Previous Article | Next Article 
Journal of Virology, October 1999, p. 8843-8847, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Transactivation of Herpes Simplex Virus Type 1 Immediate-Early
Gene Expression by Virion-Associated Factors Is Blocked by an
Inhibitor of Cyclin-Dependent Protein Kinases
Robert
Jordan,*
Luis
Schang, and
Priscilla A.
Schaffer
Department of Microbiology, University of
Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104
Received 7 April 1999/Accepted 25 June 1999
 |
ABSTRACT |
Initiation of productive infection by human herpes simplex virus
type 1 (HSV-1) requires cell cycle-dependent protein kinase (cdk)
activity. Treatment of cells with inhibitors of cdks blocks HSV-1
replication and prevents accumulation of viral transcripts, including
immediate-early (IE) transcripts (26). Inhibition of IE
transcript accumulation suggests that virion proteins, such as VP16,
require functional cdks to activate viral transcription. In this
report, we show that a cdk inhibitor, Roscovitine, blocks VP16-dependent IE gene expression. In the presence of Roscovitine, the
level of virion-induced activation of a transfected reporter gene (the
gene encoding chloramphenicol acetyltransferase) linked to the
promoter-regulatory region of the ICP0 gene was reduced 40-fold
relative to that of untreated samples. Roscovitine had little effect on
the interaction of VP16 with VP16-responsive DNA sequences as measured
by electrophoretic mobility shift assays. These data indicate that
VP16-dependent activation of IE gene expression requires functional
cdks and that this requirement is independent of the ability of VP16 to
bind to DNA.
 |
TEXT |
The human herpes simplex virus type
1 (HSV-1) regulatory protein, VP16, stimulates productive infection by
activating transcription of viral immediate-early (IE) genes. VP16
activates transcription from IE promoters by indirectly binding to
specific sequence elements (TAATGARAT) found in the
promoter-regulatory regions of all IE genes (19, 33). VP16
is associated with the viral tegument and is released from the virion
upon entry into susceptible cells. Inside the cell, VP16 interacts with
two host proteins, host cell factor (HCF) and Oct-1, which together
facilitate binding of the protein complex to VP16 response elements
(14, 15, 30, 37). Formation of the protein-DNA complex is
essential for transactivation of IE genes (19, 22, 33).
Binding of VP16 to DNA through HCF and Oct-1 exposes the acidic
activation domain of VP16, which interacts with host transcriptional
proteins to increase the rate of transcription initiation
(31). While in vitro reconstitution of VP16-dependent
transcriptional activation using purified proteins has assisted in
elucidating the molecular mechanism of VP16 action, the mechanism by
which this process is regulated during viral infection is poorly
understood (16, 17, 24).
Several lines of evidence suggest that VP16 and VP16-associated
proteins rely on cell cycle-regulated activities to stimulate transcription. A temperature-sensitive form of HCF inhibits cell cycle
progression at the nonpermissive temperature (5). Extracts prepared from these cells inhibit VP16-dependent DNA binding and transactivation in vitro (5). Domains of HCF that are
required for cell cycle progression are also required for
VP16-dependent transcriptional activation (36). In addition,
the Oct-1 protein is phosphorylated in a cell cycle-dependent
manner (23, 27). Finally, two inhibitors of cyclin-dependent
kinases (cdks), Roscovitine and Olomucine, block accumulation of
HSV-1 IE transcripts and inhibit viral replication when added 1 to
6 h postinfection (p.i.) (25, 26). Roscovitine is a
specific inhibitor of cdk-1, cdk-2, cdk-5 (18), and cdk-7
(26a).
Inhibition of IE gene expression by cdk inhibitors suggests that these
kinases are important for VP16-dependent transcriptional activation.
Moreover, Roscovitine is the only drug that inhibits transcription of
IE genes. Taken together, these observations indicate that regulation
of VP16-dependent transactivation during viral infection requires cell
cycle-dependent activities. In this study, we demonstrate that
VP16-dependent transactivation of an IE promoter requires the
activities of cellular cdks and that this requirement is independent of
the ability of VP16 to bind to DNA.
Inhibition of virion-induced IE gene expression by
Roscovitine.
Previous findings have suggested the possibility that
cdks are important for expression of viral IE genes (25,
26). In order to measure the effects of the cdk inhibitor,
Roscovitine, on VP16-dependent transcriptional activation, a
transient-transfection/superinfection assay was utilized. Vero cells
(2 × 105/60-mm-diameter dish) were transfected with 1 µg of a plasmid (pWRICP0-CAT) that contains the gene encoding
chloramphenicol acetyltransferase (CAT) under the control of the
promoter-regulatory region of the HSV IE gene, ICP0. At 48 h
posttransfection, cultures were infected with the equivalent of 10 PFU
of UV-inactivated HSV-1 KOS per cell in the presence and absence of 100 µM Roscovitine. At 3, 6, and 9 h p.i., the cultures were
harvested and CAT activity was measured. UV inactivation of viral
stocks inhibits viral gene expression but leaves the activities of
virion proteins, including VP16, intact. Thus, in this assay,
activation of the ICP0 promoter in the transfected plasmid by
UV-inactivated virions is mediated by VP16 and possibly by other
virion-associated proteins.
Addition of Roscovitine at the time of infection blocked the ability of
UV-inactivated KOS to induce CAT expression from pWRICP0-CAT (Table
1, rows 1 to 4). In the presence of
Roscovitine, the level of CAT activity in virus-infected cultures (row
4) was similar to that in mock-infected cultures (row 1). In the
absence of Roscovitine, the level of CAT activity in virus-infected
cultures at 9 h p.i. was 39-fold higher than that in mock-infected
cultures (row 2). Addition of Roscovitine had no effect on the basal
level of CAT expression in mock-infected cultures (row 3). These
results demonstrate that Roscovitine inhibits virion-induced IE gene
expression.
Kinetics of Roscovitine-dependent inhibition of IE gene
expression.
Since Roscovitine inhibits HSV replication even when
added to infected cells at 6 h p.i. (7, 8), it was of
interest to determine if cdk activity was required for activation of
HSV IE promoters at different times after infection. For this purpose, Vero cells (2 × 105/60-mm-diameter dish) were
transfected with 1 µg of pWRICP0-CAT and mock infected or infected
with 10 PFU of UV-inactivated KOS per cell at 48 h
posttransfection. The cultures were divided into six groups containing
six dishes each. At 0, 2, 4, and 6 h p.i., the culture medium in a
single group was removed and replaced with medium containing 100 µM
Roscovitine. In addition, at 0, 2, 4, 6, 8, and 10 h p.i., one
dish from each group was harvested and CAT activity was measured. The
mock-infected group was not treated with Roscovitine.
Inhibition of virion-induced CAT expression by Roscovitine was most
efficient when drug was added at 0 and 2 h p.i. (Fig.
1). The level of CAT activity when
Roscovitine was added at these
times was similar to the basal levels in
mock-infected samples.
Roscovitine was less effective in inhibiting
virion-induced CAT
activity when added at 4 h p.i. Notably,
however, the level of
CAT activity did not change significantly after
Roscovitine addition
at this time, suggesting that the drug inhibited
new CAT expression.
By 6 h p.i., CAT activity in infected cultures
was refractory
to Roscovitine inhibition in that the levels of CAT
activity in
the presence of Roscovitine were comparable to those in the
absence
of drug. These results indicate either that (i) Roscovitine
inhibits
virion-induced CAT activity at a step that occurs prior to
6 h
p.i. or (ii) by 6 h p.i., translation of CAT mRNA becomes
rate
limiting in the infected cell and blocking new synthesis of CAT
mRNA does not affect translation of the remaining CAT message.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Kinetics of Roscovitine-dependent inhibition of IE gene
expression. Vero cells (2 × 105/60-mm-diameter dish)
were transfected with 1 µg of pWRICP0-CAT, and at 48 h
posttransfection, the cultures were mock infected or infected with 10 PFU of UV-inactivated KOS per cell. The cultures were divided into six
groups containing six dishes each. At 0, 2, 4, and 6 h p.i.
(H.P.I.), the culture medium in a single group was removed and replaced
with medium containing 100 µM Roscovitine. In addition, at 0, 2, 4, 6, 8, and 10 h p.i., one dish from each group was harvested and
CAT activity was measured. The mock-infected group was not treated with
Roscovitine. CAT activity was measured in the linear range of the
assay, and a value of 40,000 cpm represents approximately 20%
acetylation of the radiolabeled chloramphenicol substrate in the
reaction mixtures.
|
|
Lovastatin and K252a do not inhibit virion-induced IE gene
expression.
Roscovitine inhibits IE gene expression either by
blocking cdk activity or by blocking the activities of downstream
proteins which are both activated by cdks and required for cell cycle
progression. We thus tested whether cell cycle inhibition or inhibition
of other serine-threonine kinases blocked virion-induced activation of
IE gene expression. A well-characterized cell cycle inhibitor, Lovastatin, and a broad-spectrum serine-threonine kinase inhibitor, K252a, were tested for their ability to inhibit virion-induced CAT
expression (10). Lovastatin is an HMG-coenzyme A reductase inhibitor that blocks association of ras with the plasma
membrane (9, 11). This interaction is required to transduce
growth factor-dependent signaling to the nucleus (9).
Blocking this signaling pathway arrests cells in the G1
phase of the cell cycle (9). Indeed, in control experiments,
10 µM Lovastatin blocked cell cycle progression, while higher doses
were toxic (data not shown). Thus, although Roscovitine and Lovastatin
inhibit cell cycle progression, their mechanisms of action are quite different.
To test the effects of Lovastatin and K252a on HSV-1 IE gene
expression, Vero cells (2 × 10
5 cells/60-mm-diameter
dish) were transfected with 1 µg of pWRICP0-CAT.
At 48 h
posttransfection, the cultures were infected with 10 PFU
of
UV-inactivated KOS per cell in the presence and absence of
100 µM
Roscovitine, 10 µM Lovastatin, and 250 µM K252a (the highest
nontoxic dose of this drug). At 3, 6, and 9 h p.i., infected
cultures
were harvested and CAT activity was
measured.
As shown in Table
1, Lovastatin (row 8) and K252a (row 6) had little
effect on virion-induced IE gene expression when added
at the time of
infection. Likewise, cultures treated with Lovastatin
or K252a 24 h prior to infection had no effect on virion-induced
IE gene expression
(data not shown). Collectively, the results
shown in Table
1
demonstrate that virion-induced IE gene expression
requires activities
(most likely cdks) that are sensitive to inhibition
by Roscovitine but
not Lovastatin or
K252a.
Roscovitine does not inhibit VP16-dependent DNA binding.
Binding of VP16 to the consensus sequence, TAATGARAT, is
necessary for transcriptional activation of IE genes. To test whether Roscovitine inhibits binding of VP16 to DNA, gel mobility shift assays
were performed. Nuclear extracts were prepared from
cycloheximide-treated (50 µg/ml) Vero cells (107/T150
flask) that were either mock infected or infected with 20 PFU of KOS
per cell in the presence or absence of 100 µM Roscovitine. Cycloheximide was used to inhibit viral gene expression so that only
virion-associated activities would be measured in the nuclear extracts
(22). In addition, nuclear, rather than whole-cell, extracts
were used in the event that Roscovitine inhibits nuclear transport of
VP16, HCF, and Oct-1. At 3 h p.i., the cultures were harvested and
nuclear extracts were prepared by the method of Dignam et al.
(3).
Three microliters of nuclear extract (12 µg of protein) was incubated
in 12 µl of binding buffer [10 mM HEPES (pH 8.0), 1
mM EDTA, 5 mM
dithiothreitol, 0.1% NP-40, 0.5% Ficoll, 50 ng of
salmon sperm
DNA/ml, 1.5 µg of poly(dIdC)/ml] for 5 min at 20°C.
In addition,
the binding reaction mixture was supplemented with
histidine-tagged
Oct-1 POU domain protein expressed in
Escherichia coli and
purified by nickel affinity chromatography. The binding
reaction
mixtures were supplemented with Oct-1 POU domain protein
to enhance the
VP16-dependent DNA binding activity because Oct-1
is limiting in Vero
cell nuclear extracts. After 5 min of incubation,
0.5 ng of a
32P-end-labeled (~5 × 10
5 cpm) 29-bp
oligonucleotide probe (CCGTGCATGC
TAATGATATTCCTTTGGGGG)
containing the VP16 response element from the ICP0 promoter
(underlined)
was added to the reaction mixture, and the mixture was
incubated
for an additional 30 min at 20°C. The protein-DNA complexes
were
separated by native gel electrophoresis on a 5% polyacrylamide
gel in TBE buffer (89 mM Tris-borate, 89 mM boric acid, 2 mM EDTA)
and
visualized by PhosphorImager analysis (Fig.
2A).

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Roscovitine does not affect induction of
virion-induced TAATGARAT DNA binding activity. Three
microliters of nuclear extract (12 µg of protein) was incubated in 12 µl of binding buffer [10 mM HEPES (pH 8.0), 1 mM EDTA, 5 mM
dithiothreitol, 0.1% NP-40, 0.5% Ficoll, 50 ng of salmon sperm
DNA/ml, 1.5 µg of poly(dIdC)/ml] for 5 min at 20°C. In addition,
the binding reaction mixture was supplemented with histidine-tagged
Oct-1 POU domain protein expressed in E. coli and purified
by nickel affinity chromatography. After 5 min of incubation, 0.5 ng of
a 32P-end-labeled (~5 × 105 cpm) 29-bp
oligonucleotide probe (see text for complete sequence) containing the
wild-type VP16 response element from the ICP0 promoter (TAATGARAT)
or a probe containing a mutant VP16 response element
(TCCTGARAT) was added to the reaction mixture, and the
mixture was incubated for an additional 30 min at 20°C. The
protein-DNA complexes were separated by native gel electrophoresis on a
5% polyacrylamide gel in TBE buffer and visualized by PhosphorImager
analysis. Lane 1, free probe; lane 2, Oct-POU domain (Oct-1); lane 3, mock-infected nuclear extract; lanes 4 to 13, KOS-infected nuclear
extract in the presence (+) or absence ( ) of 100 µM Roscovitine.
The VIC is indicated. (B) VP16 antibody supershifts the VIC. Binding
reactions were performed as described for panel A. Following the 30-min
incubation period, 1 µl of binding buffer (lanes 3 to 5), polyclonal
rabbit antibody directed against a Gal4-VP16 fusion protein
(32) (anti-VP16) (lanes 6 to 8), or antibody directed
against the HSV-1 origin binding protein (anti-OBP) (lanes 9 to 11) was
added to the reaction mixtures. The binding reaction mixtures were
incubated for 5 min prior to gel electrophoresis. Lane 1, free probe
(not shown in figure); lane 2, Oct-1 (not shown in figure); lanes 3, 6, and 9, mock-infected extracts; lanes 4, 5, 7, 8, 10, and 11, KOS-infected nuclear extract in the presence (+) or absence ( ) of 100 µM Roscovitine.
|
|
Mock-infected nuclear extracts supplemented with purified Oct-1 POU
domain protein produced a complex that migrated more slowly
than free
probe (Fig.
2A, lane 2, Oct-1). In KOS-infected nuclear
extracts, a
second major complex, the virion-induced complex (VIC)
containing VP16,
HCF, and Oct-1 POU domain protein bound to the
VP16 response element,
was observed (Fig.
2A, lanes 4, 5, and
10 to 13, VIC). This complex was
not present in mock-infected
nuclear extracts (Fig.
2A, lane 3). To
measure the specificity
of the two protein-DNA complexes, binding was
completed with 10-
and 100-fold molar excesses of either unlabeled
specific probe
or a mutant probe in which the VP16 consensus site,
TAATGARAT
(R represents any purine), was changed to
TCCTGARAT. The VIC band
did not form with an oligonucleotide
probe containing this mutation
(data not shown). Formation of both VIC
and (putative) Oct-POU
domain complexes was efficiently inhibited by
addition of unlabeled
specific probe (Fig.
2A, lanes 6 to 9) but not by
addition of
unlabeled mutant probe (Fig.
2A, lanes 10 to 13). Moreover,
LA2-3,
a rabbit polyclonal antibody directed against a Gal4-VP16 fusion
protein (
32) and kindly provided by Steven Treizenberg
(Michigan
State University, East Lansing, Mich.), supershifted the VIC
complex
(Fig.
2B, lanes 7 and 8), while an antibody specific for the
herpesvirus
origin binding protein (OBP) did not (Fig.
2B, lanes 10 and
11).
Based on these observations, it is likely that the virion-induced
protein-DNA complex, VIC, represents VP16 bound to the consensus
TAATGARAT site through interaction with the Oct-1 POU domain
and
possibly HCF. Notably, addition of Roscovitine had no measurable
effect on the formation or mobility of either VIC or the putative
Oct-1
protein DNA complex. Thus, Roscovitine does not affect the
interaction
of VP16 with its consensus binding site in this assay.
These results
suggest that inhibition of activation of IE gene
expression by
Roscovitine occurs at a step following VP16 binding
to DNA. Whether
individual components of the VIC complex are equally
phosphorylated in
the presence (Fig.
2A, lane 5) or absence (Fig.
2A, lane 4) of
Roscovitine remains to be
determined.
In this study, we have shown that Roscovitine, a specific inhibitor of
cdk activity, blocks virion-induced activation of an
IE promoter. Two
other compounds, Lovastatin, an inhibitor of
cell cycle progression,
and K252a, a broad-spectrum serine-threonine
kinase inhibitor, did not
inhibit virion-dependent IE gene activation,
demonstrating that the
inhibitory effect is specific for Roscovitine.
The ability of
Roscovitine to inhibit transactivation of IE promoters
indicates that
the activity of one or more components of the VP16-containing
transcription complex is affected by active cdks. Roscovitine
does not
inhibit formation of protein-DNA complexes with TAATGARAT
elements or detectably change the mobility of these complexes
measured by native polyacrylamide gel
electrophoresis.
There are several possible sites at which Roscovitine may act, and they
are described in the following discussions: (i) In
vitro studies have
characterized the molecular mechanism of VP16-dependent
transcriptional
activation (
13-17,
19,
22,
24,
30,
31,
37). These studies
have identified an acidic activation domain
in the C terminus of VP16
that is essential for transcriptional
activation (
16,
17,
24,
29,
31). The acidic activation
domain, when fused to heterologous DNA
binding domains, stimulates
transcription from promoters that contain
the binding site for
the heterologous DNA binding protein
(
2). The acidic activation
domain interacts with basal
transcription factors, TFIIB and TFIID,
as measured by vitro
transcription-translation studies and by
affinity chromatography
(
16,
17,
31). Mutations in the acidic
activation domain that
block the interaction of the VP16 with
TFIIB and TFIID inhibit
transcriptional activation (
16,
24,
31). Taken together,
these studies suggest that VP16 recruits
basal transcription proteins
to promoters through interactions
with the acidic activation domain.
Recruitment of basal transcription
factors by the VP16 acidic
activation domain may require cdk activity.
Indeed, VP16 is
phosphorylated in vitro at position 375 (
20).
Point
mutations at this site block VP16-dependent protein-DNA
complex
assembly (
20). Even if cdks do not phosphorylate VP16
directly, they may stimulate downstream kinases or other enzymes
that
activate the C-terminal acidic activation domain. Thus, inhibition
of
cdk activity by Roscovitine might block the ability of VP16
to recruit
basal transcription factors to HSV-1 IE gene
promoters.
(ii) While no obvious cdk phosphorylation sites map to the domains of
VP16 that are phosphorylated in vivo, a strong cdk consensus
site maps
to the N-terminal portion of HCF at position 127 (
25).
Point
mutations at amino acid 134 in HCF, near the cdk consensus
site, block
VP16-dependent transactivation and inhibit cell cycle
progression
(
5). These observations suggest that phosphorylation
of HCF
may play a critical role in the activity of the protein
with respect to
VP16-induced transactivation and cell cycle progression.
In addition,
Oct-1 is phosphorylated in a cell cycle-dependent
manner (
23,
27). Moreover, Oct-1 DNA binding activity is regulated
by
phosphorylation (
27). Phosphorylation of components of the
VP16-HCF-Oct-1 complex, and not just the C-terminal acidic
transactivation
domain of VP16, may be required for transcriptional
activation.
Thus, Roscovitine may inhibit VP16-dependent IE gene
activation
by preventing the phosphorylation of one or more proteins in
the
VP16-induced complex. While phosphorylation may not affect the
interaction of these proteins with VP16 and the TAATGARAT
element,
inhibition of phosphorylation may block the ability of
these proteins
to interact with basal transcription factors. The cell
cycle-dependent
phosphorylation of VP16 and VP16-associated proteins is
currently
under
investigation.
(iii) Roscovitine may inhibit a component(s) of the basal transcription
complex. Initiation of eukaryotic transcription involves
the assembly
of more than 30 proteins at a specific site on the
promoter
(
12). Many of the proteins that form the transcription
complex are regulated by cell cycle-dependent activities. Cell
cycle-dependent phosphorylation of basal transcription factors
has been
observed for TFIID and TBP (
4). Furthermore, cdk-7,
a
component of the basal transcription complex, phosphorylates
the
carboxy-terminal domain of RNA polymerase II. This phosphorylation
appears to be required for basal and activated transcription (
1,
6,
21). Recent studies suggest that Roscovitine directly
inhibits
cdk7 activity in vitro (
26a). Thus, Roscovitine may
inhibit
VP16-HCF-Oct-1-dependent transcriptional activation by
blocking
assembly and/or function of the assembled transcription
complex. If
this is the primary mechanism of Roscovitine inhibition
of HSV
replication, however, one would predict that this drug
would also
affect basal transcription. While we observed little
effect on the
basal level of ICP0-CAT expression in the presence
of Roscovitine,
more-sensitive assays that directly measure basal
transcription will be
required to compare the effects of Roscovitine
on both basal and
activated transcription. It should be noted,
however, that Vero and HEL
cells survive for long periods (more
than 48 h) in
Roscovitine-containing medium, indicating that basal
cellular
transcription is not totally blocked by this
drug.
Whatever the mechanism of Roscovitine-dependent inhibition of
virion-induced IE gene expression, the demonstration that cdk
activity
is required for this process suggests that productive
infection would
be less efficient in cell types in which these
enzymes are not active.
Moreover, recent observations suggest
that cdk activity is also
required for viral E gene expression
(
26). Terminally
differentiated neurons do not express most
of the cdks whose expression
has been studied (
28). Indeed,
induction of cdk-2 activity
in terminally differentiated neurons
correlates with induction of
apoptosis in vitro (
28). Thus,
HSV infection of neurons not
expressing cdk activity may promote
the establishment of latent
infection by limiting expression of
IE and E genes. Indeed,
low-multiplicity infection of neurons
in culture leads to a latent-like
infection (
34,
35). These
observations are consistent with
the hypothesis that cdk activity
is required for HSV IE and E gene
expression during productive
infection and reactivation from latency
(
25).
 |
ACKNOWLEDGMENTS |
This work was supported in part by Public Health Service grant RO1
CA20260 from the National Cancer Institute and grant IRG-135R from the
American Cancer Society.
We thank William Halford for helpful discussions and ideas and Timothy
Block and Ying-Hsiu Su for critical reading of the manuscript. We also
thank Steve Treizenberg and David Davido for providing VP16 antibody
and Jennifer Isler for providing OBP antibody.
 |
FOOTNOTES |
*
Corresponding author. Present address: Department of
Biochemistry and Molecular Pharmacology, The Jefferson Center for
Biomedical Research, 700 Butler Ave., Doylestown, PA 18901-2697. Phone:
(215) 489-4914. Fax: (215) 489-4920. E-mail:
Robert.Jordan{at}mail.tju.edu.
 |
REFERENCES |
| 1.
|
Dahmus, M. E.
1996.
Reversible phosphorylation of the C-terminal domain of RNA polymerase II.
J. Biol. Chem.
271:19009-19012[Free Full Text].
|
| 2.
|
Das, G.,
C. S. Hinkley, and W. Herr.
1995.
Basal promoter elements as a selective determinant of transcriptional activator function.
Nature
374:657-659[Medline].
|
| 3.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1488[Abstract/Free Full Text].
|
| 4.
|
Dynlact, B.
1997.
Regulation of transcription by proteins that control the cell cycle.
Nature
389:149-152[Medline].
|
| 5.
|
Goto, H.,
S. Motomura,
A. Wilson,
R. N. Freiman,
Y. Nakabeppu,
K. Fukushima,
M. Fujishima,
W. Herr, and T. Nishimoto.
1997.
A single-point mutation in HCF causes temperature-sensitive cell-cycle arrest and disrupts VP16 function.
Gen. Dev.
11:726-737[Abstract/Free Full Text].
|
| 6.
|
Greenblatt, J.
1997.
RNA polymerase II holoenzyme and transcriptional regulation.
Curr. Opin. Cell Biol.
9:310-319[Medline].
|
| 7.
|
Honess, R. W., and B. Roizman.
1974.
Regulation of herpesvirus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins.
J. Virol.
14:8-19[Abstract/Free Full Text].
|
| 8.
|
Honess, R. W., and B. Roizman.
1975.
Regulation of herpesvirus macromolecular synthesis: sequential transition of polypeptide synthesis requires functional viral polypeptides.
Proc. Natl. Acad. Sci. USA
72:1276-1280[Abstract/Free Full Text].
|
| 9.
|
Jakobisiak, M.,
S. Bruno,
J. S. Skierski, and Z. Darzynkiewicz.
1991.
Cell cycle-specific effects of lovastatin.
Proc. Natl. Acad. Sci. USA
88:3628-3631[Abstract/Free Full Text].
|
| 10.
|
Kase, H.,
K. Iwahashi,
S. Nakanishi,
Y. Matsuda,
K. Yamada,
M. Takahashi,
C. Murakata,
A. Sato, and M. Kaneko.
1987.
K-252 compounds, novel and potent inhibitors of protein kinase C and cyclic nucleotide-dependent protein kinases.
Biochem. Biophys. Res. Commun.
142:436-440[Medline].
|
| 11.
|
Keyomarsi, K.,
L. Sandoval,
V. Band, and A. B. Pardee.
1991.
Synchronization of tumor and normal cells from g1 to multiple cell cycles by lovastatin.
Cancer Res.
51:3602-3609[Abstract/Free Full Text].
|
| 12.
|
Kingston, R. E.,
C. A. Bunker, and A. N. Imbalzano.
1996.
Repression and activation by multiprotein complexes that alter chromatin structure.
Gen. Dev.
10:905-920[Abstract/Free Full Text].
|
| 13.
|
Kristie, M. T., and P. A. Sharp.
1990.
Interactions of the oct-1 POU subdomains with specific DNA sequences and with the HSV a-trans-activator protein.
Gen. Dev.
4:2383-2396[Abstract/Free Full Text].
|
| 14.
|
Kristie, T. M., and P. A. Sharp.
1993.
Purification of the cellular c1 factor required for the stable recognition of the oct-1 homeodomain by the herpes simplex virus a-trans-induction factor (VP16).
J. Biol. Chem.
268:6525-6534[Abstract/Free Full Text].
|
| 15.
|
LaMarco, K. L., and S. L. McKnight.
1989.
Purification of a set of cellular polypeptides that bind to the purine-rich cis-regulatory element of herpes simplex virus immediate early genes.
Gen. Dev.
3:1372-1383[Abstract/Free Full Text].
|
| 16.
|
Lin, Y., and M. R. Green.
1991.
Mechanism of action of an acidic transcriptional activator in vitro.
Cell
64:971-981[Medline].
|
| 17.
|
Lin, Y.,
I. Ha,
E. Maldonado,
D. Reinberg, and M. R. Green.
1991.
Binding of general transcription factor TFIIB to an acidic activating region.
Nature
353:569-571[Medline].
|
| 18.
|
Meijer, L.,
A. Borgne,
O. Mulner,
J. P. Chong,
J. J. Blow,
N. Inagaki,
M. Inagaki,
J. G. Delcros, and J. P. Moulinoux.
1997.
Biochemical and cellular effects of Roscovitine, a potent and selective inhibitor of the cyclin-dependent kinases cdc2, cdk2 and cdk5.
Eur. J. Biochem.
243:527-536[Medline].
|
| 19.
|
O'Hare, P., and C. R. Goding.
1988.
Herpes simplex virus regulatory elements and the immunoglobulin octamer domain bind a common factor and are both targets for virion transactivation.
Cell
52:435-445[Medline].
|
| 20.
|
O'Reilly, D.,
O. Hanscombe, and P. O'Hare.
1997.
A single serine residue at position 375 of VP16 is critical for complex assembly with Oct-1 and HCF and is a target of phosphorylation by casein kinase II.
EMBO J.
16:2420-2430[Medline].
|
| 21.
|
Perkins, N. D.,
L. K. Felzien,
J. C. Betts,
K. Leung,
D. H. Beach, and G. J. Nabel.
1997.
Regulation of NF- B by cyclin-dependent kinases associated with the p300 coactivator.
Science
275:523-527[Abstract/Free Full Text].
|
| 22.
|
Preston, C. M.,
M. C. Frame, and M. E. Campbell.
1988.
A complex formed between cell components and an HSV structural polypeptide binds to a viral immediate early gene regulatory DNA sequence.
Cell
52:425-434[Medline].
|
| 23.
|
Roberts, S. B.,
N. Segil, and N. Heintz.
1991.
Differential phosphorylation of the transcription factor Oct-1 during the cell cycle.
Science
253:1022-1026[Abstract/Free Full Text].
|
| 24.
|
Roberts, S. G. E.,
I. Ha,
E. Maldonado,
D. Reinberg, and M. R. Green.
1993.
Interaction between an acidic activation and transcription factor tfIIB is required for transcriptional activation.
Nature
363:741-744[Medline].
|
| 25.
|
Schang, L. M.,
J. Phillips, and P. A. Schaffer.
1998.
Requirement of cellular cyclin-dependent kinases in herpes simplex virus replication and transcription.
J. Virol.
72:5626-5637[Abstract/Free Full Text].
|
| 26.
|
Schang, L. M.,
A. Rosenberg, and P. A. Schaffer.
1999.
Transcription of herpes simplex virus immediate-early and early genes is inhibited by Roscovitine and inhibitor specific for cellular cyclin-dependent kinases.
J. Virol.
73:2161-2172[Abstract/Free Full Text].
|
| 26a.
| Schang, L. M., P. A. Schaffer, and R. Shiekhattar. Unpublished obserations.
|
| 27.
|
Segil, N.,
S. B. Roberts, and N. Heintz.
1991.
Mitotic phosphorylation of the Oct-1 homeodomain and regulation of Oct-1 DNA binding activity.
Science
254:1814-1816[Abstract/Free Full Text].
|
| 28.
|
Shirvan, A.,
I. Ziv,
R. Zilkha-Falb,
T. Machlyn,
A. Barzilai, and E. Melamed.
1998.
Expression of cell cycle-related genes during neuronal apoptosis: is there a distinct pattern.
Neurochem. Res.
23:767-777[Medline].
|
| 29.
|
Stargell, L. A., and K. Struhl.
1995.
The TBP-TFIIA interaction in the response to acidic activators in vivo.
Science
269:75-78[Abstract/Free Full Text].
|
| 30.
|
Stern, S.,
M. Tanaka, and W. Herr.
1989.
The Oct-1 homeodomain directs formation of a multiprotein-DNA complex with the HSV transactivator VP16.
Nature
341:624-630[Medline].
|
| 31.
|
Stringer, K. F.,
C. J. Ingles, and J. Greenblatt.
1990.
Direct and selective binding of an acidic transcriptional activation domain to the TATA-box factor TFIID.
Nature
345:783-786[Medline].
|
| 32.
|
Sullivan, S. M.,
P. J. Horn,
V. A. Olson,
A. H. Koop,
W. Miu,
R. H. Ebright, and S. Triezenberg.
1998.
Mutational analysis of a transcriptional activation region of the VP16 protein of herpes simplex virus.
Nucleic Acids Res.
26:4487-4496[Abstract/Free Full Text].
|
| 33.
|
Triezenberg, S. J.,
K. L. LaMarco, and S. L. McKnight.
1988.
Evidence of DNA: protein interactions that mediate HSV-1 immediate early gene activation by Vp16.
Gen. Dev.
2:730-742[Abstract/Free Full Text].
|
| 34.
|
Wilcox, C. L., and E. M. Johnson.
1987.
Nerve growth factor deprivation results in the reactivation of latent herpes simplex virus in vitro.
J. Virol.
61:2311-2315[Abstract/Free Full Text].
|
| 35.
|
Wilcox, C. L., and E. M. Johnson.
1988.
Characterization of nerve growth factor-dependent herpes simplex virus latency in neurons in vitro.
J. Virol.
52:393-399.
|
| 36.
|
Wilson, A. C.,
R. N. Freiman,
H. Goto,
T. Nishimoto, and W. Herr.
1997.
VP16 targets an amino-terminal domain of HCF involved in cell cycle progression.
Mol. Cell. Biol.
17:6139-6146[Abstract].
|
| 37.
|
Wilson, A. C.,
K. LaMarco,
M. G. Peterson, and W. Herr.
1993.
The VP16 accessory protein HCF is a family of polypeptides processed from a large precursor protein.
Cell
74:115-125[Medline].
|
Journal of Virology, October 1999, p. 8843-8847, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fukui, Y., Shindoh, K., Yamamoto, Y., Koyano, S., Kosugi, I., Yamaguchi, T., Kurane, I., Inoue, N.
(2008). Establishment of a Cell-Based Assay for Screening of Compounds Inhibiting Very Early Events in the Cytomegalovirus Replication Cycle and Characterization of a Compound Identified Using the Assay. Antimicrob. Agents Chemother.
52: 2420-2427
[Abstract]
[Full Text]
-
Leach, N., Bjerke, S. L., Christensen, D. K., Bouchard, J. M., Mou, F., Park, R., Baines, J., Haraguchi, T., Roller, R. J.
(2007). Emerin Is Hyperphosphorylated and Redistributed in Herpes Simplex Virus Type 1-Infected Cells in a Manner Dependent on both UL34 and US3. J. Virol.
81: 10792-10803
[Abstract]
[Full Text]
-
Diwan, P., Lacasse, J. J., Schang, L. M.
(2004). Roscovitine Inhibits Activation of Promoters in Herpes Simplex Virus Type 1 Genomes Independently of Promoter-Specific Factors. J. Virol.
78: 9352-9365
[Abstract]
[Full Text]
-
Taylor, S. L., Kinchington, P. R., Brooks, A., Moffat, J. F.
(2004). Roscovitine, a Cyclin-Dependent Kinase Inhibitor, Prevents Replication of Varicella-Zoster Virus. J. Virol.
78: 2853-2862
[Abstract]
[Full Text]
-
Davido, D. J., von Zagorski, W. F., Maul, G. G., Schaffer, P. A.
(2003). The Differential Requirement for Cyclin-Dependent Kinase Activities Distinguishes Two Functions of Herpes Simplex Virus Type 1 ICP0. J. Virol.
77: 12603-12616
[Abstract]
[Full Text]
-
Schang, L. M.
(2002). Cyclin-dependent kinases as cellular targets for antiviral drugs. J Antimicrob Chemother
50: 779-792
[Abstract]
[Full Text]
-
Evers, D. L., Breitenbach, J. M., Borysko, K. Z., Townsend, L. B., Drach, J. C.
(2002). Inhibition of Cyclin-Dependent Kinase 1 by Purines and Pyrrolo[2,3-d]Pyrimidines Does Not Correlate with Antiviral Activity. Antimicrob. Agents Chemother.
46: 2470-2476
[Abstract]
[Full Text]
-
Schang, L. M., Bantly, A., Schaffer, P. A.
(2002). Explant-Induced Reactivation of Herpes Simplex Virus Occurs in Neurons Expressing Nuclear cdk2 and cdk4. J. Virol.
76: 7724-7735
[Abstract]
[Full Text]
-
Schang, L. M., Bantly, A., Knockaert, M., Shaheen, F., Meijer, L., Malim, M. H., Gray, N. S., Schaffer, P. A.
(2002). Pharmacological Cyclin-Dependent Kinase Inhibitors Inhibit Replication of Wild-Type and Drug-Resistant Strains of Herpes Simplex Virus and Human Immunodeficiency Virus Type 1 by Targeting Cellular, Not Viral, Proteins. J. Virol.
76: 7874-7882
[Abstract]
[Full Text]
-
Moxley, M. J., Block, T. M., Liu, H.-C., Fraser, N. W., Perng, G.-C., Wechsler, S. L., Su, Y.-H.
(2002). Herpes simplex virus type 1 infection prevents detachment of nerve growth factor-differentiated PC12 cells in culture. J. Gen. Virol.
83: 1591-1600
[Abstract]
[Full Text]
-
Davido, D. J., Leib, D. A., Schaffer, P. A.
(2002). The Cyclin-Dependent Kinase Inhibitor Roscovitine Inhibits the Transactivating Activity and Alters the Posttranslational Modification of Herpes Simplex Virus Type 1 ICP0. J. Virol.
76: 1077-1088
[Abstract]
[Full Text]
-
Lee, S., Herr, W.
(2001). Stabilization but Not the Transcriptional Activity of Herpes Simplex Virus VP16-Induced Complexes Is Evolutionarily Conserved among HCF Family Members. J. Virol.
75: 12402-12411
[Abstract]
[Full Text]
-
Tsavachidou, D., Podrzucki, W., Seykora, J., Berger, S. L.
(2001). Gene Array Analysis Reveals Changes in Peripheral Nervous System Gene Expression following Stimuli That Result in Reactivation of Latent Herpes Simplex Virus Type 1: Induction of Transcription Factor Bcl-3. J. Virol.
75: 9909-9917
[Abstract]
[Full Text]
-
Advani, S. J., Hagglund, R., Weichselbaum, R. R., Roizman, B.
(2001). Posttranslational Processing of Infected Cell Proteins 0 and 4 of Herpes Simplex Virus 1 Is Sequential and Reflects the Subcellular Compartment in Which the Proteins Localize. J. Virol.
75: 7904-7912
[Abstract]
[Full Text]
-
Ehmann, G. L., Burnett, H. A., Bachenheimer, S. L.
(2001). Pocket Protein p130/Rb2 Is Required for Efficient Herpes Simplex Virus Type 1 Gene Expression and Viral Replication. J. Virol.
75: 7149-7160
[Abstract]
[Full Text]
-
Flemington, E. K.
(2001). Herpesvirus Lytic Replication and the Cell Cycle: Arresting New Developments. J. Virol.
75: 4475-4481
[Full Text]
-
Rodriguez, A., Jung, E. J., Flemington, E. K.
(2001). Cell Cycle Analysis of Epstein-Barr Virus-Infected Cells following Treatment with Lytic Cycle-Inducing Agents. J. Virol.
75: 4482-4489
[Abstract]
[Full Text]
-
Hobbs, W. E., Brough, D. E., Kovesdi, I., DeLuca, N. A.
(2001). Efficient Activation of Viral Genomes by Levels of Herpes Simplex Virus ICP0 Insufficient To Affect Cellular Gene Expression or Cell Survival. J. Virol.
75: 3391-3403
[Abstract]
[Full Text]
-
Advani, S. J., Weichselbaum, R. R., Roizman, B.
(2000). E2F Proteins Are Posttranslationally Modified Concomitantly with a Reduction in Nuclear Binding Activity in Cells Infected with Herpes Simplex Virus 1. J. Virol.
74: 7842-7850
[Abstract]
[Full Text]
-
Lieu, P. T., Wagner, E. K.
(2000). The Kinetics of VP5 mRNA Expression Is Not Critical for Viral Replication in Cultured Cells. J. Virol.
74: 2770-2776
[Abstract]
[Full Text]
-
Schang, L. M., Hwang, G.-J. H., Dynlacht, B. D., Speicher, D. W., Bantly, A., Schaffer, P. A., Shilatifard, A., Ge, H., Shiekhattar, R.
(2000). Human PC4 Is a Substrate-specific Inhibitor of RNA Polymerase II Phosphorylation. J. Biol. Chem.
275: 6071-6074
[Abstract]
[Full Text]