Previous Article | Next Article 
Journal of Virology, October 1999, p. 8384-8392, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Casein Kinase 2-Mediated Phosphorylation of Respiratory Syncytial
Virus Phosphoprotein P Is Essential for the Transcription
Elongation Activity of the Viral Polymerase; Phosphorylation by
Casein Kinase 1 Occurs Mainly at Ser215 and Is
without Effect
Lesley C.
Dupuy,
Sean
Dobson,
Vira
Bitko, and
Sailen
Barik*
Department of Biochemistry and Molecular
Biology, College of Medicine, University of South Alabama, Mobile,
Alabama
Received 18 March 1999/Accepted 13 July 1999
 |
ABSTRACT |
The major site of in vitro phosphorylation by casein kinase 2 (CK2)
was the conserved Ser232 in the P proteins of human,
bovine, and ovine strains of respiratory syncytial virus (RSV).
Enzymatic removal of this phosphate group from the P protein instantly
halted transcription elongation in vitro. Transcription reconstituted
in the absence of P protein or in the presence of phosphate-free P
protein produced abortive initiation products but no full-length
transcripts. A recombinant P protein in which Ser232 was
mutated to Asp exhibited about half of the transcriptional activity of
the wild-type phosphorylated protein, suggesting that the negative
charge of the phosphate groups is an important contributor to P protein
function. Use of a temperature-sensitive CK2 mutant yeast revealed that
in yeast, phosphorylation of recombinant P by non-CK2 kinase(s) occurs
mainly at Ser215. In vitro, P protein could be
phosphorylated by purified CK1 at Ser215 but this
phosphorylation did not result in transcriptionally active P protein. A
triple mutant P protein in which Ser215,
Ser232, and Ser237 were all mutated to Ala was
completely defective in phosphorylation in vitro as well as ex vivo.
The xanthate compound D609 inhibited CK2 but not CK1 in vitro and had a
very modest effect on P protein phosphorylation and RSV yield ex vivo.
Together, these results suggest a role for CK2-mediated phosphorylation
of the P protein in the promoter clearance and elongation properties of
the viral RNA-dependent RNA polymerase.
 |
INTRODUCTION |
Respiratory syncytial virus (RSV) is
a major pediatric pathogen that claims roughly 3 million lives annually
throughout the world (19). It is a Pneumovirus
belonging to the Paramyxoviridae family and contains a
nonsegmented negative-strand RNA genome a little over 15 kb in length
(13). The genome is wrapped with the nucleocapsid protein N,
and the resultant N-RNA complex serves as the functional template for
the viral RNA-dependent RNA polymerase. In vitro (7, 30) and
ex vivo reconstitution studies (17, 44) have shown that the
minimal RNA polymerase of RSV consists of the large viral protein L and
the accessory phosphoprotein P. Optimal transcription additionally
requires viral antitermination protein M2 (14, 20), cellular
actin (10, 22), and possibly additional cellular proteins
(10).
Our laboratory has been investigating the role of phosphorylation of
the RSV P protein in viral transcription over the last few years. Using
a transcription system reconstituted with human RSV (HRSV, Long
serotype) macromolecules in vitro, we have shown that phosphorylation
of recombinant P protein by casein kinase 2 (CK2) occurs mainly at
Ser232 and that this phosphorylation is essential for the
transcription function of P (7). Phosphorylation at
Ser237 may additionally stimulate transcription to a small
extent, thus playing a modest accessory role (7, 30).
Although most of our knowledge of the molecular biology and
biochemistry of RSV has originated from studies of the human strains, there are other strains of RSV that infect nonhuman animals and therefore cause significant damage to the livestock industry and farming. Such strains include bovine RSV (BRSV), ovine RSV (ORSV), and
caprine (goat) RSV that readily infect their respective host animals
(1, 28, 37, 40, 45). Rapid advancement in gene sequencing
and cloning in the recent past has led to the finding that in spite of
their natural host preferences, these viruses are identical in genome
organization and the predicted primary structures of their proteins are
highly similar. For example, the amino acid identities between the N,
P, and L proteins of HRSV and BRSV are 93, 77, and 84%, respectively
(28, 37, 45). Thus, the transcriptional proteins of these
viruses may all have domains in common and, by corollary, the structure
and function of their transcription complexes may emulate those of the
human prototype. Recently, use of a BRSV ex vivo complementation system based on a minigenome construct has, in fact, shown that BRSV transcription requires the N, P, and L proteins and is stimulated by
the BRSV M2 protein (45), a situation identical to that of HRSV (13, 14, 17). A complementation system for ORSV is not
available. To determine the functional homology between the transcriptional macromolecules of HRSV and nonhuman RSV in detail, we
have used the P protein as a model and have demonstrated the ability of
the BRSV and ORSV P proteins to substitute for HRSV P in an otherwise
HRSV-based transcription reaction. In addition, we have mapped the
major phosphorylation site of the BRSV and ORSV P proteins to
Ser232 and provided evidence that the protein kinase
involved has properties of CK2.
Although recombinant HRSV P can be phosphorylated by purified and crude
CK2 in vitro (7, 29, 30), the exact nature of the in vivo
kinase for P remains elusive (7, 38). Drugs such as heparin,
that inhibit CK2 in vitro, do not enter cultured cells (ex vivo). In an
attempt to identify the intracellular kinase for P, we have therefore
adopted two fundamentally different approaches. In the first, we
expressed the P proteins and their CK2 site mutant forms in the
available temperature-sensitive yeast CK2 mutant, which represents the
only known CK2 mutation in any cell (12). In the second
approach, we re-evaluated an antiviral xanthate compound, D609, which
was previously shown to inhibit RSV P protein phosphorylation, as well
as RSV growth in cell culture (42). During the course of
these studies, we discovered that the RSV P protein is also an
excellent substrate for purified CK1 in vitro and perhaps for a
CK1-like activity in yeast. We then mapped the exact site of the
CK1-mediated phosphorylation to Ser215 and demonstrated a
lack of its role in the transcriptional activity of the P protein.
The precise role of the phosphate groups in the activation of the RSV P
protein remains unknown. We now show that the RSV L protein alone
cannot initiate transcription and that the unphosphorylated P protein
can aid in this process. However, transcription in the presence of the
unphosphorylated P protein results in the production of short, discrete
oligonucleotide transcripts from within the leader region of RSV. Use
of phosphorylated P resulted in promoter clearance of RSV RNA
polymerase and production of full-length transcripts. In addition, we
have recently shown that the phosphate groups of P protein are
susceptible to hydrolysis by the prokaryotic protein phosphatase
encoded by phage lambda (PP
) in vitro (2, 4). We have now
successfully used this phosphatase to demonstrate a role of the
phosphate groups of RSV P in the elongation phase of transcription. The
RSV phosphoprotein, therefore, acts as an elongation factor for the
viral RNA-dependent RNA polymerase. Together, our results present a
comprehensive picture of the different phosphate groups of the RSV P
protein in vitro, as well as ex vivo, and an evaluation of their roles,
or lack thereof, in viral transcription.
(This work was submitted in partial fulfillment of the requirements for
a Ph.D. at the University of South Alabama by L. C. Dupuy.)
 |
MATERIALS AND METHODS |
Bacterial expression of BRSV and ORSV P proteins.
BRSV
strain A51908 (28) was purchased from the American Type
Culture Collection. ORSV strain WSU 83-1578 was a kind gift from Howard
D. Lehmkuhl. The P-encoding genes of BRSV and ORSV were cloned in
bacterial expression vector pET-3a by using the same procedures that
were adopted for the human strain (29). Briefly, the
P-encoding genes were amplified by reverse transcription (RT) and PCR
using specific primers containing NdeI and BamHI sites and cloned into the same sites in pET-3a. The recombinant proteins were purified through phosphocellulose and DEAE-cellulose chromatography, during which the proteins behaved essentially like
their human counterpart (29). Site-directed mutagenesis was
also carried out as described previously (5).
Expression and 32P labeling of RSV P proteins in
yeast.
The HRSV P-encoding gene and its mutant forms were first
cloned into pET-3a essentially as previously described (29)
and then subcloned between BamHI and AvrII sites
of the inducible yeast vector YEP-PGAL1 (a kind gift from James Wang;
16). The wild-type and mutant YEP-PGAL1-RSVP
constructs and the YEP-PGAL1 vector alone were each introduced into
both wild-type yeast and temperature-sensitive CK2 mutant yeast (kind
gifts of Claiborne V. C. Glover, University of Georgia;
12). The growth of the transformants at various
temperatures, induction of P protein synthesis by galactose, metabolic
labeling of cells with [32P]orthophosphate, lysis of
cells, and immunoprecipitation of P protein were carried out
essentially as previously described (12). CK1 and CK2
activities in yeast extracts were determined by using specific peptide
substrates, RRREEESEEE for CK2 and KRRRALS(P)VASLPGL for CK1 in
standard in vitro reactions (8, 24). Where mentioned, immunoblot (Western blot) analysis of P protein was performed by using
anti-P antibody (29) and Ultra-signal chemiluminescence detection (Pierce, Rockford, Ill.).
Phosphorylation of recombinant P proteins by protein kinases (or HEp-2
cell extracts) and reconstituted RSV transcription reactions were
carried out as described previously (7). The CK1 substrate
peptide and recombinant CK1 and CK2 were purchased from New England
Biolabs (Beverly, Mass.).
Reconstituted RSV transcription.
Transcription reactions
based on unfractionated ribonucleoprotein were carried out essentially
as described previously (3, 30). Reconstituted reactions (10 µl) were also performed as previously described (7, 30).
In brief, 20-µl reaction mixtures contained 50 mM Tris-acetate (pH
7.5), 100 mM Na-acetate, 10% glycerol, 2 µg of actinomycin D per ml,
1 mM dithiothreitol; 120 ng of template N-RNA, 10 ng of L protein (both
fractionated from ribonucleoprotein), 50 to 200 ng of purified
recombinant (bacterial) P protein, 50 ng of HEp-2 extract containing
actin, 50 µCi (50 µM) of [
-32P]UTP, and 500 µM
each ATP, CTP, and GTP. The L preparation and the N-RNA complex each
contributed about 2 to 4 ng of the M2 protein (22K protein), detectable
by immunoblot analysis (data not shown). When phosphorylated P protein
was used in a transcription, the bacterial P was phosphorylated by CK2
present in total HEp-2 cell extract (or purified CK1, where mentioned)
and then purified away from kinases by phosphocellulose chromatography
as previously described (7). HEp-2 extract, pretreated with
excess anti-CK2 antibody, was used as the source of actin as previously
described (7, 30). 32P-labeled transcripts were
quantitated by the DEAE (DE81) paper binding described previously
(3).
For some reactions (see Fig.
4), all four

-
32P-labeled
ribonucleoside triphosphates were used at a final concentration of 100
µM (50 µCi) each. To analyze the RNA products by gel
electrophoresis,
100 µl of each transcription reaction mixture was
deproteinized
with phenol-chloroform, precipitated with ethanol, dried,
and
dissolved in 5 µl of 90% formamide. Half of the RNA was analyzed
by electrophoresis on a 25% polyacrylamide gel containing 6 M
urea to
analyze small oligoribonuclotide products essentially
as previously
described (
6). The other half of the RNA was
electrophoresed
on acidic agarose-urea gels as described previously
(
3).
Following electrophoresis, both gels were dried and exposed
to X-ray
films.
Effect of the xanthate compound D609.
To explore the effect
of D609 (BIOMOL Research Laboratories, Plymouth Meeting, Pa.) on viral
growth, HEp-2 cells grown in 10-cm-diameter dishes to 80% confluency
were infected with RSV at a multiplicity of infection of 3. All of the
media used in these experiments were brought to pH 7.0 by the addition
of 1 M HCl (42). After 2 h of adsorption of the virus,
the media were replaced with fresh, prewarmed media containing 0, 15, 30, 45, and 100 µM D609. To label P proteins, the media were removed 24 h later, the infected monolayers were washed twice with
phosphate-free media, incubated with phosphate-free media for 2 h,
and finally incubated with phosphate-free media plus
[32P]orthophosphate (1 mCi per dish) for 4 h. The
cells were then processed for immunoprecipitation by using antibodies
against RSV P proteins as described previously (29). To
determine viral titers, parallel cultures were grown without the
32P label and the supernatant titer was determined by
serial dilution on CV-1 cells.
VSV (vesicular stomatitis virus) infection was carried out in an
essentially identical manner, except that BHK-21 cells were
infected,
the infected cells were
32P labeled at 12 h
postinfection (because of the faster growth
rate of VSV), and the
labeled P protein was immunoprecipitated
with a polyclonal rabbit
antibody against
VSV.
To determine the effect of D609 on kinases, standard phosphorylation
reactions containing RSV P protein as a substrate,
[

-
32P]ATP as a phosphate donor, and purified kinases
or total HEp-2
extract as a source of kinase were carried out (
7,
29) in
the presence of a range of D609 concentrations. Reaction
mixtures
lacking the substrate P protein but otherwise complete were
incubated
in ice for 5 min. Reactions were then initiated by addition
of
the P protein. Incubations were carried out at 37°C for 5 min
and
then terminated by the addition of sodium dodecyl sulfate
(SDS) sample
buffer as previously described (
29). In parallel
reactions
it was ensured that the reaction rate was linear at
the time of
termination. The CK1 inhibitor CK1-7 (Seikagaku America,
Ijamsville,
Md.) was also used in a similar manner at a final
concentration of 40 µM (
8).
Sequencing of RNA.
The details of the sequencing of the
short transcripts produced in RSV transcription reactions in vitro (see
Fig. 4) will be described elsewhere. In brief, the labeled RNAs were
located by autoradiography and the bands were excised. RNA was eluted by overnight incubation in the presence of 1% SDS. A 2-µg sample of
carrier tRNA was added to it, and the RNA was subjected to phenol-chloroform extraction, followed by precipitation with ethanol and ether. The triphosphate group at the 5' end was removed by calf
intestinal alkaline phosphatase as previously described
(25); the 5' end was then phosphorylated by using T4
polynucleotide kinase. The RNA was sequenced by two different methods.
(i) In the ligation-RT-PCR method, the synthetic RNA, G8,
was first ligated to the 5' end of the transcript by using T4 RNA
ligase. The 3' end of the product was then ligated to the
phosphorylated 5' end of another synthetic RNA with the sequence
GGU12 to generate the chimeric RNA with the final sequence
G8-(RSV RNA)-GGU12. This chimeric RNA was then
amplified by RT followed by PCR using avian myeloblastosis virus
reverse transcriptase, Pfu polymerase, and primers G8 and
A12CC (complementary to the two synthetic termini). The
product was cloned into an SmaI-cut vector by blunt-end
ligation and then sequenced by using primers in the vector regions
flanking the insert. (ii) In the enzymatic sequencing method,
corresponding RNAs from a nonradioactive transcription reaction were
gel purified and used in enzymatic analysis essentially as previously
described (25). The nucleotide sequence at the 3' end was
determined by ligation with 5'-[32P]pCp, followed by
digestion with RNase T2. The nucleotide sequence at the 5' end was
determined by labeling of the 5' end of the RNA with polynucleotide
kinase and [
-32P]ATP, followed by digestion with
nuclease P1. For both the 5' and 3' nucleotides, the RNase-digested
material was analyzed by two-dimensional thin-layer chromatography
(25).
 |
RESULTS |
Ser232 is the major site of phosphorylation in P
proteins of all strains of RSV.
We have previously shown that
Ser232 is the major site of phosphorylation of the P
protein of HRSV ex vivo (expressed in HEp-2 cells) and in vitro by a
cellular protein kinase activity that had the hallmarks of CK2 (7,
29, 38). Using an in vitro transcription assay, we also showed
that the Ser232 phosphate is the primary determinant of the
transcriptional activity of the P protein while the phosphate at
Ser237 makes a much smaller contribution (7).
Since this offers an important mechanism of regulation of P function,
we wanted to test whether this phenomenon is unique to HRSV or
operational in the nonhuman strains also. To this end, we expressed the
P proteins of the BRSV and ORSV strains and their S232A, S237A, and
S232,237A mutants in bacteria. It should be recalled that the P
proteins of the HRSV, BRSV, and ORSV strains are highly similar and
have 77% amino acid identity with one another in pairwise alignment
(1, 28). Particularly similar are the C-terminal ends of all
three, and this area includes Ser232 and Ser237
(7). We therefore expressed the wild-type and mutant P
proteins of ORSV BRSV and tested them as substrates for phosphorylation by total HEp-2 cell extract in vitro. Results presented in Fig. 1 show that as in the case of HRSV P,
mutation of Ser232 also abrogated phosphorylation in the
BRSV and ORSV P proteins. The inhibition of this phosphorylation by
heparin and anti-CK2 antibody confirmed that the protein kinase
involved is identical to or resembles CK2 (data not shown). Thus,
Ser232 appears to be the universal site of phosphorylation
in the P proteins of all RSV strains.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 1.
In vitro phosphorylation of recombinant BRSV and ORSV P
proteins. The following purified proteins were phosphorylated by using
total HEp-2 cell extract as described in Materials and Methods (lane
designations are in parentheses): wild-type HRSV (WT), used as a
standard marker and a positive control; an equivalent fraction from a
pET-3a vector-only strain (Vector); wild-type BRSV P (WT); S237A mutant
BRSV P (237); S232A mutant BRSV P (232); S232, 237A double mutant BRSV
P (232,237); wild-type ORSV P (WT); S237A mutant ORSV P (237); S232A
mutant ORSV P (232); and S232, 237A double mutant ORSV P (232,237). The
phosphorylation reactions were analyzed by SDS-polyacrylamide gel
electrophoresis followed by staining (B) or autoradiography (A). The
identity of the bands as P was confirmed by immunoblot analysis (C)
using an antibody against HRSV P.
|
|
Essential role of CK2-mediated phosphorylation of
Ser232 in BRSV and ORSV P protein transcriptional
activity.
Due to the absence of a reconstituted in vitro
transcription system for BRSV and ORSV, we were not able to test the
role of Ser232 phosphorylation of their P proteins in
homologous viral transcription. Nevertheless, since the nonhuman
proteins were highly similar to the human protein, we reasoned that
they might be able to replace human P in the reconstituted
transcription reaction of HRSV. Thus, standard P protein-responsive
HRSV transcription reactions containing template N-RNA, L protein, 22K
protein, and uninfected HEp-2 cell extract were reconstituted in which
human P was replaced with recombinant bovine or ovine P. Results in
Fig. 2 show that at optimal
concentrations, transcription achieved by the bovine and ovine P
proteins was about 40 and 25% of that achieved by the human
counterpart. It is therefore obvious that these two heterologous P
proteins are capable of functionally interacting with the
transcriptional macromolecules of HRSV.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Transcriptional activity of BRSV and ORSV P proteins.
Recombinant P proteins of BRSV and ORSV were expressed in
Escherichia coli and purified as described in Materials and
Methods. Transcription reactions (10 µl) were reconstituted with the
HRSV N-RNA template, HRSV L protein, HEp-2 cell extract (as a source of
actin and CK2), and various amounts (25, 50, 100, and 150 ng) of
recombinant wild-type (wt) and mutant P proteins, as indicated.
incorp., incorporated.
|
|
The ability of the bovine and ovine P proteins to activate
transcription in the human system in effect provided us with an
assay
for these P proteins. By using this assay, we then tested
the effect of
the S232A mutation in these proteins. As shown in
Fig.
2, just as in
human P (
7), mutation of Ser
232 to Ala in the
ovine and bovine P proteins destroyed their transcription
activation
property. Taken together, results of Fig.
1 and
2 and
earlier results
obtained with human P (
7,
38) prove a critical
role of
CK2-mediated phosphorylation of Ser
232 in all RSV P
proteins.
Ser232 phosphates of P protein are essential for RSV
transcription elongation.
The P protein is the only protein whose
phosphorylation is known to be important in RSV transcription and is
sensitive to lambda phosphatase (PP
) (2, 7, 29, 30).
There is no evidence that the L or N proteins of RSV are
phosphorylated. We have recently shown that actin and its accessory
proteins are also required for RSV transcription (10).
Although the phosphorylation status of actin is uncertain, pretreatment
of either actin or the accessory factor(s) with PP
did not destroy
its transcriptional activity (10). The susceptibility of the
HRSV P phosphates to PP
therefore provided us with a tool to remove
the phosphates of P midway in transcription and determine the effect of
their removal on transcription. As shown in Fig.
3A, addition of purified PP
to an RSV
transcription reaction completely inhibited transcription regardless of
the time at which it was added. The bulk of the transcription measured
as shown in Fig. 3 was transcription elongation, based on the following
reasoning. (i) The transcripts were labeled by using
-32P-labeled UTP (Materials and Methods), and there is
no known RSV transcript that starts with a U. In fact, U is extremely
rare within the first 15 nucleotides of all RSV transcripts (for
example, see Fig. 4A), A and G being predominant in this region. (ii)
The DEAE-cellulose paper (DE81) that we used to measure RNA synthesis (Fig. 3) efficiently binds RNA molecules greater than 15 to
20-nucleotides long. Shorter RNA molecules bind much less efficiently
and tend to get dissociated under our washing conditions
(3; data not shown). (iii) In standard reconstituted
RSV transcription reaction mixtures, full-length transcripts could be
detected as early as 5 min (data not shown). In other words, a drastic
shutdown of total UMP incorporation by PP
, such as in Fig. 3A, would
not be possible without cessation of RNA elongation. Thus, we conclude that phosphorylation of P is essential for the RNA elongation step of
RSV transcription.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of wild-type (A) and mutant (B) PP on RSV
transcription. In vitro transcription reactions (160 µl) were
reconstituted as described in Materials and Methods by using wild-type
(WT) recombinant P phosphorylated by total HEp-2 extract ( , solid
line). At 0, 10, 20, 30, and 60 min after the start of transcription
(arrowheads), a 30-µl reaction volume was taken out in a fresh tube
to which 40 ng of PP (1 µl) was added and incubation was
continued. At 0, 10, and 20 min after the addition of PP ( ,
dotted line), a 10-µl reaction volume was spotted onto DE81 paper.
The paper was then processed for quantitation of labeled transcripts as
described earlier (3). The various mutant forms of PP
were similarly added at 20 min of transcription, and the reaction was
monitored for another 20 min (B). The residual phosphatase activity of
each mutant form of PP is shown as a percentage of that of the wild
type (2). inc., incorporated.
|
|
As mentioned above, due to the unreliable binding of small RNA products
to DEAE-paper, measurement of total counts (Fig.
3)
could not answer
whether PP

additionally inhibited the initiation
of RSV
transcription. To address this question, therefore, we
directly
examined the RNA initiation products as described later
(see Fig.
4).
It should be mentioned that the amount of PP

used in these
experiments was known to be large enough to achieve nearly
instantaneous
and complete dephosphorylation of the amount of P protein
present
in the reaction mixture (
2; data not shown).
To validate that
the transcription inhibitory effect of PP

is truly
due to its
phosphatase activity and not due to any other inhibitory
activity
present in the preparation, we took advantage of the
catalytically
defective mutant forms of PP

that we had constructed
earlier
through site-directed mutagenesis. The mutations altered
critical
amino acid residues (His140, Arg73, and Asp49) that are
invariant
in all Ser/Thr phosphatases and play essential roles in the
catalytic
mechanism (
2). Three such mutant enzymes (and
their phosphatase
activities relative to the wild-type enzyme) were
H140Q (50%),
R73K (0.3%), and D49N (0.1%). These mutant enzymes were
expressed
in bacteria and purified in the same manner as the wild type.
When these mutant enzymes were added to RSV transcription reaction
mixtures, their inhibitory effects were roughly proportional to
their
residual phosphatase activity (Fig.
3B). Thus, the H140Q
mutant was
essentially as inhibitory as wild-type PP

while the
R73K mutant was
pronouncedly less inhibitory and D49N was almost
without effect. These
results confirm that the inhibitory effect
of PP

on RSV
transcription is truly due to its phosphatase activity
and not due to
any nonspecific inhibitor present in the
preparation.
The negative charge of the phosphate group at Ser232
contributes to P function.
The exact mechanism by which the
phosphate groups activate the elongation function of the P protein is
not known. Since a predominant feature of a phosphate group is its
highly negative charge, we tested the possibility that a negatively
charged amino acid, viz., Asp, may be able to functionally substitute
for Ser at position 232 to produce a mutant P protein that will be
constitutively active without CK2. Ser232 was therefore
mutated to Asp by site-directed mutagenesis, and the mutant was
expressed in bacteria, purified, and employed in a reconstituted RSV
transcription reaction. As shown in Table 1, the S232D mutant exhibited about 40%
of wild-type transcription activity (line 3) that was not affected by
the addition of either CK2 (line 4) or PP
(line 5) to the reaction,
suggesting that at least part of the transcriptional activity of the
Ser232 phosphate group is due to its negative charge. At
the same time, these results suggest that the phosphate group itself,
and not just its net negative charge, makes a large contribution to the total transcriptional activity of P.
Phosphate-free P protein can promote transcription initiation, but
phosphorylation is required for promoter clearance.
Since
phosphorylation of P was found to be important for transcription
elongation, we sought to determine whether it is also important for
initiation through direct analysis of the initiated transcripts. RSV
transcription was reconstituted under two conditions, both of which
would eliminate CK2-mediated phosphorylation of the P protein, i.e., by
using S232A mutant P or by using wild-type bacterial (phosphate-free) P
in the presence of anti-CK2 antibody and PP
. The anti-CK2 antibody
and PP
were included to rule out any phosphorylation of the
wild-type P protein during transcription by the HEp-2 extract that was
needed to provide actin, an essential cellular factor required for RSV
transcription. Results are shown in Fig.
4, where panel A
depicts the short initiation products resolved on a 24% polyacrylamide
gel containing 6 M urea and panel B depicts full-length mRNAs resolved
on an acidified agarose-urea gel. Reactions devoid of either L or P
produced no detectable transcript, suggesting that the P and L proteins
alone are incapable of any aspect of transcription (lanes 1 and 2 in
panels A and B). When unphosphorylated P protein was added together
with L, however, a heterogeneous population of oligoribonucleotides was produced that represented abortive initiation products (panel A, lane
3). No full-length transcripts were still detectable (panel B, lane 3).
An essentially identical RNA profile was obtained by using the S232A
mutant P protein, which is nonphosphorylatable by CK2 (lane 4). When
the sequences of the three major oligoribonucleotide products from lane
3 were determined, they were found to have identical 5' termini
complementary to the 3' terminus of the negative-sense genomic RNA
(13). The largest species was 24 nucleotides long and had
the sequence 5'ACGGGAAAAAATGCGTACAACAAA3'; the two smaller transcripts (9 and 11 nucleotides long) also had the same sequence and
were only shorter at the 3' end. All transcripts were devoid of a 5'
cap and a poly(A) tail (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Role of phosphorylation of P protein in a postinitiation
step of transcription. HRSV transcription was reconstituted essentially
as described in Materials and Methods, using all four
-32P-labeled ribonucleoside triphosphates. The following
P proteins were used: wild-type, phosphate-free recombinant P (in the
presence of 5 µg of anti-CK2 antibody and 200 ng of PP per
160-µl reaction mixture) (WT-P; lane 3); wild-type, recombinant P
prephosphorylated with total HEp-2 extract (WT-P-PO4; lanes
1 and 5); and Ser232Ala mutant recombinant P (S232A-P; lane 4).
Following a 2-h transcription at 30°C, the 32P-labeled
RNA was deproteinized and analyzed by electrophoresis on a 25% polyacrylamide gel (A) and an acid-agarose-urea gel (B)
as described in Materials and Methods. Autoradiographs of the gels are
shown. Each lane contains the equivalent of a 160-µl reaction
mixture. In panel A, the arrowhead indicates the putative leader RNA of
RSV; in this panel, the mRNAs did not enter the gel and remained in the
loading slots, as indicated. The major labeled RNA bands, as shown,
were excised from the gel and sequenced as described in Materials and
Methods. Panel B shows the mRNAs for the various RSV genes
(F, N, etc.), as indicated. Identical lane
numbers in the two panels indicate identical reactions. In panel B,
lanes 1 to 4 were slightly overexposed to detect any RNA band
corresponding to lane 5 and none was found.
|
|
Standard transcription reactions employing phosphorylated P protein
(panel B, lane 5) produced mostly larger mRNAs, confirming
our previous
results (
30), but also produced very small amounts
of
apparently similar short transcripts, which further supported
our
assertion that the short transcripts may be bona fide intermediates
of
normal transcription and not degradation products. This is
consistent
with a model of RSV transcription in which the negative-strand
genomic
RNA encodes a single promoter at its 3' end, from which
the viral RNA
polymerase initiates transcription. Additionally,
these results
demonstrated that the viral RNA polymerase made
up of nonphosphorylated
P protein is initiation proficient but
does not travel beyond about 24 nucleotides of the leader region,
suggesting a possible defect in
promoter
clearance.
To reiterate, the results in Fig.
3 and
4 strongly suggest that
phosphorylation of P is required for the elongation activity
of the RNA
polymerase, including promoter
clearance.
Xanthate compound D609 inhibits CK2 and P phosphorylation in
vitro.
D609 has been shown to inhibit the growth of a number of
viruses, including VSV and RSV, in cell culture (33, 42).
Subsequently, it was shown to inhibit the intracellular phosphorylation
of RSV P protein and synthesis of RSV N protein; however, replication of viral genomic RNA was not affected. Although the exact target of
D609 remained undefined, based on the foregoing, it was logical to test
whether D609 inhibits P protein phosphorylation by CK2 in vitro. As
shown in Fig. 5, D609 inhibited the
phosphorylation of recombinant RSV P by purified CK2 with a 50%
inhibitory concentration of about 30 µM. Similar inhibition of
phosphorylation was also seen when the total HEp-2 extract was used as
the source of CK2 (data not shown). However, in contrast to a previous
study in which 30 µM D609 inhibited intracellular phosphorylation of
RSV P or growth of RSV in cell culture (ex vivo), we failed to obtain appreciable inhibition of either of these (Fig. 5). We do not have any
explanation for this apparent discrepancy of the ex vivo activity of
D609. It is possible that minor differences in cell culture conditions
or medium composition have large effects on the potency or cellular
uptake of D609. In apparent contrast, under the same conditions (45 µM D609), growth of VSV (on BHK-21 cells) and intracellular
phosphorylation of VSV P protein were inhibited by 60 and 95%,
respectively (33; data not shown). Thus, we presume
that inhibition of RSV growth by D609 is only observed under conditions
in which RSV P protein phosphorylation is also inhibited, indicating a
possible relationship between the two (42). Since we failed
to reproduce ex vivo inhibition of either process, we could not study
its mechanism further.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of D609 on RSV growth and P protein
phosphorylation. The various concentrations of D609 used in vitro and
ex vivo are indicated. The effect of D609 on CK2 activity in vitro
( ) was tested by using recombinant RSV P as a substrate and total
HEp-2 extract as the source of CK2 in a standard kinase reaction; use
of purified CK2 produced essentially similar results. Ex vivo effects
of D609 were determined by monitoring progeny viral titer ( ) and
metabolic labeling of RSV P protein ( ) by 32Pi. All data
are presented as percentages of values obtained with samples not
treated with D609.
|
|
RSV P can be a substrate for CK1.
Our investigations of a
non-CK2 kinase for RSV P protein were based on two lines of evidence
obtained earlier. First, when total HEp-2 extract was the source of the
kinase, about 5% of the P protein phosphorylation remained resistant
to D609 (data not shown). Second, P protein in which the two CK2
sites
Ser232 and Ser237
were both mutated
still contained about 5% of the wild-type phosphates ex vivo (7,
38). To identify the kinases involved in this residual
phosphorylation, we tested two multipotent protein kinases, viz., CK1
and protein kinase A, for the ability to phosphorylate purified
recombinant RSV P in vitro. CK1 was found to phosphorylate P protein
efficiently, whereas protein kinase A did not (data not shown). The
stoichiometry of CK1-mediated phosphorylation was found to be about
0.5, suggesting the existence of at least one phosphorylation site in
the polypeptide.
In an attempt to understand the significance of CK1-mediated
phosphorylation, we first decided to map the site of this
phosphorylation
(data not shown). Use of a variety of deletion and
substitution
mutant forms of recombinant RSV P protein in vitro
eventually
led to the identification of Ser
215 as the
single site for CK1-mediated phosphorylation. The S215A
mutant RSV P
protein was completely devoid of phosphorylation
by purified CK1 in
vitro. Studies of a number of natural and synthetic
substrates have
shown that the consensus phosphorylation site
for CK1 is a Ser or Thr
at position
n preceded by an acidic amino
acid or a
phosphorylated Ser/Thr at
n 
3 (
24).
Ser
215, belonging to the sequence DEVS
215,
indeed conformed to the CK1 motif very
well.
Relative contributions of CK2 and CK1 to the intracellular
phosphorylation states of RSV P protein.
To investigate whether
CK1 may also contribute to the phosphorylation of P protein ex vivo, we
undertook a series of studies, the results of which will be summarized
here without any data shown. First, we analyzed the phosphorylation
status of recombinant mutant P proteins expressed in human cells (ex
vivo) by metabolic labeling with 32P followed by
immunoprecipitation. The S232,237A double mutant was found to contain
about 5 to 8% of the wild-type phosphates, confirming earlier findings
(7, 38). This residual phosphorylation was found to occur at
Ser215, since the 32P content of the
S215,232,237A triple mutant was undetectable. Essentially similar
results were obtained in vitro by using bacterially expressed
recombinant P proteins as substrates for phosphorylation by a total
HEp-2 cell extract. Phosphorylation of the S232,237A double mutant was
also completely inhibited by including a CK1 inhibitor, CK1-7
(8), in the in vitro reaction mixture, further corroborating
the finding that the small amounts (5 to 8%) of residual
phosphorylation were indeed due to a CK1-like activity in the HEp-2 cells.
In our second approach, we investigated the phosphorylation status of P
following abrogation of CK2. Although CK2-mediated
phosphorylation of
RSV P can be inhibited by chemical inhibitors
such as heparin in vitro
(
7,
29), these inhibitors either
do not enter cells or are
not completely specific for CK2, which
has precluded studies of
intracellular inhibition of CK2 in HEp-2
cells. Thus, we took advantage
of the only conditional lethal
CK2 mutant of
Saccharomyces
cerevisiae (yeast) available, which
has a temperature-sensitive
growth phenotype (
12). It has previously
been shown that at
the nonpermissive temperature (37°C), the CK2
in this mutant is
completely inactivated (
12). We expressed
the wild-type P
and its various Ser

Ala mutant forms in the CK2
mutant yeast and in
the otherwise isogenic wild-type yeast strain
at different temperatures
and analyzed their phosphorylation status
as described in Materials and
Methods. The wild-type and the S232A
and S237A mutant P proteins were
equally phosphorylated in both
yeast strains and at both nonpermissive
(37°C) and permissive
(25°C) temperatures (data not shown). The
S215A mutant protein,
to the contrary, was defective in phosphorylation
in both yeast
strains and at both temperatures. These results strongly
suggest
that CK1, and not CK2, is the major kinase for RSV P protein in
yeast. The inactivation of CK2 in the temperature-sensitive yeast
strain at 37°C was confirmed by assaying the CK2 activity of cell
extracts in vitro by using a specific peptide substrate as described
in
Materials and Methods; under the same conditions, CK1 activity
remained
unaffected (data not
shown).
Taken together, results in this section and those published earlier
(
7,
38) demonstrate that, in vitro as well as ex
vivo,
serine residues 232, 237, and 215 share all of the phosphates
of RSV P. While Ser
232 is the major site for CK2-mediated
phosphorylation, small amounts
of CK1-mediated phosphorylation occur at
Ser
215 in HEp-2
cells.
CK1-mediated phosphorylation of P is irrelevant for RSV
transcription in vitro.
To address the role of the newly
discovered, albeit minor, phosphorylation of P by CK1, we
phosphorylated recombinant RSV P protein by purified CK1 in vitro and
then assayed its transcriptional activity in RSV transcription
reconstituted in the presence of anti-CK2 antibody. The anti-CK2
antibody was previously shown to be effective in inhibiting the CK2
activity present in the HEp-2 extract that was needed to provide actin,
which is essential for RSV transcription (7, 10, 30). As
shown in Table 1, CK1-catalyzed phosphorylation did not bestow
transcriptional function on the P protein (line 6). Furthermore, the
S215A mutant P was transcriptionally as active as the wild type (Table
1, line 7). These results suggest that phosphorylation of RSV P by CK1
has no discernible role in RSV transcription in vitro. Its lack of biological relevance is further underscored by the fact that this Ser
is not conserved in the BRSV and ORSV P proteins and is replaced with
Lys and Asn, respectively. The possible role of this phosphorylation in
HRSV P ex vivo could not be investigated due to the lack of a
conditional lethal CK1 mutant host cell line or a highly specific cell-permeable inhibitor of CK1.
 |
DISCUSSION |
In this communication, we have provided a comprehensive account of
the phosphate groups of the RSV P protein, the responsible kinases, and
their potential role in RSV transcription. To sum up, we have shown the
following. (i) Whereas Ser232 is the primary site for
CK2-mediated phosphorylation (7; also Fig. 1 and 2),
the only site for CK1-mediated phosphorylation is Ser215
both in vitro and ex vivo. These two residues and the minor CK2 site
Ser237 account for all of the phosphates of the RSV P
protein. (ii) L protein alone, in the absence of P, cannot initiate
transcription (Fig. 4). (iii) Initiation of transcription per se does
not require phosphorylation of P (Fig. 4 and
6). (iv) CK2-mediated phosphorylation of
P is essential for productive exit of the polymerase from the promoter
and for continued transcription elongation (Fig. 4 and 6). (v) Minor
amounts of phosphorylation by CK1 occur at Ser215 but are
not required for transcription in vitro (Table 1).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
Model for the role of P protein in transcription
initiation and elongation. (a) Even unphosphorylated P can stimulate
loading of the L-P complex at the promoter sequence of the N-RNA
template; i.e., phosphorylation is not required for this step. This
complex generates abortive transcripts within the leader region. (b)
Phosphorylation of P, likely resulting in allosteric conformational
changes in the P and L proteins, leads to suppression of the abortive
transcription, promoter clearance of the polymerase, and production of
full-length transcripts (for details, see the text). The exact
stoichiometry of L and P in the functional polymerase is not known.
|
|
Although the functional RNA polymerase of RSV requires both the L and P
proteins, the relative contributions of the two proteins to polymerase
function remain unknown. The essential role of both proteins derives
from two kinds of evidence, viz., analysis of conditional lethal
mutations and reconstitution experiments in vitro and ex vivo. First,
the L protein was found to contain multiple mutations in a
cold-sensitive RSV strain (23) and a T736A substitution in
another attenuated strain (39). Also, the temperature
sensitivity of the tsN19 mutant strain of RSV was due to a
G172S mutation in the P protein (11). In an ex vivo
cDNA-based reconstitution system, transfection of both L and P cDNAs
was required for the synthesis of full-length viral mRNAs and genomic
RNA (17, 44). Finally, in vitro, both L and P were
absolutely required to reconstitute functional transcription that
generated full-length mRNA (7, 30). These studies, however,
did not address the role of these proteins or the role of
phosphorylation of P in the various steps of the transcription process.
Our in vitro results (Fig. 4) showed that the P protein, in the absence
of L, did not produce any detectable transcript. The L protein alone
was also incapable of transcription. These results suggest that the
basic promoter-binding and ribonucleotide polymerase activities of the
viral RNA-dependent RNA polymerase require participation of both L and
P. In this regard, RSV appears to be similar to VSV and Sendai virus,
two nonsegmented negative-strand RNA viruses in both of which the P
protein appears to be required for the binding of L to the template
N-RNA (15, 21, 32).
When phosphate-free RSV P protein was added along with L, the resultant
RSV transcription complex was capable of activating transcription
although the transcripts were still short (Fig. 4). This was shown by
using either unphosphorylated P (lane 3) or conducting transcription in
the presence of PP
(lane 4). The lack of a need for phosphorylation
of RSV P in transcription initiation is also supported by our finding
that phosphorylated and unphosphorylated P proteins bound equally well
to the template N-RNA in a simple binding assay (30). The
sequencing of the short transcripts indicated that they were uncapped,
unpolyadenylated, and complementary to the 3' end of the genomic RNA
and thus may be analogous to the leader RNAs that have been found in a
number of other negative-strand RNA viruses, such as VSV and Sendai
virus (26). Although the minimal promoter of RSV remains
undefined, recent studies with VSV have shown that about 24 nucleotides
of the terminal bases are absolutely essential for transcription
(27, 43). Full transcriptional activity requires additional
sequence elements within the leader at positions 19 to 29 and 34 to 46, and a separate element at nucleotides 47 to 50, in the nontranscribed
leader-N gene junction (43). The longest abortive
RSV transcript, of 24 nucleotides, detected by us in vitro (Fig. 4) is
thus reminiscent of the minimal promoter length of VSV and may, in
fact, define the minimal functional RSV promoter. To our knowledge,
this is the first direct demonstration of free transcripts originating from the leader region of the RSV genome. Since the leader RNA of
negative-strand RNA viruses is believed to play an important role in
the initiation of encapsidation (binding of N protein to the genomic
RNA) and hence in the regulation of the transcription-to-replication switch (9, 35), further characterization of the RSV leader RNAs will be an important breakthrough in RSV gene expression. This is
currently in progress.
Full-length mRNAs were only produced when L was used together with
phosphorylated P protein (30), suggesting that a major role
of phosphorylation of P is to provide the L protein the initial processivity required for promoter clearance (Fig. 4, lanes 5). It
should be pointed out that this is fundamentally different from the
processivity imparted by the RSV M2 (22K) protein that results in the
suppression of intra- as well as intergenic pause and termination
throughout the genome (14, 20). Increasing amounts of M2, in
fact, generated progressively higher readthrough of adjacent genes and
resultant unnatural, chimeric transcripts (20).
Phosphoprotein P, in contrast, only suppresses abortive transcription
within the leader region at the promoter and does not unduly suppress
the natural intergenic termination signals downstream, even at a
relatively high concentration (7, 30; data not shown).
The finding that CK1 can phosphorylate recombinant HRSV P is
intriguing, since this phosphorylation appears to occur primarily in
yeast cells or by use of purified CK1 in vitro and is not important for
transcription (Table 1). We do not known if it plays any role in
replication. In HEp-2, which is the host cell for HRSV growth and
therefore more relevant in our studies, CK2 is responsible for the vast
majority of phosphates that are located mostly at Ser232 of
the P protein (7, 38) with only about a 5% contribution from Ser215, the site of CK1-mediated phosphorylation. It
is hard to ascertain why yeast and HEp-2 cells phosphorylate HSRV P on
different residues and through CK1 and CK2, respectively, especially
because the exact locations and nature of CK1 and CK2 in any cell are
not definitively known (18, 36). Both enzymes are considered
ubiquitous based on the fact that their activities can be measured in
extracts of virtually all kinds of cells in vitro by using artificial
and physiological substrates. However, one cannot rule out the
possibility that they associate with various regulatory subunits in
cells of different evolutionary origin in vivo (18, 36),
which results in their differential accessibility to P protein.
Alternatively, the catalytic subunits of CK1 and CK2 of yeast may have
substrate recognition properties that differ from those of their HEp-2
counterparts. In any case, until new results are obtained to the
contrary, we will consider it unlikely that the minor CK1-mediated
phosphorylation of P has any significance in the HRSV life cycle.
Although the various steps of RSV transcription are still to be
characterized, we suggest a working hypothesis of the P protein function modeled after our knowledge of eukaryotic transcription (Fig.
6). We believe that although L may encode many transcription-related domains, it cannot by itself recognize the promoter sequence at the 3'
terminus of the N-RNA template (the leader region). P protein, in
analogy to the eukaryotic transcription factors, may stabilize promoter-L interactions and thus lead to an active promoter-polymerase complex (46). This function of P does not require
phosphorylation and results in the generation of the short leader-like
transcripts free of caps and poly(A) tails. The RNA polymerase
assembled with phosphate-free P is perhaps akin to a "closed"
complex that is still in the initiation mode and fails to proceed
beyond the promoter region (31). Phosphorylation of P allows
this complex to attain an "open" conformation committed to
elongation and necessary for promoter clearance and movement along the
template. The transcripts produced in the absence of phosphorylation of
P are therefore essentially analogous to the abortive transcription
products of other, DNA-dependent, RNA polymerases (31, 41).
Since dephosphorylation of P produced immediate loss of RNA elongation
at all time points, we further postulate that the open conformation is
essential for elongation throughout transcription and that the
continued association of phosphorylated P is needed for the maintenance
of this open conformation. Recently, use of reconstituted chromatin
templates in vitro has led to the discovery of a novel protein factor,
FACT (facilitates chromatin transcription), which acts subsequent to transcription initiation to release RNA polymerase II from a
nucleosome-induced block to productive transcription (34).
We postulate that the P protein acts in an analogous manner for
RNA-dependent RNA polymerase, initiating transcription on RNA-based
chromatin, i.e., RNA templates wrapped with N protein.
 |
ACKNOWLEDGMENTS |
This research was supported in part by a grant from NIAID
(AI37938 to S.B.).
We are indebted to James C. Wang (Harvard University) for the gift of
the pYEP-PGAL1 plasmid, to Claiborne V. C. Glover (University of
Georgia) for the yeast strains, and to Howard D. Lehmkuhl (USDA-ARS, Ames, Iowa) for ovine RSV strain WSU 83-1578.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Molecular Biology, University of South Alabama,
College of Medicine, 307 University Blvd., Mobile, AL 36688-0002. Phone: (334) 460-6860. Fax: (334) 460-6127. E-mail:
sbarik{at}jaguar1.usouthal.edu.
 |
REFERENCES |
| 1.
|
Alansari, H., and L. N. D. Potgieter.
1994.
Molecular cloning and sequence analysis of the phosphoprotein, nucleocapsid protein, matrix protein and 22K (M2) protein of the ovine respiratory syncytial virus.
J. Gen. Virol.
75:3597-3601[Abstract/Free Full Text].
|
| 2.
|
Ansai, T.,
L. C. Dupuy, and S. Barik.
1996.
Interaction between a minimal protein serine/threonine phosphatase and its phosphopeptide substrate sequence.
J. Biol. Chem.
271:24401-24407[Abstract/Free Full Text].
|
| 3.
|
Barik, S.
1992.
Transcription of human respiratory syncytial virus genome RNA in vitro: requirement of cellular factor(s).
J. Virol.
66:6813-6818[Abstract/Free Full Text].
|
| 4.
|
Barik, S.
1993.
Expression and biochemical properties of a protein serine/threonine phosphatase encoded by bacteriophage .
Proc. Natl. Acad. Sci. USA
15:10633-10637.
|
| 5.
|
Barik, S.
1997.
Mutagenesis and gene fusion by megaprimer PCR.
Methods Mol. Biol.
67:173-182[Medline].
|
| 6.
|
Barik, S., and A. Das.
1990.
An analysis of the role of host factors in transcription antitermination in vitro by the Q protein of coliphage lambda.
Mol. Gen. Genet.
222:152-156[Medline].
|
| 7.
|
Barik, S.,
T. McLean, and L. C. Dupuy.
1995.
Phosphorylation of Ser232 directly regulates the transcriptional activity of the P protein of human respiratory syncytial virus: phosphorylation of Ser237 may play an accessory role.
Virology
213:405-412[Medline].
|
| 8.
|
Barik, S.,
R. E. Taylor, and D. Chakrabarti.
1997.
Identification, cloning, and mutational analysis of the casein kinase 1 cDNA of the malaria parasite, Plasmodium falciparum. Stage-specific expression of the gene.
J. Biol. Chem.
272:26132-26138[Abstract/Free Full Text].
|
| 9.
|
Blumberg, B. M.,
M. Leppert, and D. Kolakofsky.
1981.
Interaction of VSV leader RNA and nucleocapsid protein may control VSV genome replication.
Cell
23:837-845[Medline].
|
| 10.
|
Burke, E.,
L. Dupuy,
C. Wall, and S. Barik.
1998.
Role of cellular actin in the gene expression and morphogenesis of human respiratory syncytial virus.
Virology
252:137-148[Medline].
|
| 11.
|
Caravokyri, C.,
A. J. Zajac, and C. R. Pringle.
1992.
Assignment of mutant tsN19 (complementation group E) of respiratory syncytial virus to the P protein gene.
J. Gen. Virol.
73:865-873[Abstract/Free Full Text].
|
| 12.
|
Cardenas, M. E.,
Q. Dang,
C. V. Glover, and S. M. Gasser.
1992.
Casein kinase II phosphorylates the eukaryote-specific C-terminal domain of topoisomerase II in vivo.
EMBO J.
11:1785-1796[Medline].
|
| 13.
|
Collins, P. L.,
M. G. Hill,
E. Camargo,
H. Grosfeld,
R. M. Chanock, and B. R. Murphy.
1995.
Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5' proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine development.
Proc. Natl. Acad. Sci. USA
92:11563-11567[Abstract/Free Full Text].
|
| 14.
|
Collins, P. L.,
M. G. Hill,
J. Cristina, and H. Grosfeld.
1996.
Transcription elongation factor of respiratory syncytial virus, a nonsegmented negative-strand RNA virus.
Proc. Natl. Acad. Sci. USA
93:81-85[Abstract/Free Full Text].
|
| 15.
|
Emerson, S. U., and M. Schubert.
1987.
Location of the binding domains for the RNA polymerase L and the ribonucleocapsid template within different halves of the NS phosphoprotein of vesicular stomatitis virus.
Proc. Natl. Acad. Sci. USA
84:5655-5659[Abstract/Free Full Text].
|
| 16.
|
Giaever, G. N.,
L. Snyder, and J. C. Wang.
1988.
DNA supercoiling in vivo.
Biophys. Chem.
29:7-15[Medline].
|
| 17.
|
Grosfeld, H.,
M. G. Hill, and P. L. Collins.
1995.
RNA replication by respiratory syncytial virus (RSV) is directed by the N, P, and L proteins; transcription also occurs under these conditions but requires RSV superinfection for efficient synthesis of full-length mRNA.
J. Virol.
69:5677-5686[Abstract].
|
| 18.
|
Gross, S. D., and R. A. Anderson.
1998.
Casein kinase I: spatial organization and positioning of a multifunctional protein kinase family.
Cell. Signal.
10:699-711[Medline].
|
| 19.
|
Hall, C. B.
1994.
Prospects for a respiratory syncytial virus vaccine.
Science
265:1393-1394[Free Full Text].
|
| 20.
|
Hardy, R. W., and G. W. Wertz.
1998.
The product of the respiratory syncytial virus M2 gene ORF1 enhances readthrough of intergenic junctions during viral transcription.
J. Virol.
72:520-526[Abstract/Free Full Text].
|
| 21.
|
Horikami, S. M.,
J. Curran,
D. Kolakofsky, and S. A. Moyer.
1992.
Complexes of Sendai virus NP-P and P-L proteins are required for defective interfering particle genome replication in vitro.
J. Virol.
66:4901-4908[Abstract/Free Full Text].
|
| 22.
|
Huang, Y. T.,
R. R. Romito,
B. P. De, and A. K. Banerjee.
1993.
Characterization of the in vitro system for the synthesis of mRNA from human respiratory syncytial virus.
Virology
193:862-867[Medline].
|
| 23.
|
Juhasz, K.,
S. S. Whitehead,
P. T. Bui,
J. M. Biggs,
J. E. Crowe,
C. A. Boulanger,
P. L. Collins, and B. R. Murphy.
1997.
The temperature-sensitive (ts) phenotype of a cold-passaged (cp) live attenuated respiratory syncytial virus vaccine candidate, designated cpts530, results from a single amino acid substitution in the L protein.
J. Virol.
71:5814-5819[Abstract].
|
| 24.
|
Kennelly, P. J., and E. G. Krebs.
1991.
Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases.
J. Biol. Chem.
266:15555-15558[Free Full Text].
|
| 25.
|
Kuchino, Y., and S. Nishimura.
1989.
Enzymatic RNA sequencing.
Methods Enzymol.
180:154-163[Medline].
|
| 26.
|
Leppert, M.,
L. Rittenhouse,
J. Perrault,
D. F. Summers, and D. Kolakofsky.
1979.
Plus and minus strand leader RNAs in negative strand virus-infected cells.
Cell
18:735-747[Medline].
|
| 27.
|
Li, T., and A. K. Pattnaik.
1999.
Overlapping signals for transcription and replication at the 3' terminus of the vesicular stomatitis virus genome.
J. Virol.
73:444-452[Abstract/Free Full Text].
|
| 28.
|
Mallipeddi, S. K., and S. K. Samal.
1992.
Sequence comparison between the phosphoprotein mRNAs of human and bovine respiratory syncytial viruses identifies a divergent domain in the predicted protein.
J. Gen. Virol.
73:2441-2444[Abstract/Free Full Text].
|
| 29.
|
Mazumder, B.,
G. Adhikary, and S. Barik.
1994.
Bacterial expression of human respiratory syncytial virus phosphoprotein P and identification of Ser237 as the site of phosphorylation by cellular casein kinase II.
Virology
205:93-103[Medline].
|
| 30.
|
Mazumder, B., and S. Barik.
1994.
Requirement of casein kinase II-mediated phosphorylation for the transcriptional activity of human respiratory syncytial viral phosphoprotein P: transdominant negative phenotype of phosphorylation-defective P mutants.
Virology
205:104-111[Medline].
|
| 31.
|
McClure, W. R.
1985.
Mechanism and control of transcription initiation in prokaryotes.
Annu. Rev. Biochem.
54:171-204[Medline].
|
| 32.
|
Mellon, M. G., and S. U. Emerson.
1978.
Rebinding of transcriptase components (L and NS proteins) to the nucleocapsid template of vesicular stomatitis virus.
J. Virol.
27:560-567[Abstract/Free Full Text].
|
| 33.
|
Muller-Decker, K.,
E. Amtmann, and G. Sauer.
1987.
Inhibition of the phosphorylation of the regulatory non-structural protein of vesicular stomatitis virus by an antiviral xanthate compound.
J. Gen. Virol.
68:3045-3056[Abstract/Free Full Text].
|
| 34.
|
Orphanides, G.,
G. LeRoy,
C. H. Chang,
D. S. Luse, and D. Reinberg.
1998.
FACT, a factor that facilitates transcript elongation through nucleosomes.
Cell
92:105-116[Medline].
|
| 35.
|
Pattnaik, A. K.,
L. A. Ball,
A. LeGrone, and G. W. Wertz.
1995.
The termini of VSV DI particle RNAs are sufficient to signal RNA encapsidation, replication, and budding to generate infectious particles.
Virology
206:760-764[Medline].
|
| 36.
|
Pinna, L. A., and F. Meggio.
1997.
Protein kinase CK2 ("casein kinase-2") and its implication in cell division and proliferation.
Prog. Cell Cycle Res.
3:77-97[Medline].
|
| 37.
|
Samal, S. K.,
M. Zamora,
T. H. McPhillips, and S. B. Mohanty.
1991.
Molecular cloning and sequence analysis of bovine respiratory syncytial virus mRNA encoding the major nucleocapsid protein.
Virology
180:453-456[Medline].
|
| 38.
|
Sanchez-Seco, M. P.,
J. Navarro,
R. Martinez, and N. Villanueva.
1995.
C-terminal phosphorylation of human respiratory syncytial virus P protein occurs mainly at serine residue 232.
J. Gen. Virol.
76:425-430[Abstract/Free Full Text].
|
| 39.
|
Tolley, K. P.,
A. C. Marriott,
A. Simpson,
D. J. Plows,
D. A. Matthews,
S. J. Longhurst,
J. E. Evans,
J. L. Johnson,
P. A. Cane,
V. B. Randolph,
A. J. Easton, and C. R. Pringle.
1996.
Identification of mutations contributing to the reduced virulence of a modified strain of respiratory syncytial virus.
Vaccine
14:1637-1646[Medline].
|
| 40.
|
Trudel, M.,
F. Nadon,
C. Simard,
F. Belanger,
R. Alain,
C. Seguin, and G. Lussier.
1989.
Comparison of caprine, human and bovine strains of respiratory syncytial virus.
Arch. Virol.
107:141-149[Medline].
|
| 41.
|
Uptain, S. M.,
C. M. Kane, and M. J. Chamberlin.
1997.
Basic mechanisms of transcript elongation and its regulation.
Annu. Rev. Biochem.
66:117-172[Medline].
|
| 42.
|
Villanueva, N.,
J. Navarro, and E. Cubero.
1991.
Antiviral effects of xanthate D609 on the human respiratory syncytial virus growth cycle.
Virology
181:101-108[Medline].
|
| 43.
|
Whelan, S. P. J., and G. W. Wertz.
1999.
Regulation of RNA synthesis by the genomic termini of vesicular stomatitis virus: identification of distinct sequences essential for transcription but not replication.
J. Virol.
73:297-306[Abstract/Free Full Text].
|
| 44.
|
Yu, Q.,
R. W. Hardy, and G. W. Wertz.
1995.
Functional cDNA clones of the human respiratory syncytial (RS) virus N, P, and L proteins support replication of RS virus genomic RNA analogs and define minimal trans-acting requirements for RNA replication.
J. Virol.
69:2412-2419[Abstract].
|
| 45.
|
Yunus, A. S.,
P. L. Collins, and S. K. Samal.
1998.
Sequence analysis of a functional polymerase (L) gene of bovine respiratory syncytial virus: determination of minimal trans-acting requirements for RNA replication.
J. Gen. Virol.
79:2231-2238[Abstract].
|
| 46.
|
Zawel, L., and D. Reinberg.
1995.
Common themes in assembly and function of eukaryotic transcription complexes.
Annu. Rev. Biochem.
64:533-561[Medline].
|
Journal of Virology, October 1999, p. 8384-8392, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tawar, R. G., Duquerroy, S., Vonrhein, C., Varela, P. F., Damier-Piolle, L., Castagne, N., MacLellan, K., Bedouelle, H., Bricogne, G., Bhella, D., Eleouet, J.-F., Rey, F. A.
(2009). Crystal Structure of a Nucleocapsid-Like Nucleoprotein-RNA Complex of Respiratory Syncytial Virus. Science
326: 1279-1283
[Abstract]
[Full Text]
-
Harpen, M., Barik, T., Musiyenko, A., Barik, S.
(2009). Mutational Analysis Reveals a Noncontractile but Interactive Role of Actin and Profilin in Viral RNA-Dependent RNA Synthesis. J. Virol.
83: 10869-10876
[Abstract]
[Full Text]
-
Timani, K. A., Sun, D., Sun, M., Keim, C., Lin, Y., Schmitt, P. T., Schmitt, A. P., He, B.
(2008). A Single Amino Acid Residue Change in the P Protein of Parainfluenza Virus 5 Elevates Viral Gene Expression. J. Virol.
82: 9123-9133
[Abstract]
[Full Text]
-
Bitko, V., Musiyenko, A., Bayfield, M. A., Maraia, R. J., Barik, S.
(2008). Cellular La Protein Shields Nonsegmented Negative-Strand RNA Viral Leader RNA from RIG-I and Enhances Virus Growth by Diverse Mechanisms. J. Virol.
82: 7977-7987
[Abstract]
[Full Text]
-
Collins, P. L., Graham, B. S.
(2008). Viral and Host Factors in Human Respiratory Syncytial Virus Pathogenesis. J. Virol.
82: 2040-2055
[Full Text]
-
Sun, M., Fuentes, S. M., Timani, K., Sun, D., Murphy, C., Lin, Y., August, A., Teng, M. N., He, B.
(2008). Akt Plays a Critical Role in Replication of Nonsegmented Negative-Stranded RNA Viruses. J. Virol.
82: 105-114
[Abstract]
[Full Text]
-
Cowton, V. M., McGivern, D. R., Fearns, R.
(2006). Unravelling the complexities of respiratory syncytial virus RNA synthesis. J. Gen. Virol.
87: 1805-1821
[Abstract]
[Full Text]
-
Cowton, V. M., Fearns, R.
(2005). Evidence that the Respiratory Syncytial Virus Polymerase Is Recruited to Nucleotides 1 to 11 at the 3' End of the Nucleocapsid and Can Scan To Access Internal Signals. J. Virol.
79: 11311-11322
[Abstract]
[Full Text]
-
Castagne, N., Barbier, A., Bernard, J., Rezaei, H., Huet, J.-C., Henry, C., Costa, B. D., Eleouet, J.-F.
(2004). Biochemical characterization of the respiratory syncytial virus P-P and P-N protein complexes and localization of the P protein oligomerization domain. J. Gen. Virol.
85: 1643-1653
[Abstract]
[Full Text]
-
Rahaman, A., Srinivasan, N., Shamala, N., Subbarao Shaila, M.
(2004). Phosphoprotein of the Rinderpest Virus Forms a Tetramer through a Coiled Coil Region Important for Biological Function: A STRUCTURAL INSIGHT. J. Biol. Chem.
279: 23606-23614
[Abstract]
[Full Text]
-
Easton, A. J., Domachowske, J. B., Rosenberg, H. F.
(2004). Animal Pneumoviruses: Molecular Genetics and Pathogenesis. Clin. Microbiol. Rev.
17: 390-412
[Abstract]
[Full Text]
-
Mason, S. W., Aberg, E., Lawetz, C., DeLong, R., Whitehead, P., Liuzzi, M.
(2003). Interaction between Human Respiratory Syncytial Virus (RSV) M2-1 and P Proteins Is Required for Reconstitution of M2-1-Dependent RSV Minigenome Activity. J. Virol.
77: 10670-10676
[Abstract]
[Full Text]
-
MEGGIO, F., PINNA, L. A.
(2003). One-thousand-and-one substrates of protein kinase CK2?. FASEB J.
17: 349-368
[Abstract]
[Full Text]
-
Lu, B., Ma, C.-H., Brazas, R., Jin, H.
(2002). The Major Phosphorylation Sites of the Respiratory Syncytial Virus Phosphoprotein Are Dispensable for Virus Replication In Vitro. J. Virol.
76: 10776-10784
[Abstract]
[Full Text]
-
Eichwald, C., Vascotto, F., Fabbretti, E., Burrone, O. R.
(2002). Rotavirus NSP5: Mapping Phosphorylation Sites and Kinase Activation and Viroplasm Localization Domains. J. Virol.
76: 3461-3470
[Abstract]
[Full Text]
-
Fearns, R., Peeples, M. E., Collins, P. L.
(2002). Mapping the Transcription and Replication Promoters of Respiratory Syncytial Virus. J. Virol.
76: 1663-1672
[Abstract]
[Full Text]
-
Harmon, S. B., Megaw, A. G., Wertz, G. W.
(2001). RNA Sequences Involved in Transcriptional Termination of Respiratory Syncytial Virus. J. Virol.
75: 36-44
[Abstract]
[Full Text]
-
Bukreyev, A., Murphy, B. R., Collins, P. L.
(2000). Respiratory Syncytial Virus Can Tolerate an Intergenic Sequence of at Least 160 Nucleotides with Little Effect on Transcription or Replication In Vitro and In Vivo. J. Virol.
74: 11017-11026
[Abstract]
[Full Text]
-
De, B. P., Hoffman, M. A., Choudhary, S., Huntley, C. C., Banerjee, A. K.
(2000). Role of NH2- and COOH-Terminal Domains of the P Protein of Human Parainfluenza Virus Type 3 in Transcription and Replication. J. Virol.
74: 5886-5895
[Abstract]
[Full Text]
-
Burke, E., Mahoney, N. M., Almo, S. C., Barik, S.
(2000). Profilin Is Required for Optimal Actin-Dependent Transcription of Respiratory Syncytial Virus Genome RNA. J. Virol.
74: 669-675
[Abstract]
[Full Text]
-
Farsetta, D. L., Chandran, K., Nibert, M. L.
(2000). Transcriptional Activities of Reovirus RNA Polymerase in Recoated Cores. INITIATION AND ELONGATION ARE REGULATED BY SEPARATE MECHANISMS. J. Biol. Chem.
275: 39693-39701
[Abstract]
[Full Text]