Previous Article | Next Article 
Journal of Virology, October 1999, p. 8403-8410, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Role of Dendritic Cells in the Immune Response
Induced by Mouse Mammary Tumor Virus Superantigen
Frédéric
Baribaud,1,*
Ivan
Maillard,1
Sonia
Vacheron,2,3
Thomas
Brocker,4
Heidi
Diggelmann,1 and
Hans
Acha-Orbea2,3
Institute of Microbiology, University of
Lausanne, CH-1011 Lausanne,1 Institute
of Biochemistry, University of Lausanne, CH-1066
Epalinges,2 and Ludwig Institute for
Cancer Research, Lausanne Branch,3 CH-1066
Epalinges, Switzerland, and Universität Freiburg,
Medizinische Universitätsklinik, Abteilung Innere Medizin I,
Medizinische Molekularbiologie, D-79106 Freiburg,
Germany4
Received 4 March 1999/Accepted 9 July 1999
 |
ABSTRACT |
After mouse mammary tumor virus (MMTV) infection, B lymphocytes
present a superantigen (Sag) and receive help from the unlimited number
of CD4+ T cells expressing Sag-specific T-cell receptor
V
elements. The infected B cells divide and differentiate, similarly
to what occurs in classical B-cell responses. The amplification of
Sag-reactive T cells can be considered a primary immune response. Since
B cells are usually not efficient in the activation of naive T cells, we addressed the question of whether professional antigen-presenting cells such as dendritic cells (DCs) are responsible for T-cell priming.
We show here, using MMTV(SIM), a viral isolate which requires major
histocompatibility complex class II I-E expression to induce a strong
Sag response in vivo, that transgenic mice expressing I-E exclusively
on DCs (I-E
DC tg) reveal a strong Sag response. This Sag response
was dependent on the presence of B cells, as indicated by the absence
of stimulation in I-E
DC tg mice lacking B cells (I-E
DC tg
µMT
/
), even if these B cells lack I-E expression.
Furthermore, the involvement of either residual transgene expression by
B cells or transfer of I-E from DCs to B cells was excluded by the use of mixed bone marrow chimeras. Our results indicate that after priming
by DCs in the context of I-E, the MMTV(SIM) Sag can be recognized on
the surface of B cells in the context of I-A. The most likely
physiological relevance of the lowering of the antigen threshold
required for T-cell/B-cell collaboration after DC priming is to allow B
cells with a low affinity for antigen to receive T-cell help in a
primary immune response.
 |
INTRODUCTION |
Dendritic cells (DCs) play a crucial
role in antigen presentation (3, 4). Immature DCs found
mostly in nonlymphoid organs, such as Langerhans cells of the skin,
continuously filter the surrounding liquids and carry the antigens or
infectious microorganisms to the draining lymph nodes. There they
differentiate into professional antigen-presenting cells, called
interdigitating DCs, which prime naive T cells to become efficient
effector cells (3, 29-31, 36, 51, 52, 55).
B cells are inefficient at inducing immune responses with naive T cells
(9, 14, 15, 18, 20, 44, 48). On the other hand, however,
they are good presenting cells for antigen-experienced T cells when
they express an antigen-specific Ig (11, 37, 54). Most
likely, the nature and the density of costimulation molecules required
for the long duration of priming observed in the context of DCs in vivo
and in vitro is responsible for this difference (29, 40).
DCs have also been shown to directly activate B cells when the T
cell-DC interaction is replaced by anti-CD40 treatment (13).
T-cell/B-cell collaboration induced by mouse mammary tumor virus (MMTV)
infection is indistinguishable from classical antigen responses in
lymph nodes (40) and is therefore a valuable model to study
T-cell/B-cell collaboration in vivo. MMTV preferentially infects B
cells, which then present the superantigen (Sag) in the context of
major histocompatibility complex (MHC) class II on their cell surface
(2, 5, 25, 26). Sag-presenting B cells receive help from the
large number of T cells expressing Sag-specific T-cell receptor V
chains. The infected B cells divide and differentiate in both
extrafollicular and follicular B-cell compartments, similarly to
classical B-cell responses in terms of localization, surface marker
phenotypes, antibody secretion, and kinetics (40, 41). After
the initial expansion, the Sag-reactive T cells are slowly deleted from
the repertoire by peripheral clonal deletion (27, 43, 46,
64).
Although the importance of B cells during MMTV infection has been
clearly demonstrated, we were interested to know whether other types of
antigen-presenting cells might also be required to mount an efficient
Sag-induced immune response. Indeed, since such a response can be
considered a primary immune response, and since B cells are usually not
efficient in the activation of naive T cells, we addressed the question
of whether professional antigen-presenting cells such as DCs could play
a cooperative role in the activation of Sag-reactive T cells
(32).
We show here, using MMTV(SIM), a viral isolate which requires MHC class
II I-E expression to induce a strong Sag response in vivo
(42), that transgenic mice expressing I-E exclusively on DCs
(I-E
DC tg) reveal a strong Sag response. This Sag response is
dependent on the presence of B cells as indicated by the absence of
stimulation in I-E
DC tg mice lacking B cells (I-E
DC tg
µMT
/
), even if these B cells lack I-E expression.
Furthermore, the involvement of either residual transgene expression by
B cells or transfer of I-E from DCs to B cells could be excluded by the use of mixed bone marrow chimeras. Our results clearly demonstrate that
following professional T-cell priming by DCs, T-cell/B-cell interactions become productive in the immune response induced by the
MMTV Sag.
 |
MATERIALS AND METHODS |
Mouse strains.
C57BL/6 mice were purchased from Harlan OLAC
Ltd. (Bicester, United Kingdom). C57BL/6 I-E
-transgenic mice
(C57BL/6 I-E
tg) were obtained from D. Mathis (38). Mice
transgenic for MHC class II I-E expression restricted to DCs (C57BL/6
I-E
DC tg) were bred in our animal facility (6, 7). B
cell-deficient IgM mice (µMT
/
) were obtained from K. Rajewsky (33). C57BL/6 mice deficient in MHC class II
expression (I-A
/
) were provided by J. van Meerwijk
(63). All the mouse strains were maintained as breeding
pairs in our animal facilities, and the C57BL/6 I-E
DC tg
µMT
/
mice were obtained by breeding in our animal
facilities. For all the experiments described, either nontransgenic
littermates or C57BL/6 mice were used as control mice, with no
difference in the results obtained.
MMTV injections.
Titered stocks of MMTV(SIM) diluted in
phosphate-buffered saline (PBS) were injected subcutaneously into the
hind footpads of naïve mice, and the draining popliteal lymph
node was isolated 2, 4, or 6 days after injection. Alternatively, mice
were tail bled, and leukocytes were recovered from heparinized blood
samples by centrifugation through a Ficoll cushion.
AZT treatment.
Three milligrams of
3'-azido-3'-deoxythymidine (AZT; Sigma, St. Louis, Mo.) were injected
intravenously, and it was dissolved in the drinking water of the mice
at a concentration of 1 mg/ml 36 h after MMTV(SIM) injection.
Antibodies.
The following antibodies were used in this
study: fluorescein isothyocyanate (FITC)-labeled anti-V
4
(KT4-10) (60), phycoerythrin (PE)-coupled anti-CD4,
PE-coupled anti-CD8 and PE- or FITC-coupled anti-B220 (Caltag, San
Francisco, Calif.), biotinylated goat anti-mouse IgM, IgG1,
IgG2a, IgG2b, IgG3, and IgA
(Caltag); anti-Syndecan-1 (Pharmingen, Uppsala, Sweden).
Flow cytometric analysis.
Lymph node cells or peripheral
leukocytes were stained in one step, either with a mixture of
anti-V
4 antibody and anti-CD4 antibody or with a mixture
of anti-Syndecan-1 and anti-B220 antibody. Analysis was performed on a
FACScan (Becton Dickinson & Co., Mountain View, Calif.) cell analyzer
with Lysis II software for data evaluation. Dead cells were excluded by
a combination of forward and side scatter characteristics. B and T
cells from popliteal lymph nodes were sorted at different times after
MMTV(SIM) injection on a FACStar Plus (Becton Dickinson & Co.) flow
cytometer after staining with PE-coupled anti-CD4 and anti-CD8 and
FITC-labeled anti-B220. After reanalysis, the sorted cell populations
had a purity of >98%.
Enzyme-linked immunospot (ELISPOT) assay.
The number of
Ig-secreting cells and Ig isotypes were determined. Briefly, microtiter
plates (Nunc Maxisorp) were coated with goat anti-mouse IgG and IgM
(TAGO, Burlingame, Calif.), and cells isolated from lymph nodes were
serially diluted from 105 cells/well. The plate was
incubated 4 h at 37°C, and the Ig-secreting cell isotypes were
then determined with biotinylated goat anti-mouse IgM,
IgG1, IgG2a, IgG2b,
IgG3, and IgA. Finally, the plates were developed with
5-bromo-4-chloro-3-indolyl phosphate (Sigma) after incubation with a
streptavidin-conjugated alkaline phosphatase (Boehringer Mannheim). The
resulting spots were counted and expressed as the number of
spot-forming cells (SFC) per 105 B cells.
PCR detection of proviral DNA sequences.
DNA from 25,000 cells (determined by fluorescent-activated cell sorting) was amplified
with the 5' oligonucleotide Ms10 (AGGTGGGTCACAATCAACGGC), which reacts with various Sag sequences, and the 3'
oligonucleotide IM15 (CCCCTCCTTGGTATAATATCT) specific for
the MMTV(SIM) Sag or HD57 (CAAACCAAGTCAGGAAACCACTTG) for all
Mtvs. The PCR conditions were as follows: 1 cycle consisting
of 5 min at 94°C, 1 min at 59°C, and 1 min at 72°C; 25 cycles,
with 1 cycle consisting of 30 s at 94°C, 30 s at 59°C,
and 30 s at 72°C; and finally, an extension step for 10 min at
72°C in PCR buffer containing 20 mM Tris-HCl (pH 8.55), 16 mM
(NH4)2SO4, 2.5 mM
MgCl2, 150 µg of bovine serum albumin/ml, and 0.2 mM
(each) deoxynucleoside triphosphate; 2.5 U of Taq polymerase
(Biotaq; Bioprobe Systems, Les Ulis, France) and each oligonucleotide
(10 µM) were added to the PCR mixture. The specific PCR product was
detected by liquid hybridization, with 20% of the PCR mixture being
hybridized in 150 mM NaCl, 2.5 mM EDTA with 50 fmol of a
32P-labeled internal probe common to various Sag sequences
(Ms11 [CAAGGAGGTCTAGCTCTGGCG]). The conditions for the
reaction were 5 min at 98°C, 15 min at 60°C, and rapid cooling to
4°C. The reaction products were separated by size on a 2% agarose
gel, dried on DE81 paper (Whatman), and autoradiographed at
70°C on
X-Omat films (Eastman Kodak Company, Rochester, N.Y.).
Generation of bone marrow chimeras.
The chimeric mice were
prepared as previously described (63). C57BL/6 mice were
lethally irradiated (1,000 rads) with a 137Cs source and
injected the next day intravenously with 107 bone marrow
cells depleted of T cells by complement killing with anti-Thy1 antibody (AT83).
 |
RESULTS |
T-cell expansion induced by the MMTV(SIM) Sag in mice expressing
I-E exclusively on DCs.
The MMTV(SIM) Sag interacts with
V
4-expressing CD4+ T cells and requires MHC class II I-E
expression to induce a strong Sag response in vivo (42).
This last property has been demonstrated previously in C57BL/6 mice,
which do not express MHC class II I-E molecules, compared with
transgenic C57BL/6 mice expressing I-E
under the control of the MHC
class II promoter (I-E
tg) and thus expressing I-E on all MHC class
II positive cells. To further understand the respective roles of
different types of antigen-presenting cells, we used transgenic C57BL/6
mice expressing I-E
specifically on DCs but not on B cells or other
MHC class II positive cells (I-E
DC tg). Such a phenotype has been
generated through the use of the CD11c promoter to specifically drive
I-E
expression in the DC compartment. I-E
DC tg mice have normal
levels of I-E on DCs, with undetectable I-E expression on B cells as shown by flow cytometry (6, 7).
Injection of MMTV(SIM) into the footpads of C57BL/6 mice did not induce
an increase in the percentage of the Sag-reactive T cells in the
draining popliteal lymph node (Fig. 1,
left), whereas in I-E
tg mice a strong Sag response was detected
(Fig. 1, middle). This was true with virus doses contained in 2 to 0.02 µl of milk. Interestingly, transgenic mice expressing I-E exclusively
on DCs (I-E
DC tg) showed a strong, albeit slightly lower, Sag
response (Fig. 1, right), indicating that expression of I-E in the DC
compartment is critical to prime the T-cell response to the MMTV Sag.
Indeed, recent immunohistochemical observations have suggested that DCs could be involved in priming of Sag-reactive T cells (41).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
DCs can present MMTV(SIM) Sags. The T-cell response to
decreasing doses of MMTV(SIM), i.e., 2, 0.2, and 0.02 µl of MMTV(SIM)
containing purified milk (30) was analyzed 4 days after
injection in C57BL/6, C57BL/6 I-E tg, or C57BL/6 I-E DC tg mice.
The means of four lymph nodes ± standard deviations are shown.
The experiment was repeated three times, with similar results.
P < 0.01 (C57BL/6 compared to C57BL/6 I-E tg or
C57BL/6 I-E DC tg mice).
|
|
B cells contribute to the Sag response in I-E
DC tg mice.
To
determine the contribution of B cells in the immune response induced by
the MMTV(SIM) Sag in I-E
DC tg mice, the transgenic mice were crossed
and backcrossed to C57BL/6 µMT
/
mice, which lack B
cells due to disruption of the gene segment encoding the IgM
transmembrane region (33). In this way, we generated
I-E
DC tg µMT
/
mice, expressing I-E on DCs but
lacking B cells. Injection of MMTV(SIM) into the footpads of these mice
did not induce an increase in the percentage of Sag-reactive
V
4+ CD4+ T cells in the draining
lymph node (Fig. 2). As a positive
control, I-E
DC tg µMT
/
mice were infected with a
recombinant vaccinia virus expressing the MMTV(GR) Sag (34).
Such an infection induced a large increase in the percentage of
Sag-reactive T cells (data not shown), indicating that the T cells are
able to respond to Sag in these B cell-deficient mice. Taken together,
these results indicated that DCs are efficient presenters in the Sag
response induced by MMTV(SIM) but that a measurable response is
dependent on the presence of B cells.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
B cells contribute to the Sag response in I-E DC tg
mice. The T-cell response to 2 µl of MMTV(SIM) containing purified
milk (42) was analyzed 4 days after injection in C57BL/6
I-E DC tg and C57BL/6 I-E DC µMT / tg mice lacking
B cells. The means of three lymph nodes ± standard deviations are
shown. The experiment was repeated three times, with similar results.
P < 0.01 [C57BL/6 I-E DC compared to C57BL/6
I-E DC µMT / tg mice both injected with
MMTV(SIM)].
|
|
The MMTV(SIM) Sag is presented to T cells in C57BL/6 mice.
Although C57BL/6 mice failed to show a detectable expansion of
Sag-reactive T cells in the draining lymph node, it was important to
define whether the MMTV(SIM) Sag can also be presented to a lower
extent to T cells in the absence of MHC class II I-E molecules. To
address this question, we studied the deletion of
V
4+ CD4+ T cells after MMTV(SIM)
infection. Indeed, systemic deletion of Sag-reactive T cells is a much
more sensitive readout for a Sag response than the early localized
expansion that was detectable in the draining lymph node
(23). Two microliters of MMTV(SIM)-containing milk was
injected into the footpads of C57BL/6, C57BL/6 I-E
tg, or C57BL/6
I-E
DC tg mice. The percentage of V
4+
cells among CD4+ peripheral blood lymphocytes was
determined at various time points after infection (Fig.
3). The most rapid and complete deletion of V
4+ CD4+ T cells was observed
in I-E
tg mice (Fig. 3, middle). Interestingly, a slow and small but
significant deletion occurred in C57BL/6 mice in the absence of I-E
(Fig. 3, left). C57BL/6 I-E
DC tg mice had an intermediate magnitude
and kinetics of deletion (Fig. 3, right). These results indicate a weak
but detectable Sag presentation in the absence of I-E. In addition, the
slower deletion kinetics in I-E
DC tg mice compared to those in
I-E
tg mice can probably be explained by the weak priming capacity
of Sag-presenting I-E-negative B cells. Overall, the presentation of
the MMTV(SIM) Sag by I-A is estimated to be at least 100 times weaker
than its presentation by I-E [see Fig. 1, compare the absence of
response in C57BL/6 mice with 2 µl of MMTV(SIM)-containing milk to
the detectable response in I-E
DC tg mice with 0.02 µl of
MMTV(SIM)-containing milk].

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
The MMTV(SIM) Sag is presented to T cells in the absence
of MHC class II I-E molecules. V 4+ T-cell
deletion upon injection of 1 µl of MMTV(SIM) containing purified milk
was measured in leukocytes recovered from blood. The data represent the
means of peripheral blood samples of four mice ± standard
deviations. The experiment was repeated twice, with similar results.
|
|
MMTV Sag-dependent B-cell differentiation in mice expressing I-E
exclusively on DCs.
The previous experiments indicated that
expression of I-E on DCs in the presence of B cells was required to
prime a strong T-cell response to the MMTV(SIM) Sag. Since DCs seemed
to be the main antigen-presenting cells in the induction of this
primary immune response, we were interested in determining whether B
cells would still receive T-cell help and undergo T-dependent B-cell differentiation in I-E
DC tg mice (39). MMTV(SIM) was
injected into the footpads of C57BL/6, C57BL/6 I-E
tg, or C57BL/6
I-E
DC tg mice. Cells from the draining popliteal lymph node were
recovered at day 6 after infection and were studied by using an ELISPOT assay for Ig secretion and flow cytometric analysis for the expression of B-cell differentiation markers. B-cell differentiation was comparable in I-E
tg and I-E
DC tg mice (Fig.
4). Total numbers of IgM- and
IgG-secreting B cells were similar in both types of transgenic mice
(Fig. 4a). No IgM- and IgG-secreting B cells could be detected in
C57BL/6 mice in the same experiment (data not shown). The IgG isotype
pattern was somewhat different in I-E
DC tg mice, with a higher
number of IgG2a and a lower number of
IgG1-producing B cells, perhaps reflecting a different
pattern of cytokine secretion in the two transgenic mice. In addition,
extrafollicular B-cell differentiation was assessed by flow cytometry
through the detection of syndecan-1, a plasma cell differentiation
marker (Fig. 4b). Both types of transgenic mice had a similar
percentage of syndecan-1 expression among plasma blasts
(FSChigh/B220+/MHC class IIlow
cells) at day 6 after infection with MMTV(SIM), whereas the expression of this marker in C57BL/6 mice remained at the background level. In
summary, these results clearly indicated that B cells could receive
adequate T-cell help and could differentiate normally in I-E
DC tg
mice, even in the absence of I-E expression in the B-cell compartment.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 4.
Presentation of Sag by DCs leads to T-cell/B-cell
collaboration. (a) Antibody production measured by ELISPOT assay 6 days
after MMTV(SIM) injection (42) in C57BL/6 I-E and C57BL/6
I-E DC tg mice. No antibody production could be measured in C57BL/6
mice (data not shown). (b) Syndecan-1 expression 6 days after MMTV(SIM)
injection. The data are the means of three independent experiments.
|
|
Generation of bone marrow chimeric mice.
The results described
so far could be explained (i) by a requirement of I-E expression on DCs
for T-cell priming, (ii) by expression of I-E by B cells due to a
slight leakiness of the CD11c promoter used for the DC-specific I-E
expression, or (iii) by transfer of I-E molecules from
transgene-expressing DCs to B cells. To test these possibilities,
experiments with bone marrow chimeras were performed. I-E
DC tg mice
were crossed and backcrossed with µMT
/
mice to
generate I-E
DC tg µMT
/
mice, expressing I-E on DCs
but lacking B cells. Mixed bone marrow chimeras with I-E
DC
µMT
/
and C57BL/6 bone marrow were generated. In these
chimeras, all the B cells originated from the C57BL/6 bone marrow,
expressing I-A but not harboring the I-E transgene. In the DC
compartment, expression of I-E was shown to correlate with the mixing
ratio of the two bone marrows (e.g., 50% of the DCs in the chimera
expressed I-E if equal amounts of bone marrow cells were injected, data not shown).
At least 6 weeks after reconstitution, the bone marrow chimeras were
infected with MMTV(SIM) by footpad injection, and cells of the draining
popliteal lymph node were recovered at day 4 after infection. The
percentage of CD4+ T cells or CD4+ T-cell
blasts expressing V
4 was determined using flow cytometry (Fig. 5). As expected, the negative
control, C57BL/6 into C57BL/6 chimeras, had no increase in the
percentage of V
4+ cells among
CD4+ T-cell or T-cell blasts. As the positive control,
I-E
DC tg into C57BL/6 mice had a strong Sag response to the
MMTV(SIM) Sag. Interestingly, mixed bone marrow chimeras with I-E
DC
µMT
/
and C57BL/6 bone marrow also showed a strong
response to the MMTV(SIM) Sag. This response was comparable in
magnitude to that of the positive control. Minor differences in the
degree of response could be correlated to variations in the percentage
of reconstitution of the DC compartment with I-E-expressing DCs.
Indeed, titration experiments with different ratios of I-E
DC tg and
C57BL/6 bone marrow showed that optimal results were obtained when at
least 50% of the DC cells in the chimeras were of I-E
DC tg origin
(data not shown). Overall, these results indicated that residual
transgene expression by B cells was not the explanation for the effects described in Fig. 1 and 3 (if residual expression had been the explanation, no Sag response would have been observed in the bone marrow chimeras).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
Major contribution of I-E-dependent Sag presentation by
B cells in I-E DC tg mice is excluded. The V 4+ T-cell
stimulation in radiation bone marrow chimeras was analyzed 4 days after
injection of 2 µl of MMTV(SIM) containing purified milk. In mixed
bone marrow chimeras, reconstitutions ranged between 40 and 60% as
determined by the percentage of DCs expressing I-E (data not shown).
|
|
Finally, mixed bone marrow chimeras with I-E
DC
µMT
/
and C57BL/6 I-A
/
bone marrow
were prepared and challenged with MMTV(SIM). These mice were similar to
the other chimeras, except that the B cells expressed neither I-E nor
I-A. No Sag response was observed in these mice (Fig. 5, bottom),
indicating that transfer of I-E from DCs to B cells could not be the
explanation for the Sag response in I-E
DC tg mice [if transfer of
I-E had been the explanation, these chimeras would have responded to
the MMTV(SIM) Sag]. Therefore, a major contribution of I-E-dependent
Sag presentation by B cells in I-E
DC tg mice could be excluded.
Priming of Sag-reactive T cells by DCs led to an increased
recognition of Sag molecules presented on B cells by I-A.
MMTV
initially infects only a few B cells, leading to Sag-dependent
amplification of the infected cells, with little bystander activation
(25, 26, 40). A strong infection at the peak of the response
would indicate preferential amplification of the infected B cells and,
hence, Sag presentation by I-A. In the case of a polyclonal activation
that is not dependent on Sag presentation by I-A, weak infection levels
would be maintained at the peak of the response, since there is no
preferential amplification of the infected B cells. To address this
question, we extracted the cellular DNA from total lymph node cells 4 days after MMTV(SIM) injection and performed a PCR analysis to detect
proviral sequences. Figure 6 shows a
strong PCR signal at the peak of the Sag response in I-E
tg mice as
well as in I-E
DC tg mice as opposed to a weak PCR signal for the
I-E-negative C57BL/6 mice. The endogenous integrated proviral sequences
were amplified to control for DNA quantities (Fig. 6, bottom). These
results confirm a preferential amplification of the infected B cells.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 6.
Detection of MMTV(SIM) infection. Proviral MMTV(SIM) DNA
sequences were specifically amplified from total lymph node cells by
PCR and detected by liquid hybridization 4 days after injection of 2 µl of MMTV(SIM) containing purified milk. All Mtvs are
shown as internal controls for the amount of DNA.
|
|
To exclude the possibility that the strong infection is due to
preferential virus spread to activated B cells, we blocked viral spread
with the reverse transcriptase inhibitor AZT. We have previously shown
by administration of AZT that the Sag response does not result from the
spread of infectious virus to bystander-activated B cells but is due
mostly to the division of the few initially infected cells
(24). Chronic application of AZT 36 h after infection blocks viral spread to bystander B cells but does not reduce the overall B-cell amplification. Furthermore, we have shown that the
preferential amplification of infected cells under these conditions is
due to the preferential division of the infected B cells due to T-cell
help (24). If MMTV-infected B cells receive help
preferentially, an increase of the PCR signal is expected between days
2 and 4. Therefore, we used fluorescence-activated cell sorted B cells from I-E
tg and I-E
DC tg mice and determined their infection levels (Fig. 7). A comparably strong PCR
signal was observed in both types of mice in the presence or absence of
AZT. The relative infection levels increased 7.5-fold between days 2 and 4 as determined by instant imager analysis (data not shown) in both
I-E
DC tg and I-E
tg mice. As a control for the efficiency of AZT
treatment, we treated mice with AZT before MMTV infection. This
treatment results in a complete absence of a Sag response, absence of a PCR signal, and absence of an increase of lymph node size at day 4 (data not shown [24]). These results confirm that
after priming by DCs in the context of I-E, Sag can be recognized under
highly limiting conditions in the context of I-A.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 7.
Proviral MMTV(SIM) DNA sequences specifically amplified
from FACS-sorted B cells (>98% pure) by PCR and detected by liquid
hybridization 2 and 4 days after injection of 2 µl of MMTV(SIM)
containing purified milk with or without AZT treatment 36 h after
MMTV injection. All Mtvs are shown as internal controls for
the amount of DNA. The results were analyzed by instant imager (see
text).
|
|
 |
DISCUSSION |
The findings reported in this article demonstrate that MMTV uses
at least two different types of antigen-presenting cells to trigger a
potent immune response to the viral Sag. Indeed, both B cells and DCs
were shown to play a crucial role in this immune response, since the
Sag response was undetectable or dramatically reduced if one of the two
partners was absent or unable to fulfil its function. For example, this
was the case in C57BL/6 mice, where B cells were present but DCs did
not express the appropriate MHC class II molecules to prime the
Sag-reactive T cells. Similarly, in I-E
DC µMT
/
mice, where DCs were present and functional but B cells were absent, no
Sag response was detectable. Expression of the Sag-presenting MHC class
II I-E molecule exclusively on DCs was sufficient to induce a strong
Sag response, provided B cells expressing the weakly Sag-presenting MHC
class II I-A molecules were present. Therefore, a response to
previously undetectable amounts of antigen on the B-cell surface became
possible after DC priming.
The involvement of DCs in the early immune response to the MMTV SAg
clarifies several aspects of the interaction between MMTV and the
immune system (1). MMTV initially infects fewer than 100 B
cells (25, 26). It was thought previously that expression of
the viral Sag at the surface of the B cells was able to induce a strong
T-cell response, thus providing potent T-cell help to the infected B
cells which started to differentiate and to divide, increasing
dramatically the amount of proviral DNA. During this process, infected
B cells were preferentially stimulated, since they expressed the viral
Sag and received cognate T-cell help. However, B cells are known to be
inefficient as antigen-presenting cells for naive T cells, and it was
difficult to imagine how the few infected B cells would be sufficient
to trigger a potent primary immune response. In fact, priming of the
naive Sag-reactive T cells appears to require the presentation of the
viral Sag by DCs. As professional antigen-presenting cells, DCs are
able to present the Sag much more efficiently than B cells.
Sag-reactive T cells primed by DCs probably have a lower antigen
recognition threshold and can recognize the Sag presented by B cells
under suboptimal conditions. In addition, interaction with DCs might also be required to induce costimulatory molecules such as CD40L in
Sag-reactive T cells in order to prepare them for interaction with B
cells (16, 61). Indeed, mice lacking CD40L expression have
been reported to be unable to sustain an MMTV-induced Sag response
(10).
If the MMTV Sag is presented both by B cells and by DCs, the question
arises how the DCs acquire the Sag and whether they are also infected
with MMTV (62). In theory, several possibilities can be
envisaged as follows. (i) DCs or DC precursors can be infected with
MMTV and express the Sag classically from reverse transcribed and
integrated proviral DNA. (ii) DCs can sustain the first steps of the
viral life cycle, namely viral binding, entry, and reverse transcription, and the Sag is produced from incoming viral RNA or
reverse transcribed but unintegrated viral DNA. (iii) DCs are not
infected with MMTV, but small amounts of viral Sag are present within
the viral particles and can be delivered to the DCs. (iv) The DCs are
not infected, but they acquire the Sag by transfer from infected cells,
e.g., B cells.
The first possibility is attractive. B cells were known to be the first
targets of MMTV infection, but so far infection of DCs has not been
reported. Retroviruses in general, with the exception of lentiviruses,
are thought to require dividing cells to complete the proviral
integration process, and DCs are known to be nondividing cells. The
second possibility does not represent the classical way by which
retroviral proteins are expressed, but small amounts of viral protein
have been described to be produced in this way by avian retroviruses,
e.g., avian myeloblastosis virus or Rous sarcoma virus (19, 28,
59). As few molecules of MMTV Sag are required to generate a
potent biological effect, this possibility remains a potential
explanation. The third possibility, advocating the presence of the Sag
in the viral particles, would be compatible with the presence of small
amounts of many viral and cellular proteins within other retroviral
particles, e.g., human immunodeficiency virus (HIV). As the MMTV Sag is
produced as a type II transmembrane protein, one would expect that the
viral Sag is present within the viral membrane and gains access to the
cell membrane upon fusion of the virus with the DC, even without
further steps in the viral life cycle. Alternatively, the Sag would
have to be processed to a soluble form, which could be transferred to
the surface of the DC. Finally, a fourth possibility is that the Sag could be transferred from neighboring infected cells. This would require the transfer of membrane fragments of the donor cell containing the Sag or processing to a soluble form. The existence of such a
processing and transfer has already been suggested by other groups with
cell culture systems (12, 45, 47) as well as with earlier
experiments on endogenous MMTV Sags in bone marrow chimeras (57,
58).
It is interesting to compare our observations with data from studies on
HIV infection. Although CD4+ T cells are known to be the
main target of HIV and to produce the largest amount of viral
particles, the potential of HIV to infect DCs in vitro and in vivo has
been the focus of intensive research in recent years. Conflicting
reports have been generated initially as to the infectability of
cultured DCs, with efficient replication reported by some groups but
not by others (8, 35, 49, 66). More recently, productive HIV
infection has been described in immature but not mature DCs
(21). Interaction of HIV with the DCs has been shown to
occur via multiple chemokine receptors (22, 53). It is now
generally thought that DCs or DC precursors are an important target
cell type during early HIV infection, being perhaps the first cell type
to be infected within the exposed mucosa and the carrier of the virus
to neighboring lymphoid tissue (17, 50, 56). In addition,
DCs might play an important role as immune partners of the
CD4+ T cells, by allowing intercellular transfer of HIV and
favoring productive infection through activation of the
CD4+ T cells (8, 65, 66). These observations
have many similarities with our observations on the putative role of
DCs in MMTV infection.
Finally, the cooperative involvement of B cells and DCs during MMTV
infection is interesting for immunology in general, since the immune
response induced by the MMTV Sag recapitulates in many aspects the
response to a conventional antigen (40, 41). Our results
indicate that after priming by DCs in the context of I-E, the MMTV(SIM)
Sag can be recognized under limiting conditions on the surface of B
cells in the context of I-A. During this process, the avidity of the
Sag-reactive T cells for the Sag-MHC complex has to increase strongly.
The most likely physiological relevance of our observation is to allow
B cells with a low affinity for antigen to receive T-cell help in a
primary immune response.
 |
ACKNOWLEDGMENTS |
This work was supported by the Swiss National Science Foundation
grants 31-32271.94 to H.A.-O. and 31-46667.96 to H.D. H.A.-O. was
supported by Human Frontiers grant RG-544/95 as well as the Fondation
Gabriella Giorgi-Cavaglieri. Thomas Brocker is supported by the
Deutsche Forschungsgemeinschaft Leibniz-Program.
 |
FOOTNOTES |
*
Corresponding author. Present address: Department of
Pathology and Laboratory Medicine, University of Pennsylvania Medical Center, 806 Abramson, 34th and Civic Center Blvd., Philadelphia, PA
19104. Phone: (215) 573-7532. Fax: (215) 573-2883. E-mail: fbaribau{at}mail.med.upenn.edu.
 |
REFERENCES |
| 1.
|
Andersson, M., and H. Acha-Orbea.
1994.
The primary in vivo immune response to Mls-1 (Mtv-7 sag). Route of injection determines the immune response pattern.
Immunology
83:438-443[Medline].
|
| 2.
|
Ardavin, C.,
F. Luthi,
M. Andersson,
L. Scarpellino,
P. Martin,
H. Diggelmann, and H. Acha-Orbea.
1997.
Retrovirus-induced target cell activation in the early phases of infection: the mouse mammary tumor virus model.
J. Virol.
71:7295-7299[Abstract].
|
| 3.
|
Austyn, J. M.
1992.
Antigen uptake and presentation by dendritic leukocytes.
Semin. Immunol.
4:227-236[Medline].
|
| 4.
|
Banchereau, J., and R. M. Steinman.
1998.
Dendritic cells and the control of immunity.
Nature
392:245-252[Medline].
|
| 5.
|
Beutner, U.,
E. Kraus,
D. Kitamura,
K. Rajewsky, and B. T. Huber.
1994.
B cells are essential for murine mammary tumor virus transmission, but not for presentation of endogenous superantigens.
J. Exp. Med.
179:1457-1466[Abstract/Free Full Text].
|
| 6.
|
Brocker, T.,
M. Riedinger, and K. Karjalainen.
1997.
Targeted expression of major histocompatibility complex (MHC) class II molecules demonstrates that dendritic cells can induce negative but not positive selection of thymocytes in vivo.
J. Exp. Med.
185:541-550[Abstract/Free Full Text].
|
| 7.
|
Brocker, T.
1997.
Survival of mature CD4 T lymphocytes is dependent on major histocompatibility complex class II-expressing dendritic cells.
J. Exp. Med.
186:1223-1232[Abstract/Free Full Text].
|
| 8.
|
Cameron, P. U.,
P. S. Freudenthal,
J. M. Barker,
S. Gezelter,
K. Inaba, and R. M. Steinman.
1992.
Dendritic cells exposed to human immunodeficiency virus type-1 transmit a vigorous cytopathic infection to CD4+ T cells.
Science
257:383-387.
|
| 9.
|
Cassell, D. J., and R. H. Schwartz.
1994.
A quantitative analysis of antigen-presenting cell function: activated B cells stimulate naive CD4 T cells but are inferior to dendritic cells in providing costimulation.
J. Exp. Med.
180:1829-1840[Abstract/Free Full Text].
|
| 10.
|
Chervonsky, A. V.,
J. Xu,
A. K. Barlow,
M. Khery,
R. A. Flavell, and C. A. Janeway, Jr.
1995.
Direct physical interaction involving CD40 ligand on T cells and CD40 on B cells is required to propagate MMTV.
Immunity
3:139-146[Medline].
|
| 11.
|
Chesnut, R. W., and H. M. Grey.
1981.
Studies on the capacity of B cells to serve as antigen-presenting cells.
J. Immunol.
126:1075-1079[Medline].
|
| 12.
|
Delcourt, M.,
J. Thibodeau,
F. Denis, and R. P. Sekaly.
1997.
Paracrine transfer of mouse mammary tumor virus superantigen.
J. Exp. Med.
185:471-480[Abstract/Free Full Text].
|
| 13.
|
Dubois, B.,
B. Vanbervliet,
J. Fayette,
C. Massacrier,
C. Van Kooten,
F. Brière,
J. Banchereau, and C. Caux.
1997.
Dendritic cells enhance growth and differentiation of CD40-activated B lymphocytes.
J. Exp. Med.
185:941-952[Abstract/Free Full Text].
|
| 14.
|
Eynon, E. E., and D. C. Parker.
1992.
Small B cells as antigen-presenting cells in the induction of tolerance to soluble protein antigens.
J. Exp. Med.
175:131-138[Abstract/Free Full Text].
|
| 15.
|
Finkelman, F. D.,
A. Lees, and S. C. Morris.
1992.
Antigen presentation by B lymphocytes to CD4+ T lymphocytes in vivo: importance for B lymphocyte and T lymphocyte activation.
Semin. Immunol.
4:247-255[Medline].
|
| 16.
|
Foy, T. M.,
A. Aruffo,
J. Bajorath,
J. E. Buhlmann, and R. J. Noelle.
1996.
Immune regulation by CD40 and its ligand GP39.
Annu. Rev. Immunol.
14:591-617[Medline].
|
| 17.
|
Frankel, S. S.,
B. M. Wenig,
A. P. Burke,
P. Mannan,
L. D. Thompson,
S. L. Abbondanzo,
A. M. Nelson,
M. Pope, and R. M. Steinman.
1996.
Replication of HIV-1 in dendritic cell-derived syncytia at the mucosal surface of the adenoid.
Science
272:115-117[Abstract].
|
| 18.
|
Fuchs, E. J., and P. Matzinger.
1992.
B cells turn off virgin but not memory T cells.
Science
258:1156-1159[Abstract/Free Full Text].
|
| 19.
|
Gallis, B. M.,
R. N. Eisenman, and H. Diggelmann.
1976.
Synthesis of the precursor to avian RNA tumor virus internal structural proteins early after infection.
Virology
74:302-313[Medline].
|
| 20.
|
Gilbert, K. M., and W. O. Weigle.
1994.
Tolerogenicity of resting and activated B cells.
J. Exp. Med.
179:249-258[Abstract/Free Full Text].
|
| 21.
|
Granelli-Piperno, A.,
E. Delgado,
V. Finkel,
W. Paxton, and R. M. Steinman.
1998.
Immature dendritic cells selectively replicate macrophagetropic (M-tropic) human immunodeficiency virus type 1, while mature cells efficiently transmit both M- and T-tropic virus to T cells.
J. Virol.
72:2733-2737[Abstract/Free Full Text].
|
| 22.
|
Granelli-Piperno, A.,
B. Moser,
M. Pope,
D. Chen,
Y. Wei,
F. Isdell,
U. O'Doherty,
W. Paxton,
R. Koup,
S. Mojsov,
N. Bhardwaj,
I. Clark-Lewis,
M. Baggiolini, and R. M. Steinman.
1996.
Efficient interaction of HIV-1 with purified dendritic cells via multiple chemokine coreceptors.
J. Exp. Med.
184:2433-2438[Abstract/Free Full Text].
|
| 23.
|
Grusby, M. J.,
R. S. Johnson,
V. E. Papaioannou, and L. H. Glimcher.
1991.
Depletion of CD4+ T cells in major histocompatibility complex class II-deficient mice.
Science
253:1417-1420[Abstract/Free Full Text].
|
| 24.
|
Held, W.,
G. A. Waanders,
H. Acha-Orbea, and H. R. MacDonald.
1994.
Reverse transcriptase-dependent and -independent phases of infection with mouse mammary tumor virus: implications for superantigen function.
J. Exp. Med.
180:2347-2351[Abstract/Free Full Text].
|
| 25.
|
Held, W.,
G. A. Waanders,
A. N. Shakhov,
L. Scarpellino,
H. Acha-Orbea, and H. R. MacDonald.
1993.
Superantigen-induced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission.
Cell
74:529-540[Medline].
|
| 26.
|
Held, W.,
A. N. Shakhov,
S. Izui,
G. A. Waanders,
L. Scarpellino,
H. R. MacDonald, and H. Acha-Orbea.
1993.
Superantigen-reactive CD4+ T cells are required to stimulate B cells after infection with mouse mammary tumor virus.
J. Exp. Med.
177:359-366[Abstract/Free Full Text].
|
| 27.
|
Held, W.,
A. N. Shakhov,
G. Waanders,
L. Scarpellino,
R. Luethy,
J. P. Kraehenbuhl,
H. R. MacDonald, and H. Acha-Orbea.
1992.
An exogenous mouse mammary tumor virus with properties of Mls-1a (Mtv-7).
J. Exp. Med.
175:1623-1633[Abstract/Free Full Text].
|
| 28.
|
Hsia, K. J.,
H. Hara,
R. Izutani,
H. T. Park,
M. Fujihara, and A. Kaji.
1992.
Infection of terminally differentiated myotubes with Rous sarcoma virus: reduced synthesis of env and v-src proteins.
J. Gen. Virol.
73:1791-1798[Abstract/Free Full Text].
|
| 29.
|
Iezzi, G.,
K. Karjalainen, and A. Lanzavecchia.
1998.
The duration of antigenic stimulation determines the fate of naive and effector T cells.
Immunity
8:89-95[Medline].
|
| 30.
|
Inaba, K.,
J. P. Metlay,
M. T. Crowley, and R. M. Steinman.
1990.
Dendritic cells pulsed with protein antigens in vitro can prime antigen-specific, MHC-restricted T cells in situ.
J. Exp. Med.
172:631-640[Abstract/Free Full Text].
|
| 31.
|
Inaba, K.,
G. Schuler,
M. D. Witmer,
J. Valinsky,
B. Atassi, and R. M. Steinman.
1986.
Immunologic properties of purified epidermal Langerhans cells. Distinct requirements for stimulation of unprimed and sensitized T lymphocytes.
J. Exp. Med.
164:605-613[Abstract/Free Full Text].
|
| 32.
|
Ingulli, E.,
A. Mondino,
A. Khoruts, and M. K. Jenkins.
1997.
In vivo detection of dendritic cell antigen presentation to CD4+ T cells.
J. Exp. Med.
185:2133-2141[Abstract/Free Full Text].
|
| 33.
|
Kitamura, D.,
J. Roes,
R. Kuhn, and K. Rajewsky.
1991.
A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin mu chain gene.
Nature
350:423-426[Medline].
|
| 34.
|
Krummenacher, C.,
H. Diggelmann, and H. Acha-Orbea.
1996.
In vivo effects of a recombinant vaccinia virus expressing a mouse mammary tumor virus superantigen.
J. Virol.
70:3026-3031[Abstract].
|
| 35.
|
Langhoff, E.,
E. F. Terwilliger,
H. J. Bos,
K. H. Kalland,
M. C. Poznansky,
O. M. Bacon, and W. A. Haseltine.
1991.
Replication of human immunodeficiency virus type 1 in primary dendritic cell cultures.
Proc. Natl. Acad. Sci. USA
88:7998-8002[Abstract/Free Full Text].
|
| 36.
|
Lanzavecchia, A.
1998.
From antigen presentation to T-cell activation.
Res. Immunol.
149:626[Medline].
|
| 37.
|
Lanzavecchia, A.
1985.
Antigen-specific interaction between T and B cells.
Nature
314:537-539[Medline].
|
| 38.
|
Le Meur, M.,
P. Gerlinger,
C. Benoist, and D. Mathis.
1985.
Correcting an immune-response deficiency by creating E alpha gene transgenic mice.
Nature
316:38-42[Medline].
|
| 39.
|
Lenschow, D. J.,
T. L. Walunas, and J. A. Bluestone.
1996.
CD28/B7 system of T cell costimulation.
Annu. Rev. Immunol.
14:233-258[Medline].
|
| 40.
|
Luther, S. A., and H. Acha-Orbea.
1997.
Mouse mammary tumor virus: immunological interplays between virus and host.
Adv. Immunol.
65:139-243[Medline].
|
| 41.
|
Luther, S. A.,
A. Gulbranson-Judge,
H. Acha-Orbea, and I. C. M. MacLennan.
1997.
Viral superantigen drives extrafollicular and follicular B cell differentiation leading to virus-specific antibody production.
J. Exp. Med.
185:551-562[Abstract/Free Full Text].
|
| 42.
|
Maillard, I.,
K. Erny,
H. Acha-Orbea, and H. Diggelmann.
1996.
A V beta 4-specific superantigen encoded by a new exogenous mouse mammary tumor virus.
Eur. J. Immunol.
26:1000-1006[Medline].
|
| 43.
|
Marrack, P.,
E. Kushnir, and J. Kappler.
1991.
A maternally inherited superantigen encoded by a mammary tumour virus.
Nature
349:524-526[Medline].
|
| 44.
|
Matzinger, P.
1994.
Immunology. Memories are made of this?
Nature
369:605-606[Medline].
|
| 45.
|
Mix, D., and G. M. Winslow.
1996.
Proteolytic processing activates a viral superantigen.
J. Exp. Med.
184:1549-1554[Abstract/Free Full Text].
|
| 46.
|
Papiernik, M.,
C. Pontoux, and S. Gisselbrecht.
1992.
Acquired Mls-1a-like clonal deletion in Mls-1b mice.
J. Exp. Med.
175:453-460[Abstract/Free Full Text].
|
| 47.
|
Park, C. G.,
M. Y. Jung,
Y. Choi, and G. M. Winslow.
1995.
Proteolytic processing is required for viral superantigen activity.
J. Exp. Med.
181:1899-1904[Abstract/Free Full Text].
|
| 48.
|
Parker, D. C.
1993.
The functions of antigen recognition in T cell-dependent B cell activation.
Semin. Immunol.
5:413-420[Medline].
|
| 49.
|
Patterson, S., and S. C. Knight.
1987.
Susceptibility of human peripheral blood dendritic cells to infection by human immunodeficiency virus.
J. Gen. Virol.
68:1177-1181[Abstract/Free Full Text].
|
| 50.
|
Reece, J. C.,
A. J. Handley,
E. J. Anstee,
W. A. Morrison,
S. M. Crowe, and P. U. Cameron.
1998.
HIV-1 selection by epidermal dendritic cells during transmission across human skin.
J. Exp. Med.
187:1623-1631[Abstract/Free Full Text].
|
| 51.
|
Reis e Sousa, C.,
P. D. Stahl, and J. M. Austyn.
1993.
Phagocytosis of antigens by Langerhans cells in vitro.
J. Exp. Med.
178:509-519[Abstract/Free Full Text].
|
| 52.
|
Romani, N.,
S. Koide,
M. Crowley,
M. Witmer-Pack,
A. M. Livingstone,
C. G. Fathman,
K. Inaba, and R. M. Steinman.
1989.
Presentation of exogenous protein antigens by dendritic cells to T cell clones. Intact protein is presented best by immature, epidermal Langerhans cells.
J. Exp. Med.
169:1169-1178[Abstract/Free Full Text].
|
| 53.
|
Rubbert, A.,
C. Combadiere,
M. Ostrowski,
J. Arthos,
M. Dybul,
E. Machado,
M. A. Cohn,
J. A. Hoxie,
P. M. Murphy,
A. S. Fauci, and D. Weissman.
1998.
Dendritic cells express multiple chemokine receptors used as coreceptors for HIV entry.
J. Immunol.
160:3933-3941[Abstract/Free Full Text].
|
| 54.
|
Sallusto, F., and A. Lanzavecchia.
1994.
Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha.
J. Exp. Med.
179:1109-1118[Abstract/Free Full Text].
|
| 55.
|
Schuler, G., and R. M. Steinman.
1985.
Murine epidermal Langerhans cells mature into potent immunostimulatory dendritic cells in vitro.
J. Exp. Med.
161:526-546[Abstract/Free Full Text].
|
| 56.
|
Soto-Ramirez, L. E.,
B. Renjifo,
M. F. McLane,
R. Marlink,
C. O'Hara,
R. Sutthent,
C. Wasi,
P. Vithayasai,
V. Vithayasai,
C. Apichartpiyakul,
P. Auewarakul,
V. Pena Cruz,
D. S. Chui,
R. Osathanondh,
K. Mayer,
T. H. Lee, and M. Essex.
1996.
HIV-1 Langerhans' cell tropism associated with heterosexual transmission of HIV.
Science
271:1291-1303[Abstract].
|
| 57.
|
Speiser, D. E.,
R. Schneider,
H. Hengartner,
H. R. MacDonald, and R. M. Zinkernagel.
1989.
Clonal deletion of self-reactive T cells in irradiation bone marrow chimeras and neonatally tolerant mice. Evidence for intercellular transfer of Mlsa.
J. Exp. Med.
170:595-600[Abstract/Free Full Text].
|
| 58.
|
Speiser, D. E.,
R. K. Lees,
H. Hengartner,
R. M. Zinkernagel, and H. R. MacDonald.
1989.
Positive and negative selection of T cell receptor V beta domains controlled by distinct cell populations in the thymus.
J. Exp. Med.
170:2165-2170[Abstract/Free Full Text].
|
| 59.
|
Tanaka, A.,
H. Hara,
H. T. Park,
J. Wolfert,
M. Fujihara,
R. Izutani, and A. Kaji.
1992.
Infection of terminally differentiated myotubes with Rous sarcoma virus (RSV): lack of DNA integration but presence of RSV mRNA.
J. Gen. Virol.
73:1781-1790[Abstract/Free Full Text].
|
| 60.
|
Tomonari, K.,
E. Lovering, and S. Spencer.
1990.
Correlation between the V beta 4+ CD8+ T-cell population and the H-2d haplotype.
Immunogenetics
31:333-339[Medline].
|
| 61.
|
Tough, D. F.,
S. Sun, and J. Sprent.
1997.
T cell stimulation in vivo by lipopolysaccharide (LPS).
J. Exp. Med.
185:2089-2094[Abstract/Free Full Text].
|
| 62.
|
Vacheron, S.
1999.
Ph.D. thesis.
University of Lausanne, Lausanne, Switzerland.
|
| 63.
|
van Meerwijk, J. P. M.,
S. Marguerat,
R. K. Lees,
R. N. Germain,
B. J. Fowlkes, and H. R. MacDonald.
1997.
Quantitative impact of thymic clonal deletion on the T cell repertoire.
J. Exp. Med.
185:377-384[Abstract/Free Full Text].
|
| 64.
|
Webb, S.,
C. Morris, and J. Sprent.
1990.
Extrathymic tolerance of mature T cells: clonal elimination as a consequence of immunity.
Cell
63:1249-1256[Medline].
|
| 65.
|
Weissman, D.,
J. Daucher,
T. Barker,
J. Adelsberger,
M. Baseler, and A. S. Fauci.
1996.
Cytokine regulation of HIV replication induced by dendritic cell-CD4-positive T cell interactions.
AIDS Res. Hum. Retroviruses
12:759-767[Medline].
|
| 66.
|
Weissman, D.,
Y. Li,
J. M. Orenstein, and A. S. Fauci.
1995.
Both a precursor and a mature population of dendritic cells can bind HIV. However, only the mature population that expresses CD80 can pass infection to unstimulated CD4+ T cells.
J. Immunol.
155:4111-4117[Abstract].
|
Journal of Virology, October 1999, p. 8403-8410, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Courreges, M. C., Burzyn, D., Nepomnaschy, I., Piazzon, I., Ross, S. R.
(2007). Critical Role of Dendritic Cells in Mouse Mammary Tumor Virus In Vivo Infection. J. Virol.
81: 3769-3777
[Abstract]
[Full Text]
-
Burzyn, D., Rassa, J. C., Kim, D., Nepomnaschy, I., Ross, S. R., Piazzon, I.
(2004). Toll-Like Receptor 4-Dependent Activation of Dendritic Cells by a Retrovirus. J. Virol.
78: 576-584
[Abstract]
[Full Text]
-
Mpandi, M., Otten, L. A., Lavanchy, C., Acha-Orbea, H., Finke, D.
(2003). Passive Immunization with Neutralizing Antibodies Interrupts the Mouse Mammary Tumor Virus Life Cycle. J. Virol.
77: 9369-9377
[Abstract]
[Full Text]
-
Vacheron, S., Luther, S. A., Acha-Orbea, H.
(2002). Preferential Infection of Immature Dendritic Cells and B Cells by Mouse Mammary Tumor Virus. J. Immunol.
168: 3470-3476
[Abstract]
[Full Text]
-
Martin, P., Ruiz, S. R., del Hoyo, G. M., Anjuere, F., Vargas, H. H., Lopez-Bravo, M., Ardavin, C.
(2002). Dramatic increase in lymph node dendritic cell number during infection by the mouse mammary tumor virus occurs by a CD62L-dependent blood-borne DC recruitment. Blood
99: 1282-1288
[Abstract]
[Full Text]
![]()