importantly, in many cases these groups could have been brought into proximity to one another in putative heteroduplex intermediates involving the 3' and 5' partners (Fig. 4). It may be added that 3'-phosphorylated and 5'-hydroxyl-terminated viral RNA fragments can certainly be generated within the infected cell as a result of nucleolytic degradation. Therefore, the mechanism described above might well be operating upon natural viral infections.

Biological significance. The existence of nonreplicative mechanisms of RNA recombination should not be interpreted to mean the negation of the template switch mode. Moreover, it is likely that the overwhelming majority of cases of homologous RNA recombination have been due to the replicative mechanisms, as suggested by the character and distribution of crossover sites and other evidence (see references 2, 12, 13, 19, 26, 29, and 47).

However, under certain conditions, nonreplicative joining of RNA fragments may occur. Such events, though very rare, may be of extreme evolutionary importance because they may result in the generation of novel genomes from otherwise incompatible parents. Moreover, such nonreplicative rearrangements may occur in cellular RNA as well and could be fixed by reverse transcription.


    ACKNOWLEDGMENTS

This study was supported in part by grants from the Russian Foundation for Basic Research, International Association for the Promotion of Co-operation with Scientists from the New Independent States of the Former Soviet Union (INTAS), and Swiss National Science Foundation. A.B.C. is an International Research Scholar of the Howard Hughes Medical Institute, and V.I.A. is a Soros Professor.


    FOOTNOTES

* Corresponding author. Mailing address: Institute of Poliomyelitis, Russian Academy of Medical Sciences, Moscow Region 142782, Russia. Phone: (95) 439-90-26. Fax: (95) 439-93-21. E-mail: viago{at}ipive.genebee.msu.su.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Adams, R. L. P., J. T. Knowler, and D. P. Leader. 1986. The biochemistry of the nucleic acids, 10th ed. Chapman and Hall, London, England.
2. Agol, V. I. 1997. Recombination and other genomic rearrangements in picornaviruses. Semin. Virol. 8:1-9.
3. Andino, R., G. E. Rieckhof, and D. Baltimore. 1990. A functional ribonucleoprotein complex forms around the 5' end of poliovirus RNA. Cell 63:369-380[Medline].
4. Baumstark, T., A. R. W. Schroder, and D. Riesner. 1997. Viroid processing: switch from cleavage to ligation is driven by a change from a tetraloop to a loop E conformation. EMBO J. 16:559-610.
5. Birikh, K. R., P. A. Heaton, and F. Eckstein. 1997. The structure, function and application of the hammerhead ribozyme. Eur. J. Biochem. 245:1-6[Medline].
6. Cech, T. R., and B. L. Bass. 1986. Biological catalysis by RNA. Annu. Rev. Biochem. 55:599-629[Medline].
7. Chetverin, A. B. 1997. Recombination in bacteriophage Qbeta and its satellite RNAs: the in vivo and in vitro studies. Semin. Virol. 8:121-129.
8. Chetverin, A. B., H. V. Chetverina, A. A. Demidenko, and V. I. Ugarov. 1997. Nonhomologous RNA recombination in a cell-free system: evidence for a transesterification mechanism guided by secondary structure. Cell 88:503-513[Medline].
9. Chetverina, H. V., A. A. Demidenko, V. I. Ugarov, and A. B. Chetverin. 1999. Spontaneous rearrangements in RNA sequences. FEBS Lett. 450:89-94[Medline].
10. Côté, F., and J. P. Perault. 1997. Peach latent mosaic viroid is locked by a 2',5'-phosphodiester bond produced by in vitro self-ligation. J. Mol. Biol. 273:533-543[Medline].
11. Duggal, R., A. Cuconati, M. Gromeier, and E. Wimmer. 1997. Genetic recombination of poliovirus in a cell-free system. Proc. Natl. Acad. Sci. USA 94:13786-13791[Abstract/Free Full Text].
12. Figlerowicz, M., P. D. Nagy, and J. J. Bujarski. 1997. A mutation in the putative RNA polymerase gene inhibits nonhomologous, but not homologous, genetic recombination in an RNA virus. Proc. Natl. Acad. Sci. USA 94:2073-2078[Abstract/Free Full Text].
13. Figlerowicz, M., P. D. Nagy, N. Tang, C. C. Kao, and J. J. Bujarski. 1998. Mutations in the N terminus of the brome mosaic virus polymerase affect generic RNA recombination. J. Virol. 72:9192-9200[Abstract/Free Full Text].
14. Genschik, P., E. Billy, M. Swianiewicz, and W. Filipowicz. 1997. The human RNA 3'-terminal phosphate cyclase is a member of a new family of proteins conserved in Eucaryota, Bacteria, and Archea. EMBO J. 16:2955-2967[Medline].
15. Gmyl, A. P., E. V. Pilipenko, S. V. Maslova, G. A. Belov, and V. I. Agol. 1993. Functional and genetic plasticities of the poliovirus genome: quasi-infectious RNAs modified in the 5'-untranslated region yield a variety of pseudorevertants. J. Virol. 67:6309-6316[Abstract/Free Full Text].
16. Hirst, G. K. 1962. Genetic recombination with Newcastle disease virus, polioviruses, and influenza. Cold Spring Harbor Symp. Quant. Biol. 27:303-309[Abstract/Free Full Text].
17. Jarvis, T. S., and K. Kirkegaard. 1991. The polymerase in its labyrinth: mechanisms and implications of RNA recombination. Trends Genet. 7:186-191[Medline].
18. King, A. M. Q. 1988. Genetic recombination in positive strand RNA viruses, p. 149-165. In E. Domingo, J. J. Holland, and P. Ahlquist (ed.), RNA genetics, vol. 2. CRC Press, Inc., Roca Baton, Fla.
19. Kirkegaard, K., and D. Baltimore. 1986. The mechanism of recombination in poliovirus. Cell 47:433-443[Medline].
20. Kuge, S., and A. Nomoto. 1987. Construction of viable insertion and deletion mutants of the Sabin type 1 strain of poliovirus. Function of the 5' noncoding sequence in viral replication. J. Virol. 61:1478-1487[Abstract/Free Full Text].
21. Lafontain, D., D. Beadry, P. Marrqouis, and J. P. Prreault. 1995. Intra- and intermolecular nonenzymatic ligation occur within transcripts derived from the peach latent mosaic viroid. Virology 212:705-709[Medline].
22. Lai, M. M. S. 1992. RNA recombination in animal and plant viruses. Microbiol. Rev. 56:61-79[Abstract/Free Full Text].
23. Ledinko, N. 1963. Genetic recombination with poliovirus type 1 studies of crosses between a normal horse serum-resistant mutant and several guanidine-resistant mutants of the same strain. Virology 20:107-119[Medline].
24. Mohr, S. C., and R. E. Thach. 1969. Application of ribonuclease T1 to the synthesis of oligoribonucleotides of defined base sequence. J. Biol. Chem. 244:6566-6576[Abstract/Free Full Text].
25. Nagy, P. D., and J. J. Bujarski. 1993. Targeting the site of RNA-RNA recombination in brome mosaic virus with antisense sequences. Proc. Natl. Acid. Sci. USA 90:6390-6394[Abstract/Free Full Text].
26. Nagy, P. D., and A. E. Simon. 1997. New insights into the mechanisms of RNA recombination. Virology 235:1-9[Medline].
27. Nagy, P. D., and A. E. Simon. 1998. In vitro characterization of late steps of RNA recombination in turnip crinkle virus. I. Role of motif1-hairpin structure. Virology 249:379-392[Medline].
28. Nagy, P. D., and A. E. Simon. 1998. In vitro characterization of late steps of RNA recombination in turnip crinkle virus. II. The role of the priming stem and flanking sequences. Virology 249:393-405[Medline].
29. Nagy, P. D., C. Zhang, and A. E. Simon. 1998. Dissecting RNA recombination in vitro: role of RNA sequences and the viral replicase. EMBO J. 17:2392-2403[Medline].
30. Nicholson, R., J. Pelletier, S.-Y. Le, and N. Sonenberg. 1991. Structural and functional analysis of the ribosome landing pad of poliovirus type 2: in vivo translation studies. J. Virol. 65:5886-5894[Abstract/Free Full Text].
31. Pestova, T. V., C. U. Hellen, and E. Wimmer. 1991. Translation of poliovirus RNA: role of an essential cis-acting oligopyrimidine element within the 5' nontranslated region and involvement of a cellular 57-kilodalton protein. J. Virol. 65:6194-6204[Abstract/Free Full Text].
32. Pilipenko, E. V., A. P. Gmyl, and V. I. Agol. 1995. A model for rearrangements in RNA genomes. Nucleic Acids Res. 23:1870-1875[Abstract/Free Full Text].
33. Pilipenko, E. V., A. P. Gmyl, S. V. Maslova, E. V. Khitrina, and V. I. Agol. 1995. Attenuation of Theiler's murine encephalomyelitis virus by modifications of the oligopyrimidine/AUG tandem, a host-dependent translational cis element. J. Virol. 69:864-870[Abstract].
34. Pilipenko, E. V., A. P. Gmyl, S. V. Maslova, Y. V. Svitkin, A. N. Sinyakov, and V. I. Agol. 1992. Prokaryotic-like cis-element in the cap-independent internal initiation of translation on picornavirus RNA. Cell 68:119-131[Medline].
35. Pilipenko, E. V., K. V. Poperechny, S. V. Maslova, W. J. G. Melchers, H. J. Bruins Slot, and V. I. Agol. 1996. Cis-element, oriR, involved in the initiation of (-) strand poliovirus RNA: a quasi-globular multi-domain RNA structure maintained by tertiary ("kissing") interactions. EMBO J. 119:5428-5436.
36. Romanova, L. I., V. M. Blinov, E. A. Tolskaya, E. G. Viktorova, M. S. Kolesnikova, E. A. Guseva, and V. I. Agol. 1986. The primary structure of crossover regions of intertypic poliovirus recombinants: a model of recombination between RNA genomes. Virology 155:202-213[Medline].
37. Sharmeen, L., M. Y. P. Kuo, and J. Taylor. 1989. Self-ligating RNA sequences on the antigenome of human hepatitis delta virus. J. Virol. 63:1428-1430[Abstract/Free Full Text].
38. Simon, A. E., and J. J. Bujarski. 1994. RNA-RNA recombination and evolution in virus-infected plants. Annu. Rev. Phytopathol. 32:337-362.
39. Slobodskaya, O. R., A. P. Gmyl, S. V. Maslova, E. A. Tolskaya, E. G. Viktorova, and V. I. Agol. 1996. Poliovirus neurovirulence depends on the presence of a cryptic AUG upstream of the initiator codon. Virology 221:141-150[Medline].
40. Symons, R. H. 1997. Plant pathogenic RNA and RNA catalysis. Nucleic Acids Res. 25:2683-2689[Abstract/Free Full Text].
41. Tang, R. S., D. J. Barton, J. B. Flanegan, and K. Kirkegaard. 1997. Poliovirus RNA recombination in cell-free extracts. RNA 3:624-633[Abstract].
42. Taylor, J. M. 1997. cis-acting signals on the RNAs of hepatitis delta virus. Semin. Virol. 8:212-220.
43. Tolskaya, E. A., L. I. Romanova, V. M. Blinov, E. G. Viktorova, A. N. Sinyakov, M. S. Kolesnikova, and V. I. Agol. 1987. Studies on the recombination between RNA genomes of poliovirus: the primary structure and nonrandom distribution of crossover regions in the genomes of the intertypic poliovirus recombinants. Virology 161:54-61[Medline].
44. Tolskaya, E. A., L. I. Romanova, M. S. Kolesnikova, A. P. Gmyl, A. E. Gorbalenya, and V. I. Agol. 1994. Genetic studies on the NTP-binding pattern containing 2C protein of poliovirus: possible mechanism of guanidine effect on 2C function and evidence for importance of 2C oligomerization. J. Mol. Biol. 236:1310-1323[Medline].
45. Triana-Alonso, F. J., M. Dabrowski, J. Wadzack, and K. H. Nierhaus. 1995. Self-coded 3'-extension of run-off transcripts produces aberrant products during in vitro transcription with T7 RNA polymerase. J. Biol. Chem. 270:6298-6307[Abstract/Free Full Text].
46. Tsagris, M., M. Tabler, and H. L. Singer. 1991. Ribonuclease T1 generates circular RNA molecules from viroid-specific RNA transcripts by cleavage and intramolecular ligation. Nucleic Acids Res. 19:1605-1612[Abstract/Free Full Text].
47. White, K., and T. J. Morris. 1995. RNA determinants of junction site selection in RNA virus recombinants and defective interfering RNAs. RNA 1:1029-1040[Abstract].


Journal of Virology, November 1999, p. 8958-8965, Vol. 73, No. 11
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Savolainen-Kopra, C., Samoilovich, E., Kahelin, H., Hiekka, A.-K., Hovi, T., Roivainen, M. (2009). Comparison of poliovirus recombinants: accumulation of point mutations provides further advantages. J. Gen. Virol. 90: 1859-1868 [Abstract] [Full Text]  
  • Draghici, H.-K., Varrelmann, M. (2009). Evidence that the Linker between the Methyltransferase and Helicase Domains of Potato Virus X Replicase Is Involved in Homologous RNA Recombination. J. Virol. 83: 7761-7769 [Abstract] [Full Text]  
  • Romanova, L. I., Lidsky, P. V., Kolesnikova, M. S., Fominykh, K. V., Gmyl, A. P., Sheval, E. V., Hato, S. V., van Kuppeveld, F. J. M., Agol, V. I. (2009). Antiapoptotic Activity of the Cardiovirus Leader Protein, a Viral "Security" Protein. J. Virol. 83: 7273-7284 [Abstract] [Full Text]  
  • Garcia-Ruiz, H., Ahlquist, P. (2006). Inducible Yeast System for Viral RNA Recombination Reveals Requirement for an RNA Replication Signal on Both Parental RNAs.. J. Virol. 80: 8316-8328 [Abstract] [Full Text]  
  • Wierzchoslawski, R., Bujarski, J. J. (2006). Efficient In Vitro System of Homologous Recombination in Brome Mosaic Bromovirus.. J. Virol. 80: 6182-6187 [Abstract] [Full Text]  
  • van Ooij, M. J. M., Polacek, C., Glaudemans, D. H. R. F., Kuijpers, J., van Kuppeveld, F. J. M., Andino, R., Agol, V. I., Melchers, W. J. G. (2006). Polyadenylation of genomic RNA and initiation of antigenomic RNA in a positive-strand RNA virus are controlled by the same cis-element. Nucleic Acids Res 34: 2953-2965 [Abstract] [Full Text]  
  • DeStefano, J. J., Titilope, O. (2006). Poliovirus Protein 3AB Displays Nucleic Acid Chaperone and Helix-Destabilizing Activities. J. Virol. 80: 1662-1671 [Abstract] [Full Text]  
  • Serviene, E., Jiang, Y., Cheng, C.-P., Baker, J., Nagy, P. D. (2006). Screening of the Yeast yTHC Collection Identifies Essential Host Factors Affecting Tombusvirus RNA Recombination. J. Virol. 80: 1231-1241 [Abstract] [Full Text]  
  • Simmonds, P., Welch, J. (2006). Frequency and Dynamics of Recombination within Different Species of Human Enteroviruses. J. Virol. 80: 483-493 [Abstract] [Full Text]  
  • Chetverin, A. B., Kopein, D. S., Chetverina, H. V., Demidenko, A. A., Ugarov, V. I. (2005). Viral RNA-directed RNA Polymerases Use Diverse Mechanisms to Promote Recombination between RNA Molecules. J. Biol. Chem. 280: 8748-8755 [Abstract] [Full Text]  
  • Gallei, A., Rumenapf, T., Thiel, H.-J., Becher, P. (2005). Characterization of Helper Virus-Independent Cytopathogenic Classical Swine Fever Virus Generated by an In Vivo RNA Recombination System. J. Virol. 79: 2440-2448 [Abstract] [Full Text]  
  • Appel, N., Herian, U., Bartenschlager, R. (2005). Efficient Rescue of Hepatitis C Virus RNA Replication by trans-Complementation with Nonstructural Protein 5A. J. Virol. 79: 896-909 [Abstract] [Full Text]  
  • GUDIMA, S. O., CHANG, J., TAYLOR, J. M. (2005). Reconstitution in cultured cells of replicating HDV RNA from pairs of less than full-length RNAs. RNA 11: 90-98 [Abstract] [Full Text]  
  • Gallei, A., Pankraz, A., Thiel, H.-J., Becher, P. (2004). RNA Recombination In Vivo in the Absence of Viral Replication. J. Virol. 78: 6271-6281 [Abstract] [Full Text]  
  • Hausmann, Y., Roman-Sosa, G., Thiel, H.-J., Rumenapf, T. (2004). Classical Swine Fever Virus Glycoprotein Erns Is an Endoribonuclease with an Unusual Base Specificity. J. Virol. 78: 5507-5512 [Abstract] [Full Text]  
  • Oberste, M. S., Maher, K., Pallansch, M. A. (2004). Evidence for Frequent Recombination within Species Human Enterovirus B Based on Complete Genomic Sequences of All Thirty-Seven Serotypes. J. Virol. 78: 855-867 [Abstract] [Full Text]  
  • Costa-Mattioli, M., Napoli, A. D., Ferre, V., Billaudel, S., Perez-Bercoff, R., Cristina, J. (2003). Genetic variability of hepatitis A virus. J. Gen. Virol. 84: 3191-3201 [Abstract] [Full Text]  
  • Cheng, C.-P., Nagy, P. D. (2003). Mechanism of RNA Recombination in Carmo- and Tombusviruses: Evidence for Template Switching by the RNA-Dependent RNA Polymerase In Vitro. J. Virol. 77: 12033-12047 [Abstract] [Full Text]  
  • GMYL, A. P., KORSHENKO, S. A., BELOUSOV, E. V., KHITRINA, E. V., AGOL, V. I. (2003). Nonreplicative homologous RNA recombination: Promiscuous joining of RNA pieces?. RNA 9: 1221-1231 [Abstract] [Full Text]  
  • Wierzchoslawski, R., Dzianott, A., Kunimalayan, S., Bujarski, J. J. (2003). A Transcriptionally Active Subgenomic Promoter Supports Homologous Crossovers in a Plus-Strand RNA Virus. J. Virol. 77: 6769-6776 [Abstract] [Full Text]  
  • Romani, A., Guerra, E., Trerotola, M., Alberti, S. (2003). Detection and analysis of spliced chimeric mRNAs in sequence databanks. Nucleic Acids Res 31: e17-e17 [Abstract] [Full Text]  
  • Egger, D., Bienz, K. (2002). Recombination of Poliovirus RNA Proceeds in Mixed Replication Complexes Originating from Distinct Replication Start Sites. J. Virol. 76: 10960-10971 [Abstract] [Full Text]  
  • Gauss-Muller, V., Kusov, Y. Y. (2002). Replication of a hepatitis A virus replicon detected by genetic recombination in vivo. J. Gen. Virol. 83: 2183-2192 [Abstract] [Full Text]  
  • Cuervo, N. S., Guillot, S., Romanenkova, N., Combiescu, M., Aubert-Combiescu, A., Seghier, M., Caro, V., Crainic, R., Delpeyroux, F. (2001). Genomic Features of Intertypic Recombinant Sabin Poliovirus Strains Excreted by Primary Vaccinees. J. Virol. 75: 5740-5751 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gmyl, A. P.
Right arrow Articles by Agol, V. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gmyl, A. P.
Right arrow Articles by Agol, V. I.