Previous Article | Next Article 
Journal of Virology, October 1999, p. 8541-8548, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Prevention of Encephalomyocarditis Virus-Induced Diabetes in Mice
by Inhibition of the Tyrosine Kinase Signalling Pathway and
Subsequent Suppression of Nitric Oxide Production in
Macrophages
K.
Hirasawa,1
H. S.
Jun,1
H. S.
Han,1
M. L.
Zhang,1
M. D.
Hollenberg,2 and
J. W.
Yoon1,3,*
Laboratory of Viral and Immunopathogenesis of
Diabetes, Julia McFarlane Diabetes Research Centre, Department of
Microbiology and Infectious Diseases,1 and
Endocrine Research Group, Department of Pharmacology and
Therapeutics, and Department of Medicine, Faculty of
Medicine,2 University of Calgary, Calgary,
Alberta, Canada, and Laboratory of Endocrinology, Institute for
Medical Science, Department of Endocrinology and Metabolism, School
of Medicine, Ajou University, Suwon, Korea3
Received 18 March 1999/Accepted 16 June 1999
 |
ABSTRACT |
Macrophages comprise the major population of cells infiltrating
pancreatic islets during the early stages of infection in DBA/2 mice by
the D variant of encephalomyocarditis virus (EMC-D virus). Inactivation
of macrophages prior to viral infection almost completely prevents
EMC-D virus-induced diabetes. This investigation was initiated to
determine whether a tyrosine kinase signalling pathway might be
involved in the activation of macrophages by EMC-D virus infection and
whether tyrosine kinase inhibitors might, therefore, abrogate EMC-D
virus-induced diabetes in vivo. When isolated macrophages were infected
with EMC-D virus, inducible nitric oxide synthase mRNA was expressed
and nitric oxide was subsequently produced. Treatment of macrophages
with the tyrosine kinase inhibitor tyrphostin AG126, but not tyrphostin
AG556, prior to EMC-D virus infection blocked the production of nitric
oxide. The infection of macrophages with EMC-D virus also resulted in the activation of the mitogen-activated protein kinases (MAPKs) p42MAPK/ERK2/p44MAPK/ERK1, p38MAPK,
and p46/p54JNK. In accord with the greater potency of AG126
than of AG556 in blocking EMC-D virus-mediated macrophage activation,
the incidence of diabetes in EMC-D virus-infected mice treated with
AG126 (25%) was much lower than that in AG556-treated (75%) or
vehicle-treated (88%) control mice. We conclude that EMC-D
virus-induced activation of macrophages resulting in
macrophage-mediated
-cell destruction can be prevented by the
inhibition of a tyrosine kinase signalling pathway involved in
macrophage activation.
 |
INTRODUCTION |
Insulin-dependent diabetes mellitus
(IDDM), also known as type 1 diabetes, results from the destruction of
pancreatic
cells (27, 31). Genetic and environmental
factors are believed to be involved in the pathogenesis of IDDM
(24, 25, 30). Viral infection is one environmental factor
considered to play a role in this disease. Among the viruses implicated
in the development of IDDM, the most clear and unequivocal evidence
that a virus induces the disease comes from studies on the D variant of
encephalomyocarditis (EMC) virus (EMC-D virus) in mice (7,
34) and Kilham rat virus in rats (6, 11). In
genetically susceptible strains of mice, EMC-D virus causes diabetes by
the selective destruction of
cells.
The molecular identification of the EMC virus genes responsible for the
induction of diabetes (16, 17, 29) and the genetic factors
of the host (19, 32) have been extensively studied. However,
the molecular immune mechanisms involved in the pathogenesis of
diabetes in EMC virus-infected mice remain to be determined. Earlier
studies showed that the selective infection of pancreatic
cells
with EMC-D virus leads to the recruitment of macrophages into the
islets followed by infiltration of T lymphocytes (1). Depletion of macrophages prior to infection of mice with a low dose of
EMC-D virus resulted in the prevention of diabetes (2, 14). In contrast, the incidence of diabetes increased when
macrophages were activated prior to viral infection (2).
The depletion of T lymphocytes failed to alter the incidence of
diabetes in EMC-D virus-infected mice (33). These results
indicate that macrophages play a primary role in the destruction of
cells in mice infected with a low dose of EMC-D virus.
Our recent study showed that macrophages activated by EMC-D virus in
vivo produce the soluble mediators interleukin-1
(IL-1
), tumor
necrosis factor alpha (TNF-
), and inducible nitric oxide synthase
(iNOS), which play an important role in the destruction of
cells
(12). However, the mechanisms that activate macrophages are
not known. This investigation was initiated to determine whether a
tyrosine kinase signal pathway might be involved in the EMC-D virus-induced activation of macrophages in vitro and, if so, whether the administration of a tyrosine kinase inhibitor in vivo might protect
against EMC-D virus-induced diabetes. For our study, we focused on the
tyrosine kinase inhibitors tyrphostin AG126 and tyrphostin AG556
(hereafter referred to simply as AG126 and AG556), which have been
shown to prevent lipopolysaccharide (LPS)-induced lethal toxicity
either in mice (23) or dogs (28), respectively. We now report that AG126 prevents EMC-D virus-mediated macrophage activation in vitro. Further, when administered in vivo prior to
infection of DBA/2 mice with EMC-D virus, AG126 led to a reduction of
-cell destruction and a reduction in the incidence of diabetes. This
result suggests that a tyrosine kinase signalling pathway involved in
the EMC-D virus-induced activation of macrophages plays a role in
macrophage-dependent
-cell destruction, leading to the development
of diabetes in mice.
 |
MATERIALS AND METHODS |
Virus.
The source and preparation of EMC virus have been
described elsewhere (13, 35, 36). The virus was purified by
CsCl2 gradient centrifugation from a supernatant of L929
cell culture infected with plaque-purified EMC-D virus.
Mice.
DBA/2 mice were obtained from Jackson Laboratory (Bar
Harbor, Maine). The animals were housed in an animal facility at the Health Science Centre, University of Calgary, Calgary, Alberta, Canada.
Eight-week-old male mice were used for in vitro and in vivo experiments.
Reagents.
The tyrosine kinase inhibitors AG126, AG556,
herbimycin A, and genistein were purchased from Calbiochem Inc. (La
Jolla, Calif.). LPS from Escherichia coli O26:86 was
purchased from Sigma Chemical Co. (St. Louis, Mo.).
Macrophage preparation and infection.
Peritoneal macrophages
were harvested from DBA/2 mice 4 days after intraperitoneal injection
of 2 ml of 3% thioglycolate (Difco Laboratories, Detroit, Mich.).
Cells were washed twice and resuspended in RPMI 1640 medium
supplemented with 5% fetal calf serum, 2 mM L-glutamine,
50 U of penicillin per ml, and 50 µg of streptomycin per ml. Cells
were plated at 2 × 106 cells per well in 24-well
plates (for analysis of nitric oxide [NO] release and virus
replication) or at 107 cells in 60-mm dishes, (or reverse
transcriptase-PCR [RT-PCR] and Western blot analyses). Cells were
cultured for 2 h at 37°C in 5% CO2 and then washed
three times to remove nonadherent cells. More than 95% of the adherent
cells were determined to be macrophages on the basis of morphologic
criteria. Cells were infected with EMC virus at a multiplicity of
infection (MOI) of 5 or stimulated with 1 µg of LPS per ml. For
experiments with tyrosine kinase inhibitors, cells were pretreated with
the inhibitors for 2 h and then washed three times before EMC
virus infection.
RT-PCR.
The total RNA was extracted from macrophages or
pancreatic cells from DBA/2 mice with Trizol reagent (Gibco BRL Life
Technologies Inc., Gaithersburg, Md.). The cDNA was synthesized with 4 µg of RNA in 20 µl of reaction mixture containing 50 pmol of
oligo(dT)12-18 primer, 10 mM dithiothreitol, 75 mM KCl, 50 mM Tris-HCl (pH 8.3), 5 mM MgCl2, 15 U of RNase inhibitor,
0.2 mM each deoxynucleoside triphosphate, and 20 U of Moloney murine
leukemia virus reverse transcriptase (Gibco BRL). PCR was performed
with 1 µl of cDNA with pairs of oligonucleotide primers corresponding
to the cDNA sequences. The following oligonucleotide sequences were
used: for
-actin, GTTACCAACTGGGACGACA and
TTCGAGCAGGAGATGGCCA; for IL-1
,
GGAATGACCTGTTCTTTGAAGTT and GGCTCCGAGATGAACAACAAAA;
for TNF-
, CTTAGACTTTGCGGAGTCCG and
GGGACAGTGACCTGGACTGT; for iNOS, GCATGGACCAGTATAAGGCAAGAC and TTGCTCATGACATCGACCAGAAGC;
and for EMC virus VP1, GGAGTTGAGAATGCTGAGAGAGGGGTT and
GGAATTCATTCCAGCATAAGGACTCCAGCTCTCTCGG (25 cycles). PCR
amplification was carried out in 50 µl of the reaction mixture
containing 50 pmol of sense and antisense primer, 0.2 mM
deoxynucleoside triphosphate, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, and 0.1% Triton X-100, with denaturation at
94°C for 1 min, annealing at 60°C (IL-1
, TNF-
, iNOS, and
-actin) or 55°C (EMC virus VP1), and extension at 72°C, using a
DNA thermal cycler (Perkin-Elmer Cetus, Norwalk, Conn.). The products
were separated by electrophoresis on a 1.5% agarose gel and detected
by ethidium bromide staining.
NO assay.
NO formation was measured as the stable end
product nitrite (NO2
) in culture supernatants
with the Griess reagent (10). Briefly, 100 µl of culture
supernatant was added to each well of 96-well plates and mixed with the
same volume of Griess reagent [0.1% N-(1-naphthyl)ethylenediamine dihydrochloride in
H2O, 1% sulfanilamide in 5%
H3PO4], and the optical density at 540 nm was
read with a Biokinetics reader (Mandel Scientific Co. Ltd., Guelph,
Ontario, Canada).
Measurement of virus replication.
The virus concentrations
of the culture supernatants and the pancreatic tissues from EMC
virus-infected mice were determined by plaque assay using L929 cells as
described previously (13, 36).
Western blot analysis.
Macrophages were lysed in lysis
buffer (50 mM Tris [pH 7.6], 1% Nonidet P-40, 150 mM
NaCl, 50 mM NaF, 1 mM Na3VO4, 5 mM EDTA, 1 mM
phenylmethlsulfonyl fluoride, 10 µg of aprotinin per ml) at 4°C for
30 min. Lysates were cleared of debris by centrifugation at 12,000 × g for 20 min. Samples were analyzed by electrophoresis using 10% sodium dodecyl sulfate-polyacrylamide gels followed by
transfer to nitrocellulose membranes (Amersham Life Science Inc.,
Oakville, Ontario, Canada). The membrane was blocked with 5% bovine
serum albumin in Tris-buffered saline containing 0.1% Tween 20 and
then incubated with antiphosphotyrosine monoclonal antibody 4G10
(Upstate Biotechnology, Lake Placid, N.Y.), anti-p38 mitogen-activated
protein kinase (MAPK) phosphospecific antibody, anti-SAPK/JNK
phosphospecific antibody, anti-extracellular signal-regulated kinase
1/2 (ERK1/2) phosphospecific antibody (Calbiochem, La Jolla, Calif.),
anti-ERK2 antibody (Santa Cruz Biotechnology, Santa Cruz, Calif.), or
polyclonal anti-EMC-D virus antibodies obtained from EMC-D
virus-infected mice. After washing, the membrane was incubated with
peroxidase-conjugated goat anti-mouse or anti-rabbit antibody, and
specific bands were detected with an enhanced chemiluminescence detection system (Amersham).
Treatment of EMC virus-infected DBA/2 mice with tyrosine kinase
inhibitors.
Male DBA/2 mice infected with EMC virus (50 PFU/mouse)
were injected intraperitoneally with 400 µg of tyrosine kinase
inhibitor (AG126 or AG556) in 100 µl of 10% dimethyl sulfoxide
(DMSO)-phosphate-buffered saline (PBS). As a control, 100 µl of 10%
DMSO-PBS was injected into male DBA/2 mice. Daily administration of
tyrosine kinase inhibitor or 10% DMSO-PBS was initiated on the same
day as EMC virus infection and continued for 9 days. Blood glucose was
measured at 3, 5, 7 and 9 days postinfection. RT-PCR analyses of
cytokines and iNOS in the pancreas were performed 5 days postinfection, and viral titers in the pancreatic cells were determined 4 and 5 days
postinfection. Histological examination of the pancreatic cells was
performed 12 days postinfection.
Measurement of blood glucose.
Blood glucose levels of
nonfasting mice were measured with a one-touch Basic glucometer
(Lifescan, Burnaby, British Columbia, Canada). The mean blood glucose
level of 43 uninfected DBA/2 male mice was 132 ± 15 mg/dl
(mean ± standard deviation [SD]). In this experiment,
nonfasting animals with blood glucose levels greater than 177 mg/dl (3 SD above the mean) were scored as diabetic.
Histological examination.
Eight mice per group were
sacrificed at 12 days postinfection, and each pancreas was fixed in
10% buffered neutral formalin. Paraffin-embedded sections were stained
with hematoxylin and eosin and examined. Histological changes of the
pancreatic islets were classified as peri-islet infiltration, mild to
moderate insulitis, severe insulitis, and atrophied morphology. The
islets with peri-islet infiltration had infiltrating mononuclear cells
around them. The architecture of islets having mild to moderate
insulitis was well preserved, but 1 to 49% of these islets exhibited
lymphocytic infiltration within the islets. Severe insulitis was
characterized by morphological damage to the pancreatic
cells, with
50 to 100% of these islets exhibiting lymphocytic infiltration. Islets with atrophied morphology were small and retracted, exhibiting severe
-cell necrosis with or without residual lymphocytic infiltration.
Statistical analysis.
Statistical analysis was conducted by
Student's t test or Kruskal-Wallis one-way analysis of
variance on ranks.
 |
RESULTS |
EMC-D virus-induced activation of macrophages, cytokine and iNOS
gene expression, and production of NO.
To determine whether EMC-D
virus can infect macrophages, we isolated peritoneal macrophages
from DBA/2 mice, inoculated the macrophages with EMC-D virus,
and examined the EMC-D viral RNA in the macrophages, using RT-PCR
at different times after inoculation. We found that viral RNA was
detectable in macrophages within 30 min after infection. At 6 and
12 h after infection, there was a marked increase in viral RNA,
indicating new RNA synthesis (Fig. 1A).
As controls, we inoculated L929 cells with EMC-D virus and examined the
expression of EMC-D viral RNA. The amounts of EMC-D viral RNA seen
between 6 and 24 h after infection were much higher than those
detected in EMC-D virus-infected macrophages (Fig. 1A).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 1.
(A) RT-PCR analysis of EMC virus RNA and -actin mRNA
in L929 cells and macrophages; (B) EMC-D virus replication in
macrophages and L929 cells. (A) RNA was isolated from EMC-D
virus-infected L929 cells and macrophages at 0, 0.5, 2, 6, 12, 18 and
24 h post-EMC-D virus infection and analyzed by RT-PCR. (B)
Triplicate culture supernatants of macrophages ( ) and L929 cells
( ) infected with EMC-D virus at an MOI of 5, and culture medium
containing the same amount of virus without cells ( ), were harvested
at 6, 12, 18, 24 and 48 h postinfection. Virus concentration was
determined with a plaque assay on L929 cells. Bars represent SD.
|
|
To determine whether infection of macrophages by EMC-D virus results in
the production of progeny virus, we measured the amount of progeny
virus in the macrophage culture medium at various times after
infection. Viral progeny were hardly detected in the culture medium,
and the infectious virus titer was not increased from the time of the
inoculation (0 h) to the end of the experiment (48 h). In contrast,
viral titers from the EMC-D virus-infected L929 cell culture
supernatant continuously increased up to 24 h after infection.
(Fig. 1B).
To determine whether the failure of progeny viral production in EMC-D
virus-infected macrophages was due to a defect in the synthesis of
viral proteins, we measured the viral capsid proteins in the lysate of
the infected macrophages by Western blot analysis using antibodies
against EMC-D virus. Viral capsid proteins were hardly detected,
whereas significant amounts of EMC viral capsid proteins were detected
in the lysate of the infected L929 cells (data not shown). These
results indicate that EMC-D virus can infect macrophages and synthesize
viral RNA but cannot produce progeny virus, probably due to a defect in
viral protein synthesis. Thus, EMC-D virus does not lyse macrophages
but may activate them.
To determine whether the activation of macrophages by EMC-D virus
results in macrophage-derived cytokine or iNOS gene expression, we
measured levels of IL-1
, TNF-
, and iNOS mRNAs in EMC-D
virus-infected macrophages at various times after infection. As
controls, we measured expression of the same genes in LPS-stimulated
macrophages. We found that IL-1
, TNF-
, and iNOS mRNAs were
clearly detected in the LPS-treated macrophages from 2 to 6 h
after stimulation (Fig. 2A). TNF-
mRNA
was not detected thereafter, but IL-1
and iNOS mRNAs remained at the
same level at the termination of the experiment at 24 h (Fig. 2A).
In contrast, EMC-D virus-infected macrophages produced undetectable
amounts of TNF-
and IL-1
mRNAs, but iNOS mRNA was clearly
expressed from 4 h after infection to the end of the experiment at
24 h (Fig. 2A). This result showed that EMC-D virus can activate
macrophages directly and induce the expression of iNOS, but not TNF-
or IL-1
, mRNA.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
(A) RT-PCR analysis of TNF- , IL-1 , iNOS, and
-actin mRNAs in macrophages infected with EMC-D virus (MOI = 5)
or stimulated with LPS (1 mg/ml). RNA was isolated from the cells at 0, 2, 4, 6, 12, and 24 h after EMC-D virus infection or LPS
stimulation and analyzed by RT-PCR. (B) Kinetics of NO production in
uninfected macrophages ( ) and macrophages infected with EMC-D virus
( ). At the indicated time intervals, triplicate samples were removed
for nitrite determination by Griess assay. Bars represent SD.
|
|
To determine whether the expression of iNOS mRNA in EMC-D
virus-infected macrophages results in the production of NO, we measured the production of NO at various times after infection with EMC-D virus.
Increased levels of NO production were observed, with a clear elevation
at 12 h and a marked elevation at 48 h (Fig. 2B).
Involvement of tyrosine kinase signalling pathways in the
production of NO in EMC-D virus-infected macrophages.
To determine
whether tyrosine kinase signalling pathways might be involved in the
production of NO in EMC-D virus-activated macrophages, we examined the
effects of tyrosine kinase inhibitors AG126 and AG556 on the production
of NO in macrophages infected with EMC-D virus. We found that the
treatment with AG126 resulted in a significant reduction of NO
production, whereas treatment with AG556 had little effect (Fig.
3A). In contrast, NO production was
inhibited in an LPS-stimulated macrophage cell line (RAW246) treated
with AG556 (data not shown). To determine whether other tyrosine kinase
inhibitors also inhibit NO production in isolated macrophages, we
measured NO production in EMC-D virus-activated macrophages that were
treated with herbimycin A or genistein. We found that NO production in
these macrophages was clearly inhibited in a concentration-dependent
manner by these inhibitors (Fig. 3B).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of tyrosine kinase inhibitors on NO production
of macrophages infected with EMC-D virus. Peritoneal macrophages were
infected with EMC-D virus (MOI = 5) in the presence of AG126 or
AG556 (A) herbimycin A or genistein (B) with 2 h of preincubation.
DMSO was added as a control. At 24 h postinfection, NO production
was determined from triplicate samples. Bars represent SD. *,
P < 0.01 by Student's t test.
|
|
Since the tyrosine kinase inhibitors suppressed the EMC-D
virus-mediated production of NO in the activated macrophages, we hypothesized that EMC-D virus may induce tyrosine phosphorylation of
host proteins in the infected macrophages. To determine whether infection of macrophages by EMC-D virus might result in the induction of tyrosine phosphorylation, we examined the tyrosine-phosphorylated proteins in EMC-D virus-infected macrophages by Western blot analysis using an antiphosphotyrosine antibody. We found that the
phosphorylation of 44- and 42-kDa proteins was significantly increased
from 5 to 7 h after EMC-D virus infection (Fig.
4A). Because MAPKs (or ERKs) can become
phosphorylated upon cell activation and since p42MAPK/ERK2
and p44MAPK/ERK1 have molecular masses of 42 and 44 kDa,
respectively, we performed Western blot analysis with
anti-phosphospecific ERK1/2 antibody to determine whether the 42- and
44-kDa phosphorylated might actually be ERKs. We found that
the phosphorylation and activation of p42MAPK/ERK2
and p44MAPK/ERK1 were clearly increased in the
macrophages at 5 h after EMC-D virus infection, indicating
that the 42- and 44-kDa tyrosine-phosphorylated proteins (Fig. 4A)
were p42MAPK/ERK2 and p44MAPK/ERK1,
respectively (Fig. 4B). In addition, we examined other members of the
MAPK family. We found that p38MAPK and
p46/p54JNK were also activated at 5 h after EMC-D
virus infection (Fig. 4C and D, respectively). Western blot analysis
using anti-total ERK2 antibody revealed that all samples
contained comparable amounts of protein (Fig. 4E).

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 4.
Western blot analysis of protein tyrosine
phosphorylation (A), phosphorylated p42MAPK/ERK2 and
p44MAPK/ERK1 (B), phosphorylated p38MAPK (C),
phosphorylated p46/p54JNK (D), and total ERK (E) of
macrophages during EMC-D virus infection. Cell lysates were blotted
with (A) antiphosphotyrosine monoclonal antibody 4G10 (A),
antiphosphospecific ERK1/2 antibody (B), anti-phosphospecific p38
antibody (C), anti-phosphospecific SAPK/JNK antibody (D), and anti-ERK2
antibody (E). Extracts were prepared from uninfected cells at 0.5 (0.5C) and 7 (7C) h and from EMC-D virus-infected cells at 0.5, 1, 3, 5, and 7 h after infection. The double-headed arrow indicates the
region of phosphorylated proteins. Positions of size markers and
proteins are indicated in kilodaltons on the left and right,
respectively.
|
|
To determine whether AG126 and AG556 suppress the activation of MAPKs,
the phosphorylation of p42MAPK/ERK2,
p44MAPK/ERK1, p38MAPK, and
p46/p54JNK was examined in EMC-D virus-infected macrophages
treated with AG126 or AG556. We found that AG556 was more effective
than AG126 in inhibiting the phosphorylation of
p42MAPK/ERK2 and p44MAPK/ERK1, whereas
AG126 was slightly more effective than AG556 in inhibiting the
phosphorylation of p38MAPK. The two drugs appeared equally
effective in reducing the phosphorylation of p46/p54JNK
(Fig. 5A). We also found that herbimycin
and genistein were effective in inhibiting the phosphorylation of
p42MAPK/ERK2, p44MAPK/ERK1,
p38MAPK, and p46/p54JNK at the higher of the
two doses used (Fig. 5B).

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of AG126 and AG556 (A) and herbimycin A and
genistein (B) on the phosphorylation of MAPKs in macrophages infected
with EMC-D virus. Extracts were prepared from uninfected cells (lanes
C), infected cells (lanes E), and infected cells treated with 10 (126/10) or 50 (126/50) µM AG126, 10 (556/10) or 50 (556/50) µM
AG556, 5 (H5) or 20 (H20) µM herbimycin A, or 5 (G5) or 12 (G12) µg
of genistein per ml. Western blot analyses were performed with
phosphospecific antibodies against ERK1/2 (p-Erk), p38 (p-p38), and
SAPK/JNK (p-JNK) and antibody against ERK2 (t-Erk2). Sizes are
indicated kilodaltons on the right.
|
|
Prevention of EMC-D virus-induced diabetes in DBA/2 mice by
AG126.
Since the tyrosine kinase inhibitor AG126 blocked
macrophage activation in vitro and since macrophages play a critical
role in the EMC-D virus-mediated destruction of pancreatic
cells in
vivo, we examined whether the in vivo administration of AG126 might
prevent EMC-D virus-induced diabetes in DBA/2 mice. We found that the
incidence of diabetes was significantly decreased in mice treated with
AG126. Twenty-five percent of the mice treated with AG126 (Fig.
6B) and approximately 88% of mice
treated with 10% DMSO-PBS (vehicle) (Fig. 6A) developed diabetes 9 days after EMC-D virus infection. In contrast with AG126, AG556 did not
suppress the production of NO in the EMC-D virus-infected macrophages
in vitro (Fig. 3A). Thus, we were interested in determining the effect of AG556 on the EMC-D virus-induced diabetes in DBA/2 mice. We found
that AG556 treatment failed to prevent EMC-D virus-induced diabetes
(Fig. 6C). There was no significant difference in the incidence of
diabetes between the AG556-treated group (75%) and the vehicle-treated
control group (88%).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of tyrosine kinase inhibitors AG126 and AG556 on
the development of EMC-D virus-induced diabetes in DBA/2 mice. Mice
were treated with 10% DMSO-PBS (A) or 400 µg of AG126 (B) or AG556
(C) every day. Each circle represents an individual animal. The shaded
area shows the mean blood glucose level ± 3 SD of the value for
uninfected control mice (P < 0.05 compared with 10%
DMSO-PBS- or AG556-treated mice at 5, 7, and 9 days after infection,
using Kruskal-Wallis one-way analysis of variance on ranks).
|
|
Examination of pancreatic islet architecture revealed a significant
reduction in
-cell destruction and mononuclear cell infiltration when mice were treated with AG126. The majority (75%) of examined islets from AG126-treated mice showed only mild to moderate insulitis with peri-islet infiltration, while 23% showed severe insulitis and
2% showed an atrophied morphology. In contrast, only 16% of examined
islets from vehicle-treated control mice showed mild to moderate
insulitis, while 49% showed severe insulitis and 35% showed an
atrophied morphology. The islet histopathology seen in AG556-treated
mice was similar to that seen in the vehicle-treated control mice (Fig.
7; Table
1). This result indicated that the tyrosine kinase inhibitor AG126 substantially prevented the destruction of
cells, resulting in the prevention of diabetes, while AG556 did
not confer this preventative effect.

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 7.
Pancreatic islets of EMC-D virus-infected mice treated
with AG126 (A), AG556 (B), or 10% DMSO-PBS (C) at 12 days
postinfection (hematoxylin and eosin staining).
|
|
To determine whether there was any difference in viral replication in
pancreatic islets between AG126- and vehicle-treated mice, we measured
infectious virus titers in the pancreatic tissues of AG126- and
vehicle-treated mice at 4 and 5 days after infection. We found that
there was no significant difference in the viral concentration between
AG126- and vehicle-treated mice at day 4 (7.06 ± 0.07 and
7.49 ± 0.23 log10 PFU/g of tissue [mean ± SD], respectively) or day 5 (6.47 ± 0.34 and 6.47 ± 0.26 log10 PFU/g of tissue, respectively) after infection. These
results indicate that the prevention of diabetes in AG126-treated mice
is not due to the inhibition of viral replication.
Effect of AG126 on expression of IL-1
, TNF-
and iNOS mRNAs in
pancreatic tissue infected with EMC-D virus.
To determine whether
treatment with AG126 might affect the expression of macrophage-derived
cytokines and iNOS in pancreatic islets from EMC-D virus-infected mice,
we analyzed the expression of IL-1
, TNF-
, and iNOS in the
pancreatic tissue of 10% DMSO-PBS- and AG126-treated, EMC-D
virus-infected mice at 5 days postinfection by RT-PCR. We found that
the expression of iNOS mRNA was clearly suppressed in the pancreatic
tissue of AG-126-treated mice compared with that in the pancreatic
tissue of vehicle-treated mice; the expression of IL-1
and TNF-
also appeared to be reduced (Fig. 8).
This result indicates that AG126 not only suppressed the expression of
iNOS but also attenuated the induction of mRNA for cytokines such as
IL-1
and TNF-
in the pancreatic islet infiltrates of mice
infected with EMC-D virus.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 8.
RT-PCR analysis of IL- , TNF- , iNOS, and -actin
mRNA expression in the pancreas of mice infected with EMC-D virus at 5 days postinfection. RNA was isolated from the pancreatic tissue of an
uninfected mouse (lane C), nondiabetic EMC-D virus-infected,
AG126-treated mice (lanes 1 to 3), nondiabetic EMC-D virus-infected,
10% DMSO-PBS-treated mice (lanes 1, 2, 3, and 5), and diabetic EMC-D
virus-infected, 10% DMSO-PBS-treated mice (lane 4).
|
|
 |
DISCUSSION |
Infection of DBA/2 mice with a high dose (5 × 105 PFU/mouse) of the diabetogenic EMC-D virus results in
the rapid destruction of pancreatic
cells and the development of
diabetes within 4 days (34). However, infection of mice with
a lower dose (102 PFU) of EMC-D virus results in a
significant decrease in the incidence of diabetes and delay in the
onset of the disease (1, 2). In mice infected with the lower
dose of EMC-D virus, macrophages play a critical role in the
destruction of pancreatic
cells, as activation of macrophages prior
to viral infection results in a significant increase in the incidence
of diabetes and inactivation of macrophages prior to viral infection
almost completely prevents EMC-D virus-induced diabetes (2,
14). Our additional studies showed that the selective EMC-D viral
infection of pancreatic
cells results in an initial recruitment of
macrophages into the islets, followed by infiltration of other
immunocytes including T cells, NK cells, and B cells (1). In
the pancreatic islets containing activated macrophages, there is
production of soluble mediators such as NO, IL-1
, and TNF-
that
contribute to the destruction of pancreatic
cells, resulting in the
development of diabetes in mice infected with a low dose of EMC-D
virus. However, it was not known whether macrophages are directly
activated by the virus and produce such soluble mediators when
infected with EMC-D virus in vitro. Thus, we infected isolated
peritoneal macrophages with EMC-D virus in vitro and examined the
expression of IL-1
, TNF-
, and iNOS mRNAs. We found that iNOS mRNA
expression and NO production were induced, whereas the expression of
TNF-
and IL-1
mRNA was undetectable. This result differed from
our previous observation that the expression of TNF-
and IL-1
as
well as iNOS was clearly increased in macrophages that
infiltrated the pancreatic islets in vivo. There may be differences in
the induction of cytokines from macrophages between in vitro (isolated,
infected with EMC-D virus in vitro) and in vivo (macrophages present in the target tissue along with other immunocytes) conditions.
Nevertheless, NO was a consistent product of infected macrophages in
both in vivo and in vitro conditions.
NO is known to play an important role in the progression of
inflammation in the pancreatic islets and the destruction of
cells,
resulting in the development of diabetes in mice (8, 26).
Exogenous and endogenous NO has been shown to induce apoptosis in
isolated rat pancreatic islet cells as well as in the HIT pancreatic
cell line (18). In addition, the NO-mediated
upregulation of fas in pancreatic
cells significantly
contributes to their destruction. In animal models of spontaneous IDDM,
BioBreeding (BB) rats and nonobese diabetic mice, NO has been shown to
contribute to pancreatic
-cell destruction. In BB rats, iNOS mRNA is
highly expressed in inflammatory cells in the pancreatic islets
(20). Treatment of BB rats with
N-nitro-L-arginine methyl ester, an NOS
inhibitor, results in a significant decrease in the incidence of
diabetes (21). Treatment of nonobese diabetic mice with the iNOS inhibitor aminoguanidine caused a delay in the onset of diabetes in adoptive-transfer models (3). Our recent study also
showed that treatment of DBA/2 mice with the iNOS inhibitor
aminoguanidine resulted in a significant decrease in the incidence of
EMC-D virus-induced diabetes (12). In addition to
contributing to
-cell destruction, NO can enhance the activity
of cyclooxygenases 1 and 2 so as to augment the production of
prostaglandins and thromboxanes, resulting in an acceleration of the
inflammatory response (21).
Recent studies have reported that the induction of tyrosine
phosphorylation by viral infection may play a role in the generation of
inflammatory mediators by immune cells. For instance, astrocytes stimulated with Newcastle disease virus produce TNF-
via a
tyrosine kinase signalling pathway (9), and adenovirus
infection stimulates the Raf-MAPK signalling pathway and induces the
expression of IL-8 in HeLa cells (4). Thus, we examined
whether inhibition of tyrosine phosphorylation would suppress the
production of NO in EMC-D virus-infected macrophages in vitro. We
found that the treatment of isolated macrophages with the
tyrosine kinase inhibitors AG126, herbimycin A, or genistein prior to
EMC-D virus infection resulted in the suppression of NO production.
This result indicated that EMC virus infection activates a tyrosine
kinase signalling pathway involved in iNOS mRNA expression and NO
production in macrophages. However, AG556, which is more lipophilic
than AG126, failed to inhibit the production of NO in EMC-D
virus-infected macrophages although AG556 blocked the NO production by
LPS-stimulated macrophages. The differential effects of AG126 and AG556
in blocking iNOS induction in LPS- and virus-stimulated cells suggest
that different tyrosine kinase signalling pathways may be activated by
EMC-D virus and LPS.
We next examined the tyrosine-phosphorylated proteins in EMC-D
virus-infected macrophages by Western blot analysis using
antiphosphotyrosine antibodies. We found that proteins with molecular
masses of 38 to 46 kDa were tyrosine phosphorylated. We went on to show
that viral infection caused the activation of the MAPK family members; p42MAPK/ERK2, p44MAPK/ERK1,
p38MAPK, and p46/p54JNK. These results indicate
that the EMC-D virus can activate MAPK signal pathways kinases,
including those which may be involved in the induction of iNOS in
macrophages. A causative role for p46/p54JNK in the
induction of iNOS in TNF-
and gamma interferon-stimulated macrophages has recently been established (5). It was also reported that echovirus 1 can induce the phosphorylation of
p42MAPK/ERK2 and p44MAPK/ERK1 as well as
p38MAPK (15). In our study, we found a
differential action between AG126 and AG556 on the phosphorylation of
MAPKs. AG556 was more effective than AG126 in inhibiting the
phosphorylation of p42MAPK/ERK2 and
p44MAPK/ERK1, whereas AG126 was slightly more effective
than AG556 in inhibiting the phosphorylation of p38MAPK. We
do not know whether these differences are sufficient to account for our
observation that AG126 could inhibit NO production in EMC-D-infected
macrophages whereas AG556 could not, as there may be other differential
effects of AG126 and AG556 on other tyrosine kinase signalling pathways
not measured in these experiments. This possibility is presently under investigation.
Given the substantial evidence linking NO production to
-cell
destruction, we hypothesized that the suppression of NO production in
macrophages by a tyrosine kinase inhibitor might prevent the development of EMC-D virus-induced diabetes in vivo. Thus, we tested
the effect of AG126 on the development of diabetes in DBA/2 mice
infected with a low dose of EMC-D virus. We found that the incidence of
diabetes dramatically decreased in mice treated with AG126. Twenty-five
percent of AG126-treated mice and 88% of the vehicle-treated controls
became diabetic. In contrast, a related tyrosine kinase inhibitor,
AG556, which failed to suppress the production of NO in infected
macrophages in vitro, failed to prevent diabetes when given to EMC-D
virus-infected DBA/2 mice. The level of iNOS mRNA in AG126-treated mice
that developed diabetes at 7 days after infection was similar to that
in 10% DMSO-PBS-treated diabetic mice (data not shown). Thus, the
suppression of macrophage-derived NO in vitro and the prevention of
diabetes are strongly correlated.
In our previous study, we showed that macrophages infiltrating the
pancreatic islets express IL-1
, TNF-
, and iNOS mRNAs and that
mice treated with antibodies against IL-1
or TNF-
or with the
iNOS inhibitor aminoguanidine exhibited a significant decrease in the
incidence of diabetes (12). Furthermore, mice treated with a
combination of anti-IL-1
antibody, anti-TNF-
antibody, and
aminoguanidine showed a lower incidence of diabetes than mice treated
with any of these agents alone (12). Thus, we tested whether
the expression of IL-1
, TNF-
, and iNOS mRNAs in the pancreatic
islets was also suppressed in the EMC-D virus-infected mice treated
with AG126. We found that the expression of these cytokine genes
(IL-1
and TNF-
) and iNOS mRNA was clearly suppressed compared to
vehicle-treated controls. In our present study, iNOS mRNA (but not
IL-1
or TNF-
mRNA) was expressed in isolated macrophages infected
with EMC-D virus in vitro. However, IL-1
and TNF-
mRNAs as well
as iNOS mRNA was expressed in the pancreas after infection in vivo,
suggesting that the induction of cytokine gene expression in infected
macrophages may depend on the immune environment. Thus, the local
suppression of NO production in macrophage-infiltrated pancreatic
islets by treatment of mice with a tyrosine kinase inhibitor may result
in the reduction of mononuclear cell infiltration of the islets,
leading to the suppression of production of cytokines such as IL-1
and TNF-
by macrophages in the inhibitor-treated mice.
On the basis of these observations, we suggest that the infection of
macrophages in vivo with EMC-D virus results in a cascade of signalling
pathway kinase activation, induction of iNOS expression, NO production,
NO-mediated upregulation of fas, and fas-mediated apoptosis of pancreatic
cells, resulting in the development of
diabetes in DBA/2 mice infected with a low dose of EMC-D virus. Treatment of EMC-D virus-infected mice with tyrosine kinase inhibitors results in an inhibition of the tyrosine kinase signalling pathway, suppression of NO production, and prevention of macrophage-mediated
-cell destruction, leading to the prevention of EMC-D virus-induced diabetes.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the Medical Research
Council of Canada to J.W.Y. and M.D.H. and the Canadian Diabetes Association and the Korea Science and Engineering Foundation
(97-0403-0101-3) to J.W.Y., fellowships from the Japan Society for the
Promotion of Science for Japanese Junior Scientist to K.H., and
studentships from the Alberta Heritage Foundation for Medical Research
to H.S.H. J.W.Y. is a Heritage Medical Scientist awardee of the
Alberta Heritage Foundation for Medical Research. K.H. is a
postdoctoral research fellow.
We are grateful to Alex Levitzki and Aviv Gazit for help in obtaining
AG126 and AG556. We gratefully acknowledge the editorial assistance of
A. L. Kyle and Karen L. Clarke and the technical assistance of Joy
M. Goldberg and Lori D. Zbytnuik.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Viral Immunopathogenesis of Diabetes, Julia McFarlane Diabetes Research Centre, Faculty of Medicine, University of Calgary, 3330 Hospital Dr.
NW, Calgary, Alberta, Canada T2N 4N1. Phone: (403) 220-4569. Fax: (403)
270-7526. E-mail: yoon{at}ucalgary.ca.
 |
REFERENCES |
| 1.
|
Baek, H. S., and J. W. Yoon.
1990.
Role of macrophages in the pathogenesis of encephalomyocarditis virus-induced diabetes in mice.
J. Virol.
64:5708-5715[Abstract/Free Full Text].
|
| 2.
|
Baek, H. S., and J. W. Yoon.
1991.
Direct involvement of macrophages in the destruction of beta cells leading to development of diabetes in virus-infected mice.
Diabetes
40:1586-1596[Abstract].
|
| 3.
|
Bowman, M.,
O. Simell,
Z. Look,
R. Luchetta, and M. Atkinson.
1994.
Pharmacokinetic and therapeutic analysis of aminoguanidine.
Diabetes
43(Suppl. 1):235A.
|
| 4.
|
Bruder, J. T., and I. Kovesdi.
1997.
Adenovirus infection stimulates the Raf/MAPK signalling pathway and induces interleukin-8 expression.
J. Virol.
71:398-404[Abstract].
|
| 5.
|
Chan, E. D.,
B. W. Winston,
S. T. Uh,
M. W. Wynes,
D. M. Rose, and W. Riches.
1999.
Evaluation of the role of mitogen-activated protein kinases in the expression of inducible nitric oxide synthase by IFN-gamma and TNF-alpha in mouse macrophages.
J. Immunol.
162:415-422[Abstract/Free Full Text].
|
| 6.
|
Chung, Y. H.,
H. S. Jun,
K. Hirasawa,
B. R. Lee,
N. van Rooijen, and J. W. Yoon.
1997.
Role of macrophages and macrophage-derived cytokines in the pathogenesis of Kilham rat virus-induced autoimmune diabetes in diabetes-resistant BB rats.
J. Immunol.
159:446-471.
|
| 7.
|
Craighead, J. E., and M. F. McLane.
1968.
Diabetes mellitus: induction in mice by encephalomyocarditis virus.
Science
162:913-915[Abstract/Free Full Text].
|
| 8.
|
Faust, A.,
R. Kleemann,
H. Rothe, and H. Kolb.
1996.
Role of macrophages and cytokines in beta cell death, p. 47-56.
In
E. Shafrir (ed.), Lessons from animal diabetes VI. Birkhauser Boston, Cambridge, Mass.
|
| 9.
|
Fischer, S. N.,
Y. U. Kim, and M. L. Shin.
1994.
Tyrosine kinase activation by Newcastle disease virus is required for TNF- gene induction in astrocytes.
J. Immunol.
153:3210-3217[Abstract].
|
| 10.
|
Green, L. C.,
D. A. Wagner,
J. Goglowski,
P. L. Skipper,
J. S. Wishnok, and S. R. Tannenbaum.
1982.
Analysis of nitrate, nitrite, and [15N] nitrate in biological fluids.
Anal. Biochem.
126:131-138[Medline].
|
| 11.
|
Guberski, D. L.,
V. A. Thomas,
W. R. Shek,
A. A. Like,
E. S. Handler,
A. A. Rossini,
J. E. Wallace, and R. M. Welsh.
1991.
Induction of type I diabetes by Kilham's rat virus in diabetes-resistant BB/Wor rats.
Science
254:1010-1013[Abstract/Free Full Text].
|
| 12.
|
Hirasawa, K.,
H. S. Jun,
K. Maeda,
Y. Kawaguchi,
S. Itagaki,
T. Mikami,
H. S. Baek,
K. Doi, and J. W. Yoon.
1997.
Possible role of macrophage-derived soluble mediators in the pathogenesis of encephalomyocarditis virus-induced diabetes.
J. Virol.
71:4024-4031[Abstract].
|
| 13.
|
Hirasawa, K.,
M. Takeda,
S. Itagaki, and K. Doi.
1996.
Involvement of macrophages in the development of encephalomyocarditis virus (EMC)-induced diabetes.
Exp. Anim.
45:77-80[Medline].
|
| 14.
|
Hirasawa, K.,
S. Tsutsui,
M. Takeda,
M. Mizutani,
S. Itagaki, and K. Doi.
1996.
Depletion of Mac-1-positive macrophages protects DBA/2 mice from encephalomyocarditis virus-induced myocarditis and diabetes.
J. Gen. Virol.
77:737-741[Abstract/Free Full Text].
|
| 15.
|
Huttunen, P.,
T. Hyypia,
P. Vihnen,
L. Nissinen, and J. Heino.
1998.
Echovirus 1 infection induces both stress and growth-activated mitogen activated protein kinase pathways and regulates the transcription of cellular immediate early genes.
Virology
250:85-93[Medline].
|
| 16.
|
Jun, H. S.,
Y. Kang,
A. L. Notkins, and J. W. Yoon.
1997.
Gain or loss of diabetogenicity resulting from a single point mutation in recombinant encephalomyocarditis virus.
J. Virol.
71:9782-9785[Abstract].
|
| 17.
|
Jun, H. S.,
Y. Kang,
H. S. Yoon,
K. H. Kim,
A. L. Notkins, and J. W. Yoon.
1998.
Determination of encephalomyocarditis viral diabetogenicity by a putative binding site of the viral capsid protein.
Diabetes
47:576-582[Abstract].
|
| 18.
|
Kaneto, H.,
J. Fujii,
H. S. Seo,
K. Suzuki,
T. Matsuoka,
M. Nakamura,
H. Tatsumi,
Y. Yamasaki,
T. Kamada, and N. Taniguchi.
1995.
Apoptotic cell death triggered by nitric oxide in pancreatic beta-cells.
Diabetes
44:733-738[Abstract].
|
| 19.
|
Kang, Y., and J. W. Yoon.
1993.
A genetically determined host factor controlling susceptibility to encephalomyocarditis virus-induced diabetes in mice.
J. Gen. Virol.
74:1207-1213[Abstract/Free Full Text].
|
| 20.
|
Kleemann, R.,
H. Rothe,
V. Kolb-Bachofen,
Q. W. Xie,
C. Nathan,
S. Martin, and H. Kolb.
1993.
Transcription and translation of inducible nitric oxide synthase in the pancreas of prediabetic BB rats.
FEBS Lett.
328:9-12[Medline].
|
| 21.
|
Lindsay, R. M.,
W. Smith,
S. P. Rossiter,
M. A. McIntyre,
B. C. Williams, and J. D. Baird.
1995.
Nw-nitro-L-arginine methyl ester reduces the incidence of IDDM in BB/E rats.
Diabetes
44:365-368[Abstract].
|
| 22.
|
McDaniel, M. L.,
G. Kwon,
J. R. Hill,
C. A. Marshall, and J. A. Corbett.
1996.
Cytokine and nitric oxide in islet inflammation and diabetes.
Proc. Soc. Exp. Biol. Med.
211:24-32[Abstract].
|
| 23.
|
Novogrodsky, A.,
A. Vanichkin,
M. Patya,
A. Gazit,
N. Osherov, and A. Levitzki.
1994.
Prevention of lipopolysaccharide-induced lethal toxicity by tyrosine kinase inhibitors.
Science
264:1319-1322[Abstract/Free Full Text].
|
| 24.
|
Rossini, A. A.,
D. L. Greiner,
H. P. Friedman, and J. P. Mordes.
1993.
Immunopathogenesis of diabetes mellitus.
Diabetes Rev.
1:43-75.
|
| 25.
|
She, J. X.
1996.
Susceptible to type 1 diabetes: HLA-DQ and DR revisited.
Immunol. Today
17:323-329[Medline].
|
| 26.
|
Stassi, G.,
R. De Maria,
G. Trucco,
W. Rudert,
R. Tesiti,
A. Galluzzo,
C. Giordano, and M. Trucco.
1997.
Nitric oxide primes pancreatic beta cells for Fas-mediated destruction in insulin-dependent diabetes mellitus.
J. Exp. Med.
186:1193-1200[Abstract/Free Full Text].
|
| 27.
|
Tisch, R., and H. McDevitt.
1996.
Insulin-dependent diabetes mellitus.
Cell
85:291-297[Medline].
|
| 28.
|
Vanichkin, A.,
M. Patya,
A. Gazit,
A. Levitzki, and N. Novogrodsky.
1996.
Late administration of a lipophilic tyrosine kinase inhibitor prevents lipopolysaccharide and Escherichia coli-induced lethal toxicity.
J. Infect. Dis.
173:927-933[Medline].
|
| 29.
|
Yoon, J. W.
1995.
A new look at viruses in type 1 diabetes.
Diabetes Metab. Rev.
11:83-107[Medline].
|
| 30.
|
Yoon, J. W.
1997.
Pathogenesis of IDDM: environmental factors, p. 1-14.
In
J. Pickup, and G. Williams (ed.), Textbook of diabetes. Blackwell Scientific Publications, London, England.
|
| 31.
|
Yoon, J. W., and H. S. Jun.
1998.
Insulin-dependent diabetes mellitus, p. 1390-1398.
In
I. M. Roitt, and P. J. Delves (ed.), Encyclopedia of immunology, 2nd ed. Academic Press, London, England.
|
| 32.
|
Yoon, J. W.,
M. A. Lesniak,
R. Fussganger, and A. L. Notkins.
1976.
Genetic differences in susceptibility of pancreatic -cells to virus-induced diabetes mellitus.
Nature
264:178-180[Medline].
|
| 33.
|
Yoon, J. W.,
P. R. McClintock,
C. J. Bachurski,
J. D. Longstreth, and A. L. Notkins.
1985.
Virus-induced diabetes mellitus: no evidence for immune mechanisms in the destruction of -cells by the D-variant encephalomyocarditis virus.
Diabetes
34:922-925[Abstract].
|
| 34.
|
Yoon, J. W.,
P. R. McClintock,
T. Onodera, and A. L. Notkins.
1980.
Virus-induced diabetes mellitus. XVIII. Inhibition by a non-diabetogenic variant of encephalomyocarditis virus.
J. Exp. Med.
152:878-892[Abstract/Free Full Text].
|
| 35.
|
Yoon, J. W.,
M. M. Rodrigues,
C. Currier, and A. L. Notkins.
1982.
Longterm complications of virus-induced diabetes in mice.
Nature
296:567-569.
|
| 36.
|
Yoon, J. W.,
A. K. C. Wong,
Y. S. Bae, and H. M. Eun.
1988.
An apparent deletion of an oligonucleotide detected by RNA fingerprint in the nondiabetogenic B variant of encephalomyocarditis virus is caused by a point mutation.
J. Virol.
62:637-640[Abstract/Free Full Text].
|
Journal of Virology, October 1999, p. 8541-8548, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Steer, S. A., Moran, J. M., Christmann, B. S., Maggi, L. B. Jr, Corbett, J. A.
(2006). Role of MAPK in the Regulation of Double-Stranded RNA- and Encephalomyocarditis Virus-Induced Cyclooxygenase-2 Expression by Macrophages.. J. Immunol.
177: 3413-3420
[Abstract]
[Full Text]
-
Yoo, J. K., Kwon, H., Khil, L.-Y., Zhang, L., Jun, H.-S., Yoon, J.-W.
(2005). IL-18 Induces Monocyte Chemotactic Protein-1 Production in Macrophages through the Phosphatidylinositol 3-Kinase/Akt and MEK/ERK1/2 Pathways. J. Immunol.
175: 8280-8286
[Abstract]
[Full Text]
-
Moran, J. M., Moxley, M. A., Buller, R. M. L., Corbett, J. A.
(2005). Encephalomyocarditis Virus Induces PKR-Independent Mitogen-Activated Protein Kinase Activation in Macrophages. J. Virol.
79: 10226-10236
[Abstract]
[Full Text]
-
Moran, J. M., Buller, R. M. L., McHowat, J., Turk, J., Wohltmann, M., Gross, R. W., Corbett, J. A.
(2005). Genetic and Pharmacologic Evidence That Calcium-independent Phospholipase A2{beta} Regulates Virus-induced Inducible Nitric-oxide Synthase Expression by Macrophages. J. Biol. Chem.
280: 28162-28168
[Abstract]
[Full Text]
-
Nakamichi, K., Inoue, S., Takasaki, T., Morimoto, K., Kurane, I.
(2004). Rabies Virus Stimulates Nitric Oxide Production and CXC Chemokine Ligand 10 Expression in Macrophages through Activation of Extracellular Signal-Regulated Kinases 1 and 2. J. Virol.
78: 9376-9388
[Abstract]
[Full Text]
-
Hirasawa, K., Kim, A., Han, H.-S., Han, J., Jun, H.-S., Yoon, J.-W.
(2003). Effect of p38 Mitogen-Activated Protein Kinase on the Replication of Encephalomyocarditis Virus. J. Virol.
77: 5649-5656
[Abstract]
[Full Text]
-
Maggi, L. B. Jr., Moran, J. M., Buller, R. M. L., Corbett, J. A.
(2003). ERK Activation Is Required for Double-stranded RNA- and Virus-induced Interleukin-1 Expression by Macrophages. J. Biol. Chem.
278: 16683-16689
[Abstract]
[Full Text]
-
Maggi, L. B. Jr., Moran, J. M., Scarim, A. L., Ford, D. A., Yoon, J.-W., McHowat, J., Buller, R. M. L., Corbett, J. A.
(2002). Novel Role for Calcium-independent Phospholipase A2 in the Macrophage Antiviral Response of Inducible Nitric-oxide Synthase Expression. J. Biol. Chem.
277: 38449-38455
[Abstract]
[Full Text]
-
de Magalhaes, J. C., Andrade, A. A., Silva, P. N. G., Sousa, L. P., Ropert, C., Ferreira, P. C. P., Kroon, E. G., Gazzinelli, R. T., Bonjardim, C. A.
(2001). A Mitogenic Signal Triggered at an Early Stage of Vaccinia Virus Infection. IMPLICATION OF MEK/ERK AND PROTEIN KINASE A IN VIRUS MULTIPLICATION. J. Biol. Chem.
276: 38353-38360
[Abstract]
[Full Text]
-
Choi, K. S., Jun, H. S., Kim, H. N., Park, H. J., Eom, Y. W., Noh, H. L., Kwon, H., Kim, H. M., Yoon, J. W.
(2001). Role of Hck in the Pathogenesis of Encephalomyocarditis Virus-Induced Diabetes in Mice. J. Virol.
75: 1949-1957
[Abstract]
[Full Text]