Previous Article | Next Article 
Journal of Virology, October 1999, p. 8356-8363, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Protection by Live, Attenuated Simian
Immunodeficiency Virus against Heterologous Challenge
Michael S.
Wyand,1
Kelledy
Manson,1
David C.
Montefiori,2
Jeffrey D.
Lifson,3
R. Paul
Johnson,4 and
Ronald
C.
Desrosiers4,*
New England Regional Primate Research Center,
Harvard Medical School, Southborough, Massachusetts
01772-91024; Primedica, Worcester,
Massachusetts 016081; Duke University
Medical Center, Department of Surgery, Durham, North Carolina
277102; and AIDS Vaccine Program,
SAIC
Frederick, NCI
Frederick Cancer Research and Development
Center, Frederick, Maryland 217013
Received 3 May 1999/Accepted 9 July 1999
 |
ABSTRACT |
We examined the ability of a live, attenuated deletion mutant of
simian immunodeficiency virus (SIV), SIVmac239
3, which is missing
nef and vpr genes, to protect against challenge
by heterologous strains SHIV89.6p and SIVsmE660. SHIV89.6p is a
pathogenic, recombinant SIV in which the envelope gene has been
replaced by a human immunodeficiency virus type 1 envelope gene; other
structural genes of SHIV89.6p are derived from SIVmac239. SIVsmE660 is
an uncloned, pathogenic, independent isolate from the same primate
lentivirus subgrouping as SIVmac but with natural sequence variation in
all structural genes. The challenge with SHIV89.6p was performed by the
intravenous route 37 months after the time of vaccination. By the
criteria of CD4+ cell counts and disease, strong protection
against the SHIV89.6p challenge was observed in four of four vaccinated
monkeys despite the complete mismatch of env sequences.
However, SHIV89.6p infection was established in all four previously
vaccinated monkeys and three of the four developed fluctuating viral
loads between 300 and 10,000 RNA copy equivalents per ml of plasma 30 to 72 weeks postchallenge. When other vaccinated monkeys were
challenged with SIVsmE660 at 28 months after the time of vaccination,
SIV loads were lower than those observed in unvaccinated controls but
the level of protection was less than what was observed against
SHIV89.6p in these experiments and considerably less than the level of
protection against SIVmac251 observed in previous experiments. These
results demonstrate a variable level of vaccine protection by live,
attenuated SIVmac239
3 against heterologous virus challenge and
suggest that even live, attenuated vaccine approaches for AIDS will
face significant hurdles in providing protection against the natural
variation present in field strains of virus. The results further
suggest that factors other than anti-Env immune responses can be
principally responsible for the vaccine protection by live, attenuated SIV.
 |
INTRODUCTION |
Infection by live, attenuated
deletion mutants of simian immunodeficiency virus (SIV) has afforded
rhesus monkeys strong protection against subsequent challenge by
wild-type, disease-causing strains of SIV (4, 7, 18, 36).
While it has been argued that this protection could result from some
sort of blocking or interference phenomenon (13, 32, 34),
several lines of circumstantial evidence suggest that the protection
may be immune mediated (16). Protection has been shown to be
time dependent: the longer the time interval, the better the
protection, despite the fact that vaccine virus loads are highest
during the initial weeks following immunization (4, 36).
While the most solid protection has been observed in monkeys with
apparent sterilizing immunity, some animals have exhibited long-term
protective effects despite a transient take of the challenge virus
(18, 36), again apparently more consistent with
immune-mediated protection than with viral interference. Monkeys that
control replication of SIVmac239
nef least effectively are the least
protected upon subsequent challenge (23). Finally,
CD4+ cells in peripheral blood mononuclear cells (PBMC) of
vaccinated animals are perfectly capable of supporting the replication
of SIV in culture (11).
Despite these arguments in support of immune-mediated mechanisms for
the protection, no clear evidence has been forwarded regarding what
these immune responses might be. There is considerable interest in the
scientific community in identifying the responses that are protective
in this system because even if the live, attenuated approach is never
forwarded for trials in humans, such research in monkeys may be able to
tell us what types of immune responses are needed for protection. In
addition, it is not known how broadly protective the live, attenuated
vaccine approach can be against pathogenic, heterologous virus
challenge in this rhesus monkey model. We have addressed these issues
by vaccinating rhesus monkeys with the attenuated strain SIVmac239
3
(9, 36) and subsequently challenging them with pathogenic,
uncloned, heterologous strains SHIV89.6p (28) and SIVsmE660
(12, 15).
 |
MATERIALS AND METHODS |
Animals.
Rhesus monkeys were received from the Oregon
Regional Primate Research Center, Beaverton, Oreg., or Laboratory
Animal Breeders and Services, Yemassee, S.C. Upon receipt, the monkeys
underwent a 6-week quarantine. During this period, the animals received three intradermal tuberculin tests, sampling for hematology and serum
chemistry profiles, and rectal swabs for bacterial culture. Feces were
also analyzed for occult blood, ovum, and parasite determinations. In
addition, each animal was screened for antibody status with respect to
SIV, simian type D virus, simian T-cell lymphotropic virus type 1, herpesvirus B, and measles virus. All animals were antibody negative
for SIV, simian type D virus, and simian T-cell lymphotropic virus type
1. All animal care and use procedures conformed to the revised Public
Health Service Policy on Humane Care and Use of Laboratory Animals.
Vaccination and challenge.
The preparation of SIVmac239
3
vaccine stock has been described previously (9, 36). By
intravenous inoculation, four male rhesus monkeys were vaccinated with
SIVmac239
3 containing 0.01 ng of p27 and four were vaccinated with
SIVmac239
3 containing 1.1 ng of p27. These amounts of this stock
represent 23 tissue culture infectious doses and 5 rhesus monkey
infectious doses in the first group and 2.3 × 103
tissue culture infectious doses and 5 × 102 rhesus
monkey infectious doses in the second group. The preparations of the
SIVsmE660 challenge stock (provided by Vanessa Hirsch) and of the
SHIV89.6p challenge stock (provided by Norman Letvin) have been
described (12, 15, 28). Monkeys in the first group were
challenged intravenously with 20 tissue culture infectious doses of
SIVsmE660 28 months after the time of vaccination. Monkeys in the
second group were challenged intravenously with SHIV89.6p containing
0.019 ng of p27 37 months after the time of vaccination.
Flow cytometry.
Whole blood collected in EDTA was analyzed
for expression of CD4 (OKT4a [Ortho] and Anti-Leu 3a [Becton
Dickinson]), CD8 (Anti-Leu 2a [Becton Dickinson]), and CDw29 (4B4
[Coulter Immunology]) by a whole-blood lysis technique previously
described (36). Briefly, antibody (volume dependent upon the
specific antibody) was added to 100 µl of whole blood and incubated
for 10 min in the dark. Lysing solution (Becton Dickinson) was added
and the samples were incubated for 10 min at room temperature. Stained
cells were fixed with 0.5% paraformaldehyde. Samples were analyzed on
a Becton Dickinson FACScan cytometer.
Cell-associated virus loads.
Cell-associated virus loads
were determined by quantitating the numbers of infectious cells in PBMC
as previously described (9). Twelve serial 1:3 dilutions of
PBMC, beginning with 106 cells, were cocultured in
duplicate with 105 CEM×174 cells per well in 24-well
plates. Supernatant samples were collected after 21 days of culture and
stored frozen at 
70°C until analysis for p27 antigen with the
Coulter p27 antigen assay kit.
Antiviral antibodies by ELISA.
Enzyme-linked immunosorbent
assay (ELISA) plates were coated with purified lysed SIVmac251,
SIVmac239, or SIVsmE660 as previously described (6, 9).
Human immunodeficiency virus type 1 (HIV-1) and SIV envelope proteins
were purchased from Immunodiagnostics (Bedford, Mass.) and also used to
coat ELISA plates. Dilutions of sera from the monkeys were assayed for
antibody binding by using an alkaline phosphatase-conjugated goat
anti-human immunoglobulin G (heavy and light chain) in accordance with
our previously described procedures (6, 9).
Plasma RNA loads.
Citrated plasma samples were assayed for
SIV RNA levels as described previously (9, 35).
DNA PCR.
Genetic analysis of mutant versus wild-type SIV
sequences was performed by using a PCR method previously described
(21, 36), with slight modifications. One-half microgram of
chromosomal DNA was used per 100-µl reaction. DNA was added to the
reaction mixture minus Taq polymerase and denatured at
95°C for 10 min and immediately placed on ice. The DNA-reaction mix
was briefly centrifuged and returned to ice. The DNA-reaction mix was
placed in a thermocycler preheated to 72°C for 1 to 2 min;
Taq polymerase (2.5 U) was added and the PCR was carried out
for 35 cycles of 94°C for 1 min, 57°C for 1 min, and 72°C for 1 min 45 s. The analyses for SIVmac239
3 and E660 sequences were
conducted separately. The primer pairs for SIVmac239
3 were as
previously described (36). The sequences of the forward
primers for E660 were PCR1 (5'-ACA ACA AAA CAT GGA TGA TGT GG)
and PCR2 (5'-AGT CCC CTT AAG GGC CAT GAC ATA).
HIV-1 env sequences were amplified similarly using HIV-1
89.6 env-specific primer pairs. The expected size for the
first round of PCR was 962 bp (primers were F1
[GCAACCACCACTCTATTTTGTGC] and R1
[CCTCCTGAGGATTGATTAAAGGC]). The expected size for the
nested PCR was 453 bp (primers were F2 [GGATGAAAGCCTAAAGCCATGTG]
and R2 [AGCAGTTGAGTTGACACCACTGG]). Ten microliters
was electrophoresed in a 1.5% agarose gel containing ethidium bromide.
Virus neutralization assays.
Neutralizing antibodies were
measured in either CEM×174 cells (SIVmac251LP and SIVsmE660) or MT-2
cells (HIV-1 MN and SHIV-89.6p) by a reduction in virus-induced
cell-killing effects as described previously (4, 15). Assay
stocks of SIVmac251LP, SIVsmE660, and HIV-1 MN were prepared in H9
cells and SHIV-89.6p was prepared in human PBMC. Titers are reported as
the reciprocal serum dilutions at which 50% of cells were protected
from virus-induced killing. This cutoff usually corresponds to a >90%
reduction in viral Gag antigen synthesis.
Assay of CTL activity.
SIV-specific cytotoxic T lymphocytes
(CTL) were analyzed following antigen-specific stimulation of PBMC as
described previously (17). Briefly, PBMC were stimulated by
using autologous herpesvirus papio-transformed B lymphoblastoid cell
lines (B-LCL) infected with a recombinant vaccinia virus (vAbt388;
provided by D. Panicali, Therion Biologics, Cambridge, Mass.)
containing the SIVmac251 gag and pol genes and
the SIVmac239 env gene, which were inactivated with UV
psoralen after overnight incubation. After 10 to 12 days of culture,
stimulated PBMC were used as effector cells in a standard 51Cr-release assay. Target cells consisted of autologous
B-LCL infected with recombinant vaccinia viruses expressing SIV
proteins. Recombinant vaccinia viruses used to infect target cells
include vAbt252 (encoding the SIVmac251 p55 Gag and protease proteins;
Therion), rVV-239 (encoding the SIVmac239 envelope [Env])
(30), and the control vaccinia virus NYCBH. Cold targets
consisting of unlabeled autologous B-LCL infected with the control
vaccinia virus NYCBH were used at a cold/hot target ratio of 15:1 to
decrease background lysis. Chromium released was assayed after a 5-h
incubation at 37°C in a 5% CO2 incubator, and the
percent cytotoxicity was calculated as follows: (test release
spontaneous release)/(maximum release
spontaneous release) × 100. SIV-specific release was then calculated by subtracting lysis
of control NYCBH-infected target cells from that of target cells
expressing SIV antigens. Based on examination of 10 naive control
animals not infected with SIV, SIV-specific lysis of greater than 5%
seen at more than one effector/target ratio was interpreted as significant.
 |
RESULTS |
Vaccine phase.
Eight monkeys were vaccinated by intravenous
inoculation with SIVmac239
3, which contains two deletions in
nef and a deletion in vpr (9). The
response of rhesus monkeys to the SIVmac239
3 was similar to what has
been described previously (9). There was an early spike in
virus load around 2 to 3 weeks after inoculation, which subsequently
resolved (Fig. 1A and B). Anti-SIV
antibody responses were readily detected (Fig. 1C and D) and these
persisted for the duration of the vaccine phase. There were no
statistically significant differences in either peak viral PBMC loads
or levels of SIV antibodies at 44 weeks between the groups of monkeys
vaccinated with SIVmac239
3 containing 0.01 versus 1.1 ng of p27
(P > 0.3; Mann-Whitney test).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 1.
Vaccine phase. (A) Cell-associated vaccine virus loads
following vaccination in monkeys that were subsequently challenged with
SHIV89.6p. (B) Cell-associated vaccine virus loads following
vaccination in monkeys that were subsequently challenged with
SIVsmE660. Code for PBMC load: 0, virus was not recovered with
106 or fewer PBMC; 1, virus was recovered with
106 but not fewer PBMC; 2, 333,333 PBMC; 3, 111,111 PBMC;
4, 37,037 PBMC; 5, 12,345 PBMC; 6, 4,115 PBMC; 7, 1,371 PBMC; 8, 457 PBMC. (C) Anti-SIV antibody responses as detected by ELISA following
vaccination in monkeys that were subsequently challenged with
SHIV89.6p. (D) Anti-SIV antibody responses as detected by ELISA
following vaccination in monkeys that were subsequently challenged with
SIVsmE660. A410, absorbance at 40 nm.
|
|
SHIV89.6p challenge.
SHIV89.6 is a recombinant virus which
contains gag and pol sequences from SIVmac239 and
env sequences from HIV-1 isolate 89.6 (29).
SHIV89.6p is a highly aggressive derivative that causes acute declines
in CD4+ cell numbers and death with AIDS over a time course
that is usually less than 12 weeks (28). Thus, challenge in
this case was with an uncloned strain of virus very closely matched in
gag and pol sequences (19) but totally
mismatched in env sequences (Table 1). Challenge was performed by the
intravenous route with SHIV89.6p containing 0.019 ng of
p27gag antigen 37 months after the time of
vaccination. Two naive rhesus monkeys served as controls for challenge.
Both unvaccinated monkeys inoculated with SHIV89.6p developed rapid,
severe declines in CD4 cell numbers (Fig.
2A). CD4
+ cell counts were
reduced to near zero by 5 weeks (Fig.
2A). These
control animals were
euthanized at 8 weeks postinoculation because
of deteriorating
clinical condition. At necropsy, one animal had
Epstein-Barr virus
esophagitis and lymphoid hyperplasia and the
other animal had lymphoid
follicular involution and inflammatory
infiltrates in the
gastrointestinal tract. This acute clinical
course is typical of
pathogenic SHIV89.6p infections that we have
observed in four other
monkeys inoculated with the same stock
of virus. In contrast to these
control animals, all four of the
vaccinated monkeys were completely
protected against any CD4 cell
depletion (Fig.
2A).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
Outcome of challenge with SHIV89.6p. (A)
CD4+ T lymphocytes. (B) Cell-associated virus loads
measured as the number of infectious cells in PBMC. Code is as used
previously (9, 36): 2, 333,333 PBMC; 3, 111,111 PBMC; 4, 37,037 PBMC; 5, 12,345 PBMC; 6, 4,115 PBMC; 7, 1,371 PBMC; 8, 457 PBMC.
(C) Viral RNA levels in plasma. Open symbols used for control animals
EPF and EPJ. Closed symbols are for vaccinated animals. The detection
limit, approximately 300 copy equivalents (Copy Eq) per ml, is
indicated by the dashed line.
|
|
Vaccine virus was not recovered from PBMC of any of the four vaccinated
monkeys at the time of challenge (Fig.
2B) or during
the weeks
preceding challenge, even when 10
6 PBMC were used for
cocultivation. These findings are consistent
with previous
descriptions of the attenuated nature of SIVmac239

3
(
9).
Cell-associated virus loads, measured as the numbers of
infectious
cells in PBMC, peaked in the control animals around
2 weeks after
challenge and, following a slight decline, remained
at moderate or high
levels until the time of death (Fig.
2B).
Virus was recovered from only
one of the four vaccinated animals
at week 2 postinoculation. In
fact, cell-associated viral loads
remained low in all four vaccinated
animals throughout the remaining
course of measurements (Fig.
2B).
Viral loads were also evaluated after challenge by quantitating the
amounts of virion-associated viral RNA in plasma. Viral
RNA was
detected in plasma for three of the four vaccinated monkeys
at week 2 following challenge (Fig.
2C). However, the levels of
viral RNA at week
2 postchallenge were 2 to 4 logs lower in these
three vaccinated
animals than in the two controls (Fig.
2C). The
levels of viral RNA
declined to undetectable levels by week 8,
but they persisted at
fluctuating levels of 1,000 to 10,000 RNA
copy equivalents per ml of
plasma in three of the four vaccinated
animals between 30 and 72 weeks
postchallenge (Fig.
2C). The one
animal (17170) that had no detectable
viral RNA in plasma in the
initial weeks following challenge is the
same animal that maintained
undetectable levels of plasma RNA 30 to 72 weeks after challenge
(Fig.
2C).
DNA was prepared from PBMC obtained at day 15 and weeks 20, 32, and 70 from the SHIV-challenged monkeys. DNA was used for
genetic analysis of
the presence of HIV-1 89.6
env sequences by
PCR. As
expected, day 15 PBMC from both unvaccinated control animals
yielded a
fragment consistent with the presence of SHIV89.6 challenge
virus
(Table
2). The two vaccinated monkeys
with significant
viral loads at 2 weeks after the SHIV challenge (17157 and 17049)
also showed HIV-1
env sequences with the day 15 sample (Table
2). The other two vaccinated monkeys did not have
detectable
HIV-1
env sequences in the day 15 PBMC sample
(Table
2). None
of the four vaccinated monkeys had detectable HIV-1
env sequences
in the week 20 PBMC sample. However, all four
of the previously
vaccinated monkeys had HIV-1
env sequences
detectable in their
PBMC at both 32 and 70 weeks after the SHIV89.6p
challenge (Table
2).
SIVsmE660 challenge.
SIVsmE660 (12) is an
independent isolate of SIVsm, unlinked by any recent history to
SIVmac239 or SIVmac251. Infection of rhesus monkeys with SIVsmE660
results in consistently high viral loads and eventual progression to
AIDS and death (15). Thus, challenge in this case was with
an uncloned strain of SIV within the same grouping of primate
lentiviruses as SIVmac but with natural sequence variation throughout
its genome. Although SIVsmE660 has not been directly sequenced, it is
closely related to SIVsmH4 and SIVsmE543-3 since all were derived from
the same original infected animal (14, 15). SIVsmH4 and
SIVsmE543-3 have been completely sequenced; they are very similar, and
the relatedness of their sequences to SIVmac239 has been previously
calculated (14). We can thus estimate 89 to 92% amino acid
identity in gag-pol and about 82% identity in
env between SIVsmE660 and SIVmac239 (Table 1). Challenge was
performed by the intravenous route with 20 tissue culture infectious
doses of virus 28 months from the time of SIVmac239
3 vaccination.
Two naive rhesus monkeys again served as controls for the challenge.
Vaccine virus was not recovered from three of the four vaccinated
monkeys around the time of challenge, and it was recovered
from the
fourth only when 10
6 PBMC were used (Fig.
3A). Cell-associated virus loads in the
control animals reached high levels in the weeks immediately following
challenge and remained at high levels until the time of their
deaths
with AIDS 50 to 60 weeks following inoculation (Fig.
3A).
SIV was
recovered from three of the four vaccinated animals on
multiple
occasions over the first 10 weeks with 333,333 or fewer
PBMC (Fig.
3A).
Cell-associated loads subsequently declined to
low levels, with no
virus recovered even with 10
6 PBMC in three of the four
vaccinated monkeys between 18 and 65
weeks postchallenge. The fourth
vaccinated monkey (17155), however,
maintained high cell-associated
viral loads for the duration of
the measurements.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 3.
Outcome of challenge with SIVsmE660. (A) Cell-associated
virus loads measured by the number of infectious cells in PBMC. Code
for PMBC load: 2, 333,333 PBMC; 3, 111,111 PBMC; 4, 37,037 PBMC; 5, 12,345 PBMC; 6, 4,115 PBMC; 7, 1,371 PBMC; 8, 457 PBMC. (B) Viral RNA
loads in plasma. (C) CD4+ T lymphocytes. Open symbols are
for control unvaccinated animals VT2 and KJ8. Closed symbols are for
vaccinated animals.
|
|
The results of plasma RNA measurements in this study also agreed well
with the cell-associated viral load measurements. Plasma
RNA in 17155 increased to levels approximating those in the control
animals (Fig.
3B). Two of the three remaining vaccinated animals
(17052 and 17158)
maintained persistently detectable plasma RNA
levels for at least 24 weeks, but the levels were approximately
2 to 3 logs lower than those
seen in the unvaccinated controls
(Fig.
3B).
Both of the unvaccinated controls exhibited declines in CD4 cell
numbers up until the time of their deaths (Fig.
3C). At necropsy,
neither of the two control animals had opportunistic infections.
However, animal KJ8 had diffuse follicular hyperplasia with multiple
lymphoid nodules characteristic of lymphoproliferative disease,
and
animal VT2 had lymphoproliferative disease and SIV arteriopathy.
Only
one of the four vaccinated animals (17052) has remained alive
with
normal CD4 cell numbers (Fig.
3C). Three of the four vaccinated
animals
were euthanized due to clinical deterioration 50 to 60
weeks following
inoculation. All three of these animals had decreased
CD4 cell
percentages (Fig.
3C). At necropsy, animal 17155 had
marked diffuse
follicular hyperplasia and disseminated lymphoid
nodules characteristic
of lymphoproliferative disease. Animal
17158 had an opportunistic
infection with cryptosporidiosis in
the small and large intestine as
well as lymphocytic meningoencephalitis.
The third vaccinated animal
that died, 17159, had glomerulonephritis,
thymic dysinvolution, SIV
arteriopathy, and rare multinucleate
giant cells in the pleura of the
lung. The decreases in CD4 numbers,
clinical condition, and necropsy
findings are compatible with
SIV-induced
disease.
Nested PCR was used to examine viral DNA sequences present in
PBMC at 15 days, 22 weeks, and 49 weeks after challenge. Primers
spanning the
nef gene specific for SIVmac239 and
SIVsmE660 sequences
were used. For the control unvaccinated
animals, fragments corresponding
to full-length challenge virus were
all that were detected (Table
3). Using
PBMC from the four vaccinated monkeys, SIV239-specific
primers detected
either no viral sequences or viral sequences
corresponding to the
length of the vaccine strain in 11 of the
12 samples examined (Table
2). The SIVsmE660-specific primers
detected challenge virus in all four
vaccinated and challenged
animals at one or more of the three time
points examined (Table
3). Vaccinated monkey 17159, which maintained
the lowest viral
loads after challenge (Fig.
3B), was negative for the
detection
of viral sequences with both sets of primers at weeks 22 and
49
(Table
3).
Immune responses.
Serum taken just prior to the time of
challenge was used for measurement of SIV-specific antibody responses.
Ability to neutralize a laboratory-passaged stock of SIVmac251, an
uncloned virus closely related in sequence to SIVmac239 (3),
around the time of challenge was similar in the two groups: a median of
1:459 in the SHIV-challenged group and 1:685 in the
SIVsmE660-challenged group (Table 4). Three of the four animals challenged initially with SIVsmE660 showed
weak neutralizing activity against SIVsmE660 at the time of challenge
(Table 4). The four animals challenged with SHIV89.6p showed no
detectable neutralizing activity against SHIV89.6p or against HIV-1MN
(Table 4). The lack of neutralizing activity against HIV-1 and SHIV is
not surprising given the very low level of amino acid similarity in
env compared to SIVmac239
3 (Table 1).
CTL activity against SIV
gag and
SIV
env antigens was also assessed by using blood
samples taken on the day of challenge. Three of
the four
SHIV-challenged animals showed significant CTL activity
to SIVmac251
antigens on the day of challenge as assessed by percent
specific lysis
(Fig.
4). 17157, the animal without
measurable
anti-Gag CTL activity, is the one animal with a spike in
recoverable
virus at week 2 after challenge (Fig.
2B) and this animal
also
had HIV-1
env sequences detectable in PBMC at week 2 after challenge
(Table
2). CTL activity against SIVmac251 antigens in
the SIVsmE660-challenged
animals assessed on the day of challenge was
as high as or higher
than in the SHIV-challenged animals (Fig.
5). The animal with
the lowest level of
SIV-specific CTL activity prechallenge (17158)
had the highest peak
level of viremia, while the animal with the
highest CTL activity
(17155) had the lowest peak viremia. CTL
activity against SIVsmE660
antigens was not assessed prior to
challenge.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
CTL activity to SIVmac antigens (Gag and Env) on the day
of challenge with SHIV89.6p. Assays were performed following
antigen-specific stimulation of PBMC (17) at the indicated
effector/target ratios.
|
|
 |
DISCUSSION |
Our results demonstrate significant but incomplete protection
afforded by SIVmac239
3 against challenge with SHIV89.6p. All four
vaccinated animals were strongly protected against the rapid CD4
declines and the development of disease. One of the four vaccinated and
challenged monkeys exhibited viral load set points below the limits of
detection and the other three exhibited fluctuating levels between
cutoff (~300 copy equivalents of viral RNA per ml of plasma) and
10,000 copy equivalents of viral RNA per ml of plasma. None of the
vaccinated animals exhibited apparent sterilizing immunity against the
SHIV89.6p challenge. While there have been previous reports of
protection against SHIV by live, attenuated SIV, most have used
nonpathogenic SHIV (1, 5, 33). Our results, and those in a
very recent publication (23), extend the descriptions of
protective effects of live, attenuated SIV to more highly stringent
challenge with an aggressive, pathogenic SHIV. Our findings are
consistent not only with the recent report of Lewis et al.
(23) but also with reports on the ability of nonpathogenic
SHIVs to protect against challenge by pathogenic SIVmac or SIVsm
(24, 27).
Vaccination with SIVmac239
3 was also only partially protective
against SIVsmE660 challenge when performed in a similar format. Protection against SIVsmE660 was actually less impressive than protection against SHIV89.6p in the limited number of animals studied.
No significant protection was observed in one of the vaccinated,
E660-challenged animals and the other three exhibited 2- to 4-log
reductions in viral load at set point compared to control unvaccinated
animals. Nonetheless, only one of these four vaccinated,
E660-challenged monkeys remains alive with normal CD4 counts. The level
of protection afforded by SIVmac239
3 against E660 challenge appears
to be much lower than what has been observed previously for similar
intravenous challenge with SIVmac251 (36). SIVmac251
exhibits a pattern of disease and time course in naive rhesus monkeys
similar to that of SIVsmE660, but SIVmac251 is much more closely
related in sequence to the vaccine strain, SIVmac239
3, than is
SIVsmE660. SIVmac251 is related in passage history to SIVmac239
(8, 20) and is only slightly heterologous (3). Thus, as difficult as it will be to match the live, attenuated approach
for protective efficacy, even the live, attenuated approach will face
significant hurdles in providing protection against the natural
variation present in field strains of virus.
Because gp120/gp41 Env proteins are the only virus-encoded proteins on
the surface of viral particles and since neutralizing antibodies are
directed to them, it has generally been assumed that anti-Env immune
responses would be important for providing protection. Our results
indicate that factors other than anti-Env immune responses can be
principally responsible for the vaccine protection by SIVmac239
3, at
least against SHIV challenge. The sequences of the env genes
of HIV-1 and those of SIVmac/SIVsm are highly divergent. Inspection of
their predicted amino acid sequences reveals identical stretches no
greater than six amino acids in length. We found that antibodies raised
to the SIV vaccine strain did not react appreciably to HIV-1
env (data not shown) and did not neutralize HIV-1
infectivity detectably (Table 4), similar to previous reports (25,
31, 33). In contrast, antibodies raised to the SIV vaccine strain
did react well with SIVsmE660 (data not shown) and they were able to
neutralize SIVsmE660 infectivity at least to some extent (Table 4).
Nonetheless, protection against SIVsmE660 was no better than, and
perhaps even worse than, the protection against SHIV89.6p. In contrast
to the minimal degree of matching of env sequences, the
gag-pol sequences of SHIV89.6 are >99.5% identical with
gag-pol sequences of SIVmac239
3 (Table 1)
(19).
The results described in this report and in another recent
manuscript from our group (18) focus attention on the
potential of cellular responses, particularly CTL, to Gag and Pol for
controlling SIV and SHIV infection. In the recent study
(18), monkeys were vaccinated with SIVmac239
3X and
SIVmac239
4 and were challenged vaginally. The development of
early or stronger SIV-specific CTL responses appeared to be associated
with protection and, in the
4-immunized monkeys, protection was
observed in the absence of detectable neutralizing antibodies and in
one case with only extremely low levels of binding antibodies
detectable only with sensitive tests (18). The importance of
CTL responses is consistent with the extreme difficulty in neutralizing
primary isolates of SIV and HIV (2), with evidence
suggesting a role for CTL in controlling viremia during natural
infection (22, 26), and with the ability of vaccine-induced
anti-Nef CTL to suppress viral replication in some cases following
challenge (10). This of course does not exclude the
possibility that antibodies could provide complete protection on their
own in some circumstances or that antibodies could contribute to the
protective capacity of live, attenuated vaccine approaches.
 |
ACKNOWLEDGMENTS |
We thank María García-Moll of Bio-Molecular
Technology, Inc., for the genetic analyses; Michael Piatak, Jr., Li Li,
and Tom Parks for plasma RNA analyses; and Rhona Glickman for the CTL
assays. We thank Vanessa Hirsch and Norman Letvin for providing the
challenge virus stocks. We also thank Susan Czajak for technical assistance and help with figures and Joanne Newton and Jane FitzPatrick for manuscript preparation.
This work has been supported by PHS grants AI35365 and RR 00168, NIAID
contract N01-AI-65303, and federal funds from the National Cancer
Institute, National Institutes of Health, under contract N01-C0-56000.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: New England
Regional Primate Research Center, Harvard Medical School, One Pine Hill Dr., Box 9102, Southborough, MA 01772-9102. Phone: (508) 624-8042. Fax:
(508) 624-8190. E-mail:
ronald_desrosiers{at}hms.harvard.edu.
 |
REFERENCES |
| 1.
|
Bogers, W. M.,
H. Niphuis,
P. ten Haaft,
J. D. Laman,
W. Koornstra, and J. L. Heeney.
1995.
Protection from HIV-1 envelope-bearing chimeric simian immunodeficiency virus (SHIV) in rhesus macaques infected with attenuated SIV: consequences of challenge.
AIDS
9:F13-F18[Medline].
|
| 2.
|
Burton, D. R.
1997.
A vaccine for HIV type 1: the antibody perspective.
Proc. Natl. Acad. Sci. USA
94:10018-10023[Abstract/Free Full Text].
|
| 3.
|
Choi, W. S.,
C. Colignon,
C. Thiriart,
D. P. W. Burns,
E. J. Stott,
K. A. Kent, and R. C. Desrosiers.
1994.
Effects of natural sequence variation on recognition by monoclonal antibodies that neutralize simian immunodeficiency virus infectivity.
J. Virol.
68:5395-5402[Abstract/Free Full Text].
|
| 4.
|
Connor, R. I.,
D. C. Montefiori,
J. M. Binley,
J. P. Moore,
S. Bonhoeffer,
A. Gettie,
E. A. Fenamore,
K. E. Sheridan,
D. D. Ho,
P. J. Dailey, and P. A. Marx.
1998.
Temporal analyses of virus replication, immune responses, and efficacy in rhesus macaques immunized with a live, attenuated simian immunodeficiency virus vaccine.
J. Virol.
72:7501-7509[Abstract/Free Full Text].
|
| 5.
|
Cranage, M. P.,
A. M. Whatmore,
S. A. Sharpe,
N. Cook,
N. Polyanskaya,
S. Leech,
J. D. Smith,
E. W. Rud,
M. J. Dennis, and G. A. Hall.
1997.
Macaques infected with live attenuated SIVmac are protected against superinfection via the rectal mucosa.
Virology
229:143-154[Medline].
|
| 6.
|
Daniel, M.,
N. Letvin,
P. Sehgal,
D. Schmidt,
D. Silva,
K. R. Solomon,
F. S. Hodi, Jr.,
D. Ringler,
R. D. Hunt,
N. W. King, and R. C. Desrosiers.
1988.
Prevalence of antibodies to 3 retroviruses in a captive colony of macaque monkeys.
Int. J. Cancer
41:601-608[Medline].
|
| 7.
|
Daniel, M. D.,
F. Kirchhoff,
S. C. Czajak,
P. K. Sehgal, and R. C. Desrosiers.
1992.
Protective effects of a live-attenuated SIV vaccine with a deletion in the nef gene.
Science
258:1938-1941[Abstract/Free Full Text].
|
| 8.
|
Daniel, M. D.,
N. L. Letvin,
N. W. King,
M. Kannagi,
P. K. Sehgal,
R. D. Hunt,
P. J. Kanki,
M. Essex, and R. C. Desrosiers.
1985.
Isolation of T-cell tropic HTLV-III-like retrovirus from macaques.
Science
228:1201-1204[Abstract/Free Full Text].
|
| 9.
|
Desrosiers, R. C.,
J. D. Lifson,
J. S. Gibbs,
S. C. Czajak,
A. Y. M. Howe,
L. O. Arthur, and R. P. Johnson.
1998.
Identification of highly attenuated mutants of simian immunodeficiency virus.
J. Virol.
72:1431-1437[Abstract/Free Full Text].
|
| 10.
|
Gallimore, A.,
M. Cranage,
N. Cook,
N. Almond,
J. Bootman,
E. Rud,
P. Silvera,
M. Dennis,
T. Corcoran,
J. Stott,
A. McMichael, and F. Gotch.
1995.
Early suppression of SIV replication by CD8+ nef-specific cytotoxic T cells in vaccinate macaques.
Nat. Med.
1:1167-1173[Medline].
|
| 11.
|
Gauduin, M.-C.,
R. L. Glickman,
R. Means, and R. P. Johnson.
1998.
Inhibition of simian immunodeficiency virus (SIV) replication by CD8+ T lymphocytes from macaques immunized with live attenuated SIV.
J. Virol.
72:6315-6324[Abstract/Free Full Text].
|
| 12.
|
Goldstein, S.,
W. R. Elkins,
W. T. London,
A. Hahn,
R. Goeken,
J. E. Martin, and V. M. Hirsch.
1994.
Immunization with whole inactivated vaccine protects from infection by SIV grown in human but not macaque cells.
J. Med. Primatol.
23:75-82[Medline].
|
| 13.
|
Heilman, C. A., and D. Baltimore.
1998.
HIV vaccines where are we going?
Nat. Med.
4(Suppl.):532-534[Medline].
|
| 14.
|
Hirsch, V.,
D. Adger-Johnson,
B. Campbell,
S. Goldstein,
C. Brown,
W. R. Elkins, and D. C. Montefiori.
1997.
A molecularly cloned, pathogenic, neutralization-resistant simian immunodeficiency virus, SIVsmE543-3.
J. Virol.
71:1608-1620[Abstract].
|
| 15.
|
Hirsch, V. M.,
T. R. Fuerst,
G. Sutter,
M. W. Carroll,
S. Goldstein,
M. J. Piatak,
D. C. Montefiori, and J. D. Lifson.
1996.
Patterns of viral replication correlate with outcome in simian immunodeficiency virus (SIV)-infected macaques: effect of prior immunization with a trivalent SIV vaccine in modified vaccinia virus Ankara.
J. Virol.
70:3741-3752[Abstract].
|
| 16.
|
Johnson, R. P., and R. C. Desrosiers.
1998.
Protective immunity induced by live attenuated simian immunodeficiency virus.
Curr. Biol.
10:436-443.
|
| 17.
|
Johnson, R. P.,
R. L. Glickman,
J. Q. Yang,
A. Kaur,
J. T. Dion,
M. J. Mulligan, and R. C. Desrosiers.
1997.
Induction of vigorous cytotoxic T-lymphocyte responses by live attenuated simian immunodeficiency virus.
J. Virol.
71:7711-7718[Abstract].
|
| 18.
| Johnson, R. P., J. D. Lifson, S. C. Czajak, K. S. Cole, K. H. Manson, R. Glickman, J. Yang,
D. C. Montefiori, R. Montelaro, M. Wyand, and R. C. Desrosiers. Highly attenuated vaccine strains of simian
immunodeficiency virus protect against vaginal challenge: inverse
relation of degree of protection with level of attenuation. Submitted
for publication.
|
| 19.
|
Karlsson, G. B.,
M. Halloran,
J. Li,
I.-W. Park,
R. Gomila,
K. A. Reimann,
M. K. Axthelm,
S. A. Iliff,
N. L. Letvin, and J. Sodroski.
1997.
Characterization of molecularly cloned simian-human immunodeficiency depletion in rhesus monkeys.
J. Virol.
71:4218-4225[Abstract].
|
| 20.
|
Kestler, H.,
T. Kodama,
D. Ringler,
M. Marthas,
N. Pedersen,
A. Lackner,
D. Regier,
P. Sehgal,
M. Daniel,
N. King, and R. Desrosiers.
1990.
Induction of AIDS in rhesus monkeys by molecularly cloned simian immunodeficiency virus.
Science
248:1109-1112[Abstract/Free Full Text].
|
| 21.
|
Kirchhoff, F.,
H. W. Kestler III, and R. C. Desrosiers.
1994.
Upstream U3 sequences in simian immunodeficiency virus are selectively deleted in vivo in the absence of an intact nef gene.
J. Virol.
68:2031-2037[Abstract/Free Full Text].
|
| 22.
|
Koup, R. A.,
J. T. Safrit,
Y. Cao,
C. A. Andrews,
G. McLeod,
W. Borkowsky,
C. Farthing, and D. D. Ho.
1994.
Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome.
J. Virol.
68:4650-4655[Abstract/Free Full Text].
|
| 23.
|
Lewis, M. G.,
J. Yalley-Ogunro,
J. J. Greenhouse,
T. P. Brennan,
J. B. Jiang,
T. C. VanCott,
Y. Lu,
G. A. Eddy, and D. L. Birx.
1999.
Limited protection from a pathogenic chimeric simian-human immunodeficiency virus challenge following immunization with attenuated simian immunodeficiency virus.
J. Virol.
73:1262-1270[Abstract/Free Full Text].
|
| 24.
|
Miller, C. J.,
M. B. McChesney,
X. Lu,
P. J. Dailey,
C. Chutkowski,
D. Lu,
P. Brosio,
B. Roberts, and Y. Lu.
1997.
Rhesus macaques previously infected with simian/human immunodeficiency virus are protected from vaginal challenge with pathogenic SIVmac239.
J. Virol.
71:1911-1921[Abstract].
|
| 25.
|
Montefiori, D. C.,
R. J. Cornell,
J. Y. Zhou,
J. T. Zhou,
V. M. Hirsch, and P. R. Johnson.
1994.
Complement control proteins, CD46, CD55, and CD59, as common surface constituents of human and simian immunodeficiency viruses and possible targets for vaccine protection.
Virology
205:82-92[Medline].
|
| 26.
|
Ogg, G. S.,
X. Jin,
B. Bonhoeffer,
P. R. Dunbar,
M. A. Nowak,
S. Monard,
J. P. Segal,
Y. Cao,
S. L. Rowland-Jones,
V. Cerundolo,
A. Hurley,
M. Markowitz,
D. D. Ho,
D. F. Nixon, and A. J. McMichael.
1998.
Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma load of viral RNA.
Science
279:2103-2106[Abstract/Free Full Text].
|
| 27.
|
Quesada-Rolander, M.,
B. Makitalo,
R. Thorstensson,
Y.-J. Zhang,
E. Castanos-Velez,
G. Biberfeld, and P. Putkonen.
1996.
Protection against mucosal SIVsm challenge in macaques infected with a chimeric SIV that expresses HIV type 1 envelope.
AIDS Res. Hum. Retroviruses
12:993[Medline].
|
| 28.
|
Reimann, K. A.,
J. T. Li,
R. Veazey,
M. Halloran,
I.-W. Park,
G. B. Karlsson,
J. Sodroski, and N. L. Letvin.
1996.
A chimeric simian/human immunodeficiency virus expressing a primary patient human immunodeficiency virus type 1 isolate env causes an AIDS-like disease after in vivo passage in rhesus monkeys.
J. Virol.
70:6922-6928[Abstract/Free Full Text].
|
| 29.
|
Reimann, K. A.,
B. C. D. Waite,
D. E. Lee-Parritz,
W. Lin,
B. Uchanska-Ziegler,
M. J. O'Connell, and N. L. Letvin.
1996.
An env gene derived from a primary human immunodeficiency virus type 1 isolate confers high in vivo replicative capacity to a chimeric simian/human immunodeficiency virus in rhesus monkeys.
J. Virol.
70:3198-3206[Abstract].
|
| 30.
|
Ritter, G. D. J.,
M. J. Mulligan,
S. L. Lydy, and R. W. Compans.
1993.
Cell fusion activity of the simian immunodeficiency virus envelope protein is modulated by the intracytoplasmic domain.
Virology
197:255-264[Medline].
|
| 31.
|
Robert-Guroff, M.,
K. Aldrich,
R. Muldoon,
T. L. Stern,
G. P. Bansal,
T. J. Matthews,
P. D. Markham,
R. C. Gallo, and G. Franchini.
1992.
Cross-neutralization of human immunodeficiency virus type 1 and 2 and simian immunodeficiency virus isolates.
J. Virol.
66:3602-3608[Abstract/Free Full Text].
|
| 32.
|
Rud, E. W.,
L. Oglivie,
B. E. Clarke,
N. Almond,
K. Kent,
L. Chan,
M. Page,
P. Kitchin,
J. Stott,
N. Cook,
S. Sharpe,
T. Ashworth,
M. Dennis,
G. Hall, and M. P. Cranage.
1994.
A naturally attenuated SIVmac32H vaccine or viral interference?, p. 217-223.
In
E. Norrby, F. Brown, R. M. Chanock, and H. S. Ginsberg (ed.), Vaccines '94. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 33.
|
Shibata, R.,
C. Siemon,
S. C. Czajak,
R. C. Desrosiers, and M. A. Martin.
1997.
Live, attenuated simian immunodeficiency virus vaccines elicit potent resistance against a challenge with a human immunodeficiency virus type 1 chimeric virus.
J. Virol.
71:8141-8148[Abstract].
|
| 34.
|
Stebbings, R.,
J. Stott,
N. Almond,
R. Hull,
J. Lines,
P. Silvera,
R. Sangster,
T. Corcoran,
J. Rose,
S. Cobbold,
F. Gotch,
A. McMichael, and B. Walker.
1998.
Mechanisms of protection induced by attenuated simian immunodeficiency virus II. Lymphocyte depletion does not abrogate protection.
AIDS Res. Hum. Retroviruses
14:1187-1198[Medline].
|
| 35.
|
Suryanarayana, K.,
T. A. Wiltrout,
G. M. Vasquez,
V. M. Hirsch, and J. D. Lifson.
1998.
Plasma SIV RNA viral load by determination by real-time quantification of product generation in reverse transcriptase-polymerase chain reaction.
AIDS Res. Hum. Retroviruses
14:183-189[Medline].
|
| 36.
|
Wyand, M. S.,
K. H. Manson,
M. Garcia-Moll,
D. Montefiori, and R. C. Desrosiers.
1996.
Vaccine protection by a triple deletion mutant of simian immunodeficiency virus.
J. Virol.
70:3724-3733[Abstract].
|
Journal of Virology, October 1999, p. 8356-8363, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Korber, B. T., Letvin, N. L., Haynes, B. F.
(2009). T-Cell Vaccine Strategies for Human Immunodeficiency Virus, the Virus with a Thousand Faces. J. Virol.
83: 8300-8314
[Full Text]
-
Wilson, N. A., Keele, B. F., Reed, J. S., Piaskowski, S. M., MacNair, C. E., Bett, A. J., Liang, X., Wang, F., Thoryk, E., Heidecker, G. J., Citron, M. P., Huang, L., Lin, J., Vitelli, S., Ahn, C. D., Kaizu, M., Maness, N. J., Reynolds, M. R., Friedrich, T. C., Loffredo, J. T., Rakasz, E. G., Erickson, S., Allison, D. B., Piatak, M. Jr., Lifson, J. D., Shiver, J. W., Casimiro, D. R., Shaw, G. M., Hahn, B. H., Watkins, D. I.
(2009). Vaccine-Induced Cellular Responses Control Simian Immunodeficiency Virus Replication after Heterologous Challenge. J. Virol.
83: 6508-6521
[Abstract]
[Full Text]
-
Sacha, J. B., Giraldo-Vela, J. P., Buechler, M. B., Martins, M. A., Maness, N. J., Chung, C., Wallace, L. T., Leon, E. J., Friedrich, T. C., Wilson, N. A., Hiraoka, A., Watkins, D. I.
(2009). Gag- and Nef-specific CD4+ T cells recognize and inhibit SIV replication in infected macrophages early after infection. Proc. Natl. Acad. Sci. USA
106: 9791-9796
[Abstract]
[Full Text]
-
Yeh, W. W., Jaru-ampornpan, P., Nevidomskyte, D., Asmal, M., Rao, S. S., Buzby, A. P., Montefiori, D. C., Korber, B. T., Letvin, N. L.
(2009). Partial Protection of Simian Immunodeficiency Virus (SIV)-Infected Rhesus Monkeys against Superinfection with a Heterologous SIV Isolate. J. Virol.
83: 2686-2696
[Abstract]
[Full Text]
-
Reynolds, M. R., Weiler, A. M., Weisgrau, K. L., Piaskowski, S. M., Furlott, J. R., Weinfurter, J. T., Kaizu, M., Soma, T., Leon, E. J., MacNair, C., Leaman, D. P., Zwick, M. B., Gostick, E., Musani, S. K., Price, D. A., Friedrich, T. C., Rakasz, E. G., Wilson, N. A., McDermott, A. B., Boyle, R., Allison, D. B., Burton, D. R., Koff, W. C., Watkins, D. I.
(2008). Macaques vaccinated with live-attenuated SIV control replication of heterologous virus. JEM
205: 2537-2550
[Abstract]
[Full Text]
-
Berry, N., Stebbings, R., Ferguson, D., Ham, C., Alden, J., Brown, S., Jenkins, A., Lines, J., Duffy, L., Davis, L., Elsley, W., Page, M., Hull, R., Stott, J., Almond, N.
(2008). Resistance to superinfection by a vigorously replicating, uncloned stock of simian immunodeficiency virus (SIVmac251) stimulates replication of a live attenuated virus vaccine (SIVmacC8). J. Gen. Virol.
89: 2240-2251
[Abstract]
[Full Text]
-
Walker, B. D., Burton, D. R.
(2008). Toward an AIDS Vaccine. Science
320: 760-764
[Abstract]
[Full Text]
-
Mansfield, K., Lang, S. M., Gauduin, M.-C., Sanford, H. B., Lifson, J. D., Johnson, R. P., Desrosiers, R. C.
(2008). Vaccine Protection by Live, Attenuated Simian Immunodeficiency Virus in the Absence of High-Titer Antibody Responses and High-Frequency Cellular Immune Responses Measurable in the Periphery. J. Virol.
82: 4135-4148
[Abstract]
[Full Text]
-
Giannecchini, S., Pistello, M., Isola, P., Matteucci, D., Mazzetti, P., Freer, G., Bendinelli, M.
(2007). Role of Env in Resistance of Feline Immunodeficiency Virus (FIV)-Infected Cats to Superinfection by a Second FIV Strain as Determined by Using a Chimeric Virus. J. Virol.
81: 10474-10485
[Abstract]
[Full Text]
-
De Boer, R. J.
(2007). Understanding the Failure of CD8+ T-Cell Vaccination against Simian/Human Immunodeficiency Virus. J. Virol.
81: 2838-2848
[Abstract]
[Full Text]
-
Amara, R. R., Patel, K., Niedziela, G., Nigam, P., Sharma, S., Staprans, S. I., Montefiori, D. C., Chenareddi, L., Herndon, J. G., Robinson, H. L., McClure, H. M., Novembre, F. J.
(2005). A Combination DNA and Attenuated Simian Immunodeficiency Virus Vaccine Strategy Provides Enhanced Protection from Simian/Human Immunodeficiency Virus-Induced Disease. J. Virol.
79: 15356-15367
[Abstract]
[Full Text]
-
Stebbings, R., Berry, N., Waldmann, H., Bird, P., Hale, G., Stott, J., North, D., Hull, R., Hall, J., Lines, J., Brown, S., D'Arcy, N., Davis, L., Elsley, W., Edwards, C., Ferguson, D., Allen, J., Almond, N.
(2005). CD8+ Lymphocytes Do Not Mediate Protection against Acute Superinfection 20 Days after Vaccination with a Live Attenuated Simian Immunodeficiency Virus. J. Virol.
79: 12264-12272
[Abstract]
[Full Text]
-
Broche-Pierre, S., Richardson, J., Moraillon, A., Sonigo, P.
(2005). Evaluation of live feline immunodeficiency virus vaccines with modified antigenic properties. J. Gen. Virol.
86: 2495-2506
[Abstract]
[Full Text]
-
Evans, D. T., Bricker, J. E., Sanford, H. B., Lang, S., Carville, A., Richardson, B. A., Piatak, M. Jr., Lifson, J. D., Mansfield, K. G., Desrosiers, R. C.
(2005). Immunization of Macaques with Single-Cycle Simian Immunodeficiency Virus (SIV) Stimulates Diverse Virus-Specific Immune Responses and Reduces Viral Loads after Challenge with SIVmac239. J. Virol.
79: 7707-7720
[Abstract]
[Full Text]
-
Craigo, J. K., Li, F., Steckbeck, J. D., Durkin, S., Howe, L., Cook, S. J., Issel, C., Montelaro, R. C.
(2005). Discerning an Effective Balance between Equine Infectious Anemia Virus Attenuation and Vaccine Efficacy. J. Virol.
79: 2666-2677
[Abstract]
[Full Text]
-
Johnson, P. R., Schnepp, B. C., Connell, M. J., Rohne, D., Robinson, S., Krivulka, G. R., Lord, C. I., Zinn, R., Montefiori, D. C., Letvin, N. L., Clark, K. R.
(2005). Novel Adeno-Associated Virus Vector Vaccine Restricts Replication of Simian Immunodeficiency Virus in Macaques. J. Virol.
79: 955-965
[Abstract]
[Full Text]
-
Choi, J., Walker, J., Boichuk, S., Kirkiles-Smith, N., Torpey, N., Pober, J. S., Alexander, L.
(2005). Human Endothelial Cells Enhance Human Immunodeficiency Virus Type 1 Replication in CD4+ T Cells in a Nef-Dependent Manner In Vitro and In Vivo. J. Virol.
79: 264-276
[Abstract]
[Full Text]
-
Haaft, P. t., Verschoor, E. J., Verstrepen, B., Niphuis, H., Dubbes, R., Koornstra, W., Bogers, W., Rosenwirth, B., Heeney, J. L.
(2004). Readily acquired secondary infections of human and simian immunodeficiency viruses following single intravenous exposure in non-human primates. J. Gen. Virol.
85: 3735-3745
[Abstract]
[Full Text]
-
Quinto, I., Puca, A., Greenhouse, J., Silvera, P., Yalley-Ogunro, J., Lewis, M. G., Palmieri, C., Trimboli, F., Byrum, R., Adelsberger, J., Venzon, D., Chen, X., Scala, G.
(2004). High Attenuation and Immunogenicity of a Simian Immunodeficiency Virus Expressing a Proteolysis-resistant Inhibitor of NF-{kappa}B. J. Biol. Chem.
279: 1720-1728
[Abstract]
[Full Text]
-
Tsui, R., Herring, B. L., Barbour, J. D., Grant, R. M., Bacchetti, P., Kral, A., Edlin, B. R., Delwart, E. L.
(2004). Human Immunodeficiency Virus Type 1 Superinfection Was Not Detected following 215 Years of Injection Drug User Exposure. J. Virol.
78: 94-103
[Abstract]
[Full Text]
-
Pistello, M., Matteucci, D., Bonci, F., Isola, P., Mazzetti, P., Zaccaro, L., Merico, A., Del Mauro, D., Flynn, N., Bendinelli, M.
(2003). AIDS Vaccination Studies Using an Ex Vivo Feline Immunodeficiency Virus Model: Protection from an Intraclade Challenge Administered Systemically or Mucosally by an Attenuated Vaccine. J. Virol.
77: 10740-10750
[Abstract]
[Full Text]
-
Patterson, L. J., Malkevitch, N., Pinczewski, J., Venzon, D., Lou, Y., Peng, B., Munch, C., Leonard, M., Richardson, E., Aldrich, K., Kalyanaraman, V. S., Pavlakis, G. N., Robert-Guroff, M.
(2003). Potent, Persistent Induction and Modulation of Cellular Immune Responses in Rhesus Macaques Primed with Ad5hr-Simian Immunodeficiency Virus (SIV) env/rev, gag, and/or nef Vaccines and Boosted with SIV gp120. J. Virol.
77: 8607-8620
[Abstract]
[Full Text]
-
Casimiro, D. R., Tang, A., Chen, L., Fu, T.-M., Evans, R. K., Davies, M.-E., Freed, D. C., Hurni, W., Aste-Amezaga, J. M., Guan, L., Long, R., Huang, L., Harris, V., Nawrocki, D. K., Mach, H., Troutman, R. D., Isopi, L. A., Murthy, K. K., Rice, K., Wilson, K. A., Volkin, D. B., Emini, E. A., Shiver, J. W.
(2003). Vaccine-Induced Immunity in Baboons by Using DNA and Replication-Incompetent Adenovirus Type 5 Vectors Expressing a Human Immunodeficiency Virus Type 1 gag Gene. J. Virol.
77: 7663-7668
[Abstract]
[Full Text]
-
Alexander, L., Illyinskii, P. O., Lang, S. M., Means, R. E., Lifson, J., Mansfield, K., Desrosiers, R. C.
(2003). Determinants of Increased Replicative Capacity of Serially Passaged Simian Immunodeficiency Virus with nef Deleted in Rhesus Monkeys. J. Virol.
77: 6823-6835
[Abstract]
[Full Text]
-
Chakrabarti, L. A., Metzner, K. J., Ivanovic, T., Cheng, H., Louis-Virelizier, J., Connor, R. I., Cheng-Mayer, C.
(2002). A Truncated Form of Nef Selected during Pathogenic Reversion of Simian Immunodeficiency Virus SIVmac239{Delta}nef Increases Viral Replication. J. Virol.
77: 1245-1256
[Abstract]
[Full Text]
-
Goulder, P. J.R., Walker, B. D.
(2002). HIV-1 Superinfection -- A Word of Caution. NEJM
347: 756-758
[Full Text]
-
Horton, H., Vogel, T. U., Carter, D. K., Vielhuber, K., Fuller, D. H., Shipley, T., Fuller, J. T., Kunstman, K. J., Sutter, G., Montefiori, D. C., Erfle, V., Desrosiers, R. C., Wilson, N., Picker, L. J., Wolinsky, S. M., Wang, C., Allison, D. B., Watkins, D. I.
(2002). Immunization of Rhesus Macaques with a DNA Prime/Modified Vaccinia Virus Ankara Boost Regimen Induces Broad Simian Immunodeficiency Virus (SIV)-Specific T-Cell Responses and Reduces Initial Viral Replication but Does Not Prevent Disease Progression following Challenge with Pathogenic SIVmac239. J. Virol.
76: 7187-7202
[Abstract]
[Full Text]
-
Novitsky, V., Smith, U. R., Gilbert, P., McLane, M. F., Chigwedere, P., Williamson, C., Ndung'u, T., Klein, I., Chang, S. Y., Peter, T., Thior, I., Foley, B. T., Gaolekwe, S., Rybak, N., Gaseitsiwe, S., Vannberg, F., Marlink, R., Lee, T. H., Essex, M.
(2002). Human Immunodeficiency Virus Type 1 Subtype C Molecular Phylogeny: Consensus Sequence for an AIDS Vaccine Design?. J. Virol.
76: 5435-5451
[Abstract]
[Full Text]
-
Casimiro, D. R., Tang, A., Perry, H. C., Long, R. S., Chen, M., Heidecker, G. J., Davies, M.-E., Freed, D. C., Persaud, N. V., Dubey, S., Smith, J. G., Havlir, D., Richman, D., Chastain, M. A., Simon, A. J., Fu, T.-M., Emini, E. A., Shiver, J. W.
(2002). Vaccine-Induced Immune Responses in Rodents and Nonhuman Primates by Use of a Humanized Human Immunodeficiency Virus Type 1 pol Gene. J. Virol.
76: 185-194
[Abstract]
[Full Text]
-
Lifson, J. D., Rossio, J. L., Piatak, M. Jr., Parks, T., Li, L., Kiser, R., Coalter, V., Fisher, B., Flynn, B. M., Czajak, S., Hirsch, V. M., Reimann, K. A., Schmitz, J. E., Ghrayeb, J., Bischofberger, N., Nowak, M. A., Desrosiers, R. C., Wodarz, D.
(2001). Role of CD8+ Lymphocytes in Control of Simian Immunodeficiency Virus Infection and Resistance to Rechallenge after Transient Early Antiretroviral Treatment. J. Virol.
75: 10187-10199
[Abstract]
[Full Text]
-
Giannecchini, S., Matteucci, D., Ferrari, A., Pistello, M., Bendinelli, M.
(2001). Feline Immunodeficiency Virus-Infected Cat Sera Associated with the Development of Broad Neutralization Resistance In Vivo Drive Similar Reversions In Vitro. J. Virol.
75: 8868-8873
[Abstract]
[Full Text]
-
Hofmann-Lehmann, R., Vlasak, J., Rasmussen, R. A., Smith, B. A., Baba, T. W., Liska, V., Ferrantelli, F., Montefiori, D. C., McClure, H. M., Anderson, D. C., Bernacky, B. J., Rizvi, T. A., Schmidt, R., Hill, L. R., Keeling, M. E., Katinger, H., Stiegler, G., Cavacini, L. A., Posner, M. R., Chou, T.-C., Andersen, J., Ruprecht, R. M.
(2001). Postnatal Passive Immunization of Neonatal Macaques with a Triple Combination of Human Monoclonal Antibodies against Oral Simian-Human Immunodeficiency Virus Challenge. J. Virol.
75: 7470-7480
[Abstract]
[Full Text]
-
Barouch, D. H., Santra, S., Kuroda, M. J., Schmitz, J. E., Plishka, R., Buckler-White, A., Gaitan, A. E., Zin, R., Nam, J.-H., Wyatt, L. S., Lifton, M. A., Nickerson, C. E., Moss, B., Montefiori, D. C., Hirsch, V. M., Letvin, N. L.
(2001). Reduction of Simian-Human Immunodeficiency Virus 89.6P Viremia in Rhesus Monkeys by Recombinant Modified Vaccinia Virus Ankara Vaccination. J. Virol.
75: 5151-5158
[Abstract]
[Full Text]
-
Guan, Y., Whitney, J. B., Detorio, M., Wainberg, M. A.
(2001). Construction and In Vitro Properties of a Series of Attenuated Simian Immunodeficiency Viruses with All Accessory Genes Deleted. J. Virol.
75: 4056-4067
[Abstract]
[Full Text]
-
Guan, Y., Whitney, J. B., Liang, C., Wainberg, M. A.
(2001). Novel, Live Attenuated Simian Immunodeficiency Virus Constructs Containing Major Deletions in Leader RNA Sequences. J. Virol.
75: 2776-2785
[Abstract]
[Full Text]
-
Khatissian, E., Monceaux, V., Cumont, M.-C., Kieny, M.-P., Aubertin, A.-M., Hurtrel, B.
(2001). Persistence of Pathogenic Challenge Virus in Macaques Protected by Simian Immunodeficiency Virus SIVmac{Delta}nef. J. Virol.
75: 1507-1515
[Abstract]
[Full Text]
-
Fultz, P. N., Vance, P. J., Endres, M. J., Tao, B., Dvorin, J. D., Davis, I. C., Lifson, J. D., Montefiori, D. C., Marsh, M., Malim, M. H., Hoxie, J. A.
(2001). In Vivo Attenuation of Simian Immunodeficiency Virus by Disruption of a Tyrosine-Dependent Sorting Signal in the Envelope Glycoprotein Cytoplasmic Tail. J. Virol.
75: 278-291
[Abstract]
[Full Text]
-
Silverstein, P. S., Mackay, G. A., Mukherjee, S., Li, Z., Piatak, M. Jr., Lifson, J. D., Narayan, O., Kumar, A.
(2000). Pathogenic Simian/Human Immunodeficiency Virus SHIVKU Inoculated into Immunized Macaques Caused Infection, but Virus Burdens Progressively Declined with Time. J. Virol.
74: 10489-10497
[Abstract]
[Full Text]
-
Barouch, D. H., Santra, S., Schmitz, J. E., Kuroda, M. J., Fu, T.-M., Wagner, W., Bilska, M., Craiu, A., Zheng, X. X., Krivulka, G. R., Beaudry, K., Lifton, M. A., Nickerson, C. E., Trigona, W. L., Punt, K., Freed, D. C., Guan, L., Dubey, S., Casimiro, D., Simon, A., Davies, M.-E., Chastain, M., Strom, T. B., Gelman, R. S., Montefiori, D. C., Lewis, M. G., Emini, E. A., Shiver, J. W., Letvin, N. L.
(2000). Control of Viremia and Prevention of Clinical AIDS in Rhesus Monkeys by Cytokine-Augmented DNA Vaccination. Science
290: 486-492
[Abstract]
[Full Text]
-
Hosie, M. J., Dunsford, T., Klein, D., Willett, B. J., Cannon, C., Osborne, R., MacDonald, J., Spibey, N., Mackay, N., Jarrett, O., Neil, J. C.
(2000). Vaccination with Inactivated Virus but Not Viral DNA Reduces Virus Load following Challenge with a Heterologous and Virulent Isolate of Feline Immunodeficiency Virus. J. Virol.
74: 9403-9411
[Abstract]
[Full Text]
-
Dejucq, N.
(2000). HIV-1 replication in CD4+ T cell lines: the effects of adaptation on co-receptor use, tropism, and accessory gene function. J. Leukoc. Biol.
68: 331-337
[Abstract]
[Full Text]
-
Murphy, C. G., Lucas, W. T., Means, R. E., Czajak, S., Hale, C. L., Lifson, J. D., Kaur, A., Johnson, R. P., Knipe, D. M., Desrosiers, R. C.
(2000). Vaccine Protection against Simian Immunodeficiency Virus by Recombinant Strains of Herpes Simplex Virus. J. Virol.
74: 7745-7754
[Abstract]
[Full Text]
-
Metzner, K. J., Jin, X., Lee, F. V., Gettie, A., Bauer, D. E., Di Mascio, M., Perelson, A. S., Marx, P. A., Ho, D. D., Kostrikis, L. G., Connor, R. I.
(2000). Effects of in Vivo Cd8+ T Cell Depletion on Virus Replication in Rhesus Macaques Immunized with a Live, Attenuated Simian Immunodeficiency Virus Vaccine. JEM
191: 1921-1932
[Abstract]
[Full Text]
-
Gundlach, B. R., Lewis, M. G., Sopper, S., Schnell, T., Sodroski, J., Stahl-Hennig, C., Überla, K.
(2000). Evidence for Recombination of Live, Attenuated Immunodeficiency Virus Vaccine with Challenge Virus to a More Virulent Strain. J. Virol.
74: 3537-3542
[Abstract]
[Full Text]
-
Marzio, G., Verhoef, K., Vink, M., Berkhout, B.
(2001). In vitro evolution of a highly replicating, doxycycline-dependent HIV for applications in vaccine studies. Proc. Natl. Acad. Sci. USA
98: 6342-6347
[Abstract]
[Full Text]