Previous Article | Next Article 
Journal of Virology, October 1999, p. 8330-8337, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Translational Effects of Mutations and
Polymorphisms in a Repressive Upstream Open Reading Frame of the Human
Cytomegalovirus UL4 Gene
John P.
Alderete,
Sohail
Jarrahian, and
Adam P.
Geballe*
Divisions of Human Biology and Clinical Research, Fred
Hutchinson Cancer Research Center, Seattle, Washington 98109, and
Departments of Microbiology and Medicine, University of Washington,
Seattle, Washington 98115
Received 31 March 1999/Accepted 19 July 1999
 |
ABSTRACT |
The human cytomegalovirus (HCMV) gpUL4 mRNA contains a 22-codon
upstream open reading frame (uORF2), the peptide product of which
represses downstream translation by blocking translation termination at
its own stop codon and by causing ribosomes to stall on the mRNA. A
distinctive feature of this unusual mechanism is its strict dependence
on the uORF2 peptide sequence. To delineate sequence elements that
function in the inhibitory mechanism, deletions and missense mutations
affecting the previously uncharacterized amino-terminal region of uORF2
were analyzed in transient-transfection and infection assays. These
experiments identified multiple codons in this region that are
necessary for inhibition of downstream translation by uORF2 and, in
conjunction with previous results, demonstrated that amino acids
dispersed throughout the uORF2 peptide participate in the repressive
mechanism. In contrast to the highly conserved carboxy terminus, the
amino-terminal portion of the uORF2 peptide is polymorphic. A survey of
uORF2 sequences in HCMV clinical isolates revealed that although most
have uORF2 sequences that are predicted to retain the uORF2 inhibitory
activity, ~15% contain polymorphisms at codons that are essential
for full inhibition by uORF2. Consistent with predictions based on
analyses of engineered mutations, two viral isolates with uORF2
sequences that do not inhibit downstream translation in transfection
assays expressed much more gpUL4 protein but similar levels of UL4 mRNA
compared to the levels produced by the prototypic laboratory strain
HCMV (Towne) and another clinical isolate with an inhibitory variant uORF2. These results demonstrate that uORF2 is polymorphic in sequence
and repressive activity and suggest that the uORF2 regulatory mechanism, although prevalent among natural HCMV isolates, is not
absolutely essential for viral replication.
 |
INTRODUCTION |
Previous investigations into the
basis for the scarcity of the human cytomegalovirus (HCMV) gpUL4
protein (gp48) at early times in infection revealed that its expression
is controlled by an unusual translational mechanism (2-4,
6). The second of three short upstream open reading frames
(uORFs), uORF2, within the 5' leader of the gpUL4 mRNA encodes a
22-codon peptide that mediates inhibition of downstream translation.
Ribosomes that translate uORF2 fail to cleave the peptidyl-tRNA bond
linking the nascent uORF2 peptide to tRNAPro, the tRNA
responsible for decoding the last uORF2 codon (3). These
results suggest a model in which the nascent uORF2 peptide inhibits
downstream translation by blocking translation termination at its own
stop codon, thereby causing ribosomes to stall on the mRNA and to block
access to the gpUL4 initiation codon by other scanning ribosomes.
Although the precise mechanism by which the uORF2 peptide inhibits
translational termination is not yet known, the uORF2 peptide sequence
is critical for this activity (2, 3, 6). Mutations that
alter carboxy-terminal amino acids release the inhibitory effect of
uORF2 on downstream translation and also eliminate both the ribosomal
stalling and the blockage of peptidyl-tRNA hydrolysis that occur after
translation of wild-type uORF2. In contrast, synonymous mutations of
these same codons retain the inhibitory properties of wild-type uORF2.
Thus, like a few uORFs in other eukaryotic genes (9, 12, 13, 15,
22), uORF2 acts in a peptide sequence-dependent manner.
Comparisons among known sequence-dependent uORFs have not yet revealed
any consensus sequences or shared motifs that might help to identify
molecular interactions between these uORFs and the cellular
translational machinery that are responsible for the inhibitory effects.
In order to gain additional insight into the uORF2-mediated inhibitory
mechanism, we extended our investigations by determining the role of
codons in the more amino-terminal portion of uORF2. Mutational analyses
identified several codons within this region that are essential for the
uORF2 inhibitory function. A survey of uORF2 sequences among clinical
HCMV isolates revealed that some of these essential codons are
polymorphic. Consistent with analyses of engineered mutations, certain
polymorphisms eliminate the inhibitory effect of uORF2 on downstream
translation, demonstrating that uORF2 is structurally and functionally polymorphic.
 |
MATERIALS AND METHODS |
Cells, virus, and viral DNA.
HCMV (Towne) was grown on
primary human fibroblasts (HF) as described previously (6).
Frozen suspensions of cells infected with HCMV strains isolated from
bone marrow transplant recipients were obtained from the Clinical
Virology Laboratory and from B. Torok-Storb of the Fred Hutchinson
Cancer Research Center. Clinical isolates C1, C4, and C6 were plaque
purified prior to use in infection experiments. To purify viral DNA for
sequencing, a sample of ~10 to ~20 µl obtained by scraping a
frozen virus-infected cell suspension with a wooden applicator stick
was resuspended in either proteinase K buffer (10 mM Tris [pH 7.8], 5 mM EDTA, 0.5% sodium dodecyl sulfate [SDS]) or lysis buffer (50 mM
KCl, 10 mM Tris-HCl [pH 8.3], 0.01% gelatin, 0.45% NP-40, 0.45%
Tween 20). After proteinase K was added to a final concentration of 100 µg/ml, the reaction mixtures were incubated at 37°C for 1 h
and then extracted twice with phenol-chloroform (pH 8.0). Viral DNA was
precipitated with ethanol and resuspended in TE buffer (10 mM Tris [pH
8.0], 1 mM EDTA).
Plasmids and sequence analyses.
Plasmids pEQ239, pEQ325,
pEQ422, pEQ429, and pEQ430 have been described previously (4, 6,
17). A series of
-galactosidase (
-Gal) expression plasmids
(pEQ641 through pEQ648, pEQ700 through pEQ708, and pEQ724 through
pEQ729) containing the gpUL4 (gp48) transcript leader with various
mutations or deletions in the uORF2 sequence were created by PCR-based
mutagenesis with plasmid pEQ422 as a template and with the 5' primers
shown in Table 1 and the 3' primer 7 (5'CGAGGTGCTGTTTCTGGT). The amplified products were digested
with HindIII and AflII and inserted into
pEQ422 that had been digested with HindIII and
AflII, thus replacing the uORF2 sequences as depicted in
Table 1 and Fig. 1 through 5. The gpUL4 leader sequences in these
plasmids were verified by automated sequence analysis with primer 7 and
an Amplitaq FS kit (Perkin-Elmer).
DNAs from cells infected with clinical HCMV isolates were amplified by
PCR with primers 19 (5'GATCAAGCTTTGACTATAAGGATCGCGACCG),
41 (5'CCCCGTAAGATGATCCTCG), or 165 (5'GATCAAGCTTAATCAGATGCCGGCCTTGT)
and either 28 (5'GATCGGTACCATCATAACGATACTCTTTCAGCCTTAC) or 55
(5'CCGCCGACGGTCCCTGAG). Control PCR mixtures to which no DNA
was
added were included after every third experimental sample to ensure
that no cross-contamination occurred. PCR products that were flanked
by
blank control reaction mixtures were gel purified and sequenced
with
primers 19 (5'GATCAAGCTTTGACTATAAGGATCGCGACCG), 28, 41, 88
(5'AGGCGTGTACGGTGGGAGGTCTAT), and/or 190 (5'CCTCGTATCACATGAGGT).
The analysis was repeated, if
necessary, to resolve ambiguous
nucleotides.
The gpUL4 transcript leaders from clinical isolates C1 and C6 were PCR
amplified with primers 18 and 28, and the resulting
amplified products
were inserted as
HindIII/
Asp718 fragments
into
pEQ176 (
17). The gpUL4 leader from clinical isolate C4
was PCR
amplified with primers 19 and 28, and the resulting amplified
product was digested with
NaeI and
Asp718 and
cloned into pEQ176
that had been digested with
BglII,
blunted with DNA polymerase
(Klenow fragment), and then digested with
Asp718. The resulting
plasmids, pEQ448, pEQ449, and pEQ450
(corresponding to clinical
isolates C1, C4, and C6, respectively), were
sequenced with primer
7.
The gpUL4 coding region was amplified from HCMV (Towne) DNA with
primers 21 (5'TTAGGACACGGTCAGATTG) and 22 (5'CCGTGGATCCATGATGCTTAGAGCGTGGAG).
The product was cloned
as a
BamHI blunt fragment into the
BamHI
and
SmaI sites of pBS+ to generate
pEQ371.
Transfection and RNA analyses.
-Gal expression plasmids
were transfected into primary HF with DEAE-dextran as described
previously (1). Twenty-four hours after transfection, cells
were infected with HCMV at a multiplicity of infection of 3, and at
48 h postinfection,
-Gal expression was measured by adding the
fluorogenic substrate
4-methylumbelliferyl-
-D-galactoside to the cell culture
medium. The mean (plus standard deviation) fluorescence values from
triplicate 60-mm-diameter dishes minus the mean value for cells
transfected with control pEQ430 are plotted. Whole-cell RNA was
extracted by guanidinium isothiocyanate solubilization of cells,
pooling of lysates from triplicate dishes, and pelleting of RNA through
CsCl (8).
-Gal mRNA was detected by Northern blot
analysis as described previously (7).
Whole-cell RNA from HF infected with HCMV was isolated as described
previously (
18). gpUL4 mRNA was detected by Northern
blot
analysis with a probe derived from
pEQ371.
Immunoblot assays.
HF in 100-mm-diameter dishes were
infected in duplicate with HCMV (Towne) or with clinical isolate C1,
C4, or C6 at a multiplicity of infection of 0.1. RNA was isolated from
one of each set of duplicate plates as described above at 18 days
postinfection, a time when all cells displayed viral cytopathic
effects. For protein analysis, cells on the second plate were washed
twice with phosphate-buffered saline and lysed in 500 µl of 2% SDS
at 60°C and the DNA was sheared by multiple passages through a
27-gauge needle. Approximately 40 µg of protein per sample was
separated by SDS-polyacrylamide gel electrophoresis and transferred to
polyvinylidene difluoride membranes (Micron Separations, Inc.), which
were immunoblotted with a Western-Light Plus protein detection kit
(Tropix). For detection of gpUL4 protein, rabbit polyclonal antibody
(gp48MAPC), raised to the multiple antigenic peptide (19)
(TTENSRNYYFRREDAN), was used at a 1:10,000 dilution. For
ppUL44, a mouse monoclonal antibody (Virusys Corporation, Berwick,
Maine) was used at a 1:20,000 dilution.
 |
RESULTS |
Effect of amino-terminal deletions of uORF2 on downstream
translation.
To test whether the amino-terminal portion of uORF2
contributes to inhibition of downstream translation, we constructed
plasmids that express transcripts containing mutations affecting codons 3 through 12 of uORF2 within the gpUL4 mRNA leader upstream of the
-Gal ORF. The translational impact of these uORF2 mutations was
assessed by measuring
-Gal activity and
-Gal RNA levels after
transfection of the expression plasmids into HF and subsequent infection with HCMV.
We first analyzed deletions that eliminate codon 3 (pEQ643), codons 3 through 7 (pEQ644), and codons 3 through 12 (pEQ645)
of uORF2 (Fig.
1). In transfection analyses, the plasmid
with
the codon 3 deletion expressed low levels of

-Gal, similar to
what occurred with pEQ422, a plasmid with an optimal context AUG
codon
initiating an otherwise wild-type uORF2. The plasmid with
the deletion
of codons 3 through 7 expressed an intermediate level
of

-Gal.
Deletion of codons 3 through 12 completely alleviated
uORF2
peptide-mediated translational inhibition, a result similar
to that
produced by the missense mutation of codon 22 (P22A) present
in pEQ429,
which was previously shown to eliminate uORF2 inhibitory
activity
(
4).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Effects of deletion of codons 3 through 12 on uORF2
inhibitory activity. (A) Plasmids containing deletions of codon 3 ( 3, pEQ643), codons 3 through 7 ( 3-7, pEQ644), and codons 3 through
12 ( 3-12, pEQ645) of uORF2 were transfected into triplicate dishes
of HF. Control plasmids were pEQ422, which contains an optimal-context
AUG codon (o/c) but otherwise wild-type uORF2 (wt), and pEQ429, which
contains an optimal-context AUG codon and a missense mutation of
proline to alanine at codon 22 (P22A). Subsequent to HCMV infection,
-Gal activity (B) and lacZ mRNA levels (C) were measured
as described in Materials and Methods.
|
|
Northern blot analysis of whole-cell RNAs isolated from the transfected
and infected cells revealed similar

-Gal RNA levels
among all
samples (Fig.
1C), verifying that differences in

-Gal
activity were
not due to differences in transcript accumulation.
Also, levels
of transfection efficiency were similar among samples
as judged by the
approximately equal levels of mRNA expression
from a cotransfected
plasmid expressing a catalytically inactive
lacZ control
(pEQ430) (data not shown). These data confirm that
the observed
variation in

-Gal activity resulted from translational
effects of
the uORF2 deletions and not from variation in levels
of transfection or
RNA
accumulation.
Effects of amino-terminal amino acid substitutions on
uORF2-mediated inhibition.
The deletion mutations described above
alter both the length of the uORF2 peptide and its amino acid content.
To distinguish which of these changes was responsible for the reduction
of uORF2 inhibitory activity, we replaced codons 3 through 11 in toto
with either conservative or nonconservative substitutions. If the
length but not a particular sequence of the amino-terminal region is required for the inhibitory mechanism, then both the conservative and
nonconservative mutants should retain the inhibitory activity. On the
other hand, if amino acid coding sequences within the amino terminus of
uORF2 are required for translational inhibition, then conservative
mutations may have little or no effect while nonconservative substitutions would be more likely to disrupt uORF2 peptide-mediated inhibition.
In transfection assays (Fig.
2), the
mutant containing nonconservative amino acid substitutions (pEQ642)
expressed high levels
of

-Gal while the mutant containing
conservative amino acid substitutions
(pEQ641) expressed much less

-Gal. Levels of RNA expression were
similar among all constructs
(Fig.
2C). These data suggest that
amino acids within the
amino-terminal portion of the uORF2 peptide
are required for its full
inhibitory effect.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
Missense mutations of codons 3 through 11 reduce uORF2
inhibitory activity. (A) Plasmids having conservative (pEQ641) and
nonconservative (pEQ642) substitutions in uORF2 and the same control
plasmids as those used for the Fig. 1 experiments were transfected into
HF. After HCMV infection, -Gal activity (B) and lacZ mRNA
levels (C) were measured as described in Materials and Methods. o/c,
optimal-context AUG codon; wt, wild-type uORF2.
|
|
To further delineate which amino acids within the amino-terminal
portion of the uORF2 peptide are required for inhibition,
we created
uORF2 expression constructs having mutations in codons
3 through 5, 6 through 8, or 9 through 11 (pEQ646, pEQ647, or
pEQ648, respectively)
(Fig.
3A). These mutations incorporated
subsets of amino acid changes present in the nonconservative mutant,
pEQ642 (Fig.
2A). Analysis of expression from cells transfected
with
these plasmids demonstrated that pEQ647 and, to a lesser
extent, pEQ646
expressed high levels of

-Gal (Fig.
3B). In contrast,
pEQ648 was as
inhibitory as the wild-type control (pEQ422). These
results, in
combination with the results of the analysis of RNAs
expressed from
these plasmids, implicate at least one codon in
positions 3 through 5 and at least one additional codon in positions
6 through 8 as being
necessary for full inhibition by uORF2.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 3.
At least two codons, one in positions 3 through 5 and
one in positions 6 through 8, are required for full uORF2 inhibitory
activity. (A) Plasmids containing triple amino acid uORF2 substitutions
derived from subsets of the nonconservative missense mutations in
pEQ642 (Fig. 2) were transfected into HF. Following infection with
HCMV, -Gal activity (B) and lacZ mRNA levels (C) were
measured as described in Materials and Methods. o/c, optimal-context
AUG codon; wt, wild-type uORF2.
|
|
Multiple codons in the amino-terminal region of uORF2 are each
necessary for inhibition of downstream translation.
The preceding
results suggest that specific amino acids within the amino-terminal
portion of the uORF2 peptide are necessary for translational
inhibition. To precisely define the critical codons, we analyzed
expression downstream from uORF2 mutants with single missense mutations
in codons 3 through 12 (Fig. 4A).
Complete release of the inhibitory signal occurred when either codon 7 or 8 was mutated (pEQ704 or pEQ705, respectively) (Fig. 4B). Mutation at codon 3, 4, 5, or 6 (pEQ700, pEQ701, pEQ702, or pEQ703,
respectively) released the inhibitory signal partially. The increase in
-Gal expression from the codon 3 mutant was somewhat surprising
since deletion of codon 3 (pEQ700) maintained the inhibitory signal (Fig. 1). Mutation of codons 9, 10, and 11 (pEQ706, pEQ707, and pEQ708,
respectively) individually maintained most of the repressive affect of
uORF2 on downstream translation (Fig. 4D), consistent with the
preservation of the inhibitory effect by the triple mutant with
mutations in codons 9 through 11 (pEQ648) (Fig. 3B).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
Individual codons within the amino-terminal portion of
uORF2 are important for inhibitory activity. Plasmids containing
individual missense mutations (A) were transfected into HF in two
separate experiments (B and C; D and E). Following infection with HCMV,
-Gal activity (B and D) and lacZ mRNA levels (C and E)
were measured as described in Materials and Methods. o/c,
optimal-context AUG codon; wt, wild-type uORF2.
|
|
In a previous study (
6), we identified a double mutation
(K10Q and S12P) that completely eliminated uORF2-mediated translational
inhibition. Because this dual mutation lies within the region
investigated in this report, we examined the individual contribution
of
each of these mutations. Like the K10V mutation (pEQ707) (Fig.
4) and a
previously reported K10E mutation (
6), the isolated
K10Q
mutation (pEQ727) expressed low levels of

-Gal, similar
to the level
produced by the wild-type sequence (Fig.
4D). In
contrast, the missense
mutation of codon 12 (S12P; pEQ726) by
itself eliminated most of the
inhibitory effect of uORF2. Accumulated

-Gal mRNA levels were
similar among all samples (Fig.
4C and
E). These results indicate that
S12P is the key mutation responsible
for the loss of uORF2 inhibitory
activity in the K10Q-S12P double
mutant.
These transfection experiments establish that individual codons in the
amino-terminal region of uORF2 are essential for full
uORF2-mediated
repression of downstream translation. Codons 7,
8, and 12 are most
critical, codons 3 through 6 have an intermediate
role, and codons 9 through 11 contribute little if any to uORF2
inhibitory activity.
Although these conclusions are based on analyses
of only one mutation
at most positions, they provide a foundation
for predicting the effects
of naturally occurring polymorphisms
present in other HCMV
isolates.
Survey of uORF2 in HCMV clinical isolates.
We previously
showed that clinical isolates of HCMV contain sequence polymorphisms in
uORF2 (6). While key carboxy-terminal codons, such as
proline 21 and proline 22, were consistently highly conserved, some
polymorphisms located closer to the amino terminus affected some codons
that, based on the results of the above-described analyses, seemed to
be necessary for uORF2 function.
To examine further the frequency and diversity of uORF2 polymorphisms
among clinical isolates, we determined the nucleotide
sequences of the
gpUL4 transcript leaders and deduced the uORF2
amino acid sequences
from 19 independent clinical isolates of
HCMV obtained from bone marrow
transplant recipients (Table
2).
uORF2
was present and was 22 codons long in each isolate. Polymorphisms
were
present at distinct positions within the uORF2 peptide sequence.
Nine
of the isolates possessed nucleotide changes that did not
alter the
amino acid sequence of uORF2 from that of HCMV (Towne).
Two additional
isolates had uORF2 amino acid sequences identical
to that of another
prototypic laboratory strain, AD169. Thus,
~60% of the clinical
isolates have uORF2 coding sequences identical
to those found in the
laboratory strains that have been shown
to inhibit downstream
translation (
17).
Five of the isolates share a triple codon polymorphism, K9E, K10E, and
T16I. Based on results of transfection experiments
(reference
6 and Fig.
4), none of these changes is expected
to
alter uORF2-mediated inhibition. However, isolate S27 has an
additional
substitution at codon 7, a position that is critical
for inhibition.
Isolates S21 and S24 have substitutions at codons
3 and 6, respectively, which, based on transfection results (Fig.
4), may
partially release uORF2 inhibitory activity. Isolate S33
has a change
at codon 13, a position that has not been analyzed.
Thus, at least
~15% of isolates have polymorphisms predicted to
eliminate, at least
partially, uORF2 inhibitory
activity.
Inhibitory activity of naturally occurring uORF2 variants.
To
test whether polymorphisms found in clinical isolates affect uORF2
function, we cloned the gpUL4 transcript leaders from three previously
sequenced clinical isolates, C1, C4, and C6 (6) into
lacZ expression plasmids (pEQ448, pEQ449, and pEQ450,
respectively) (Fig. 5A) and analyzed
-Gal expression in transfection and infection assays. The uORF2 from
these clinical isolates had various effects on downstream translation,
ranging from full inhibition with the C4 sequence to partial or full
release of inhibition with the C1 and C6 uORF2 sequences (Fig. 5B).
Since these plasmids contain the wild-type, rather than the
optimal-context, AUG codon at the start of uORF2, we used pEQ239, which
contains the gpUL4 leader from HCMV (Towne) and has the wild-type AUG
context, and pEQ325, which contains a mutation of the uORF2 AUG to AAG
(AUG
), as controls in this experiment.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of polymorphisms found in clinical isolates on
uORF2 inhibitory activity. (A) Deduced amino acid sequence of clinical
isolates C6, C4, and C1. Dashes indicate amino acid identity with HCMV
(Towne). Plasmids containing the gpUL4 leader from these clinical
isolates (B and C) or containing individual mutations found in isolate
C6 (D and E) were transfected into HF. After infection with HCMV,
-Gal activity (B and D) and lacZ mRNA levels (C and E)
were measured as described in Materials and Methods. o/c,
optimal-context AUG codon; wt, wild-type uORF2.
|
|
The amino acid polymorphisms found in clinical isolate C6 were analyzed
for their individual effects on uORF2 function. The
four substitutions
were each cloned into an expression construct
with a uORF2 containing
an optimal-context AUG codon. Consistent
with the predictions based on
previous data (Fig.
4 and reference
6), missense
mutations at positions 9, 10, and 16 (pEQ729,
pEQ728, and pEQ724,
respectively) preserved the inhibitory effect
of uORF2. In contrast,
the mutation at codon 7 (pEQ725) resulted
in high-level

-Gal
expression, indicating that S7L was the key
alteration of the quartet
found in the C6 uORF2 sequence. Again,
differences in

-Gal
expression could not be explained by variation
in RNA accumulation
(Fig.
5C and
E).
Expression of gpUL4 after infection with clinical isolates.
The above-described experiments demonstrated that naturally occurring
polymorphisms in some clinical isolates of HCMV eliminate the
inhibitory effect of uORF2 in transient-transfection assays. These
results predict that gpUL4, the product of the downstream reading frame
in the authentic viral mRNA, should be translated more efficiently
after infection by these strains. However, since results of
transient-transfection assays are not always reliable indicators of
regulatory mechanisms, we tested this prediction by analyzing gene
expression in cells infected with the C1, C4, C6, and Towne isolates of
HCMV (Fig. 6). Substantially more gpUL4 protein was detected by immunoblot assay after C1 and C6 infection than
after Towne or C4 infection (Fig. 6A), despite the similar levels of
abundance of UL4 mRNA in all samples (Fig. 6A, bottom). To ensure that
the differences in gpUL4 protein expression were not due to a
generalized lower level of viral protein synthesis in C4- and
Towne-infected cells, we also measured the expression of the viral
ppUL44 DNA binding protein (Fig. 6B). An immunoblot revealed similar
levels of ppUL44 protein in C4-, C6-, and Towne-infected cell extracts
and slightly less in C1-infected cell extracts. The greater expression
of gpUL4 protein in the C1- and C6-infected cells despite comparable
levels of UL4 RNA and ppUL44 protein in all samples supports the
conclusion that uORF2 exerts a major impact on gpUL4 expression during
viral infection.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 6.
gpUL4 expression after infection with HCMV (Towne) and
clinical isolates. HF extracts obtained 18 days after mock infection or
after infection with the HCMV isolate C1, C4, C6, or Towne were
separated by SDS-polyacrylamide gel electrophoresis and transferred to
polyvinylidene difluoride membranes. Immunoblots were probed with a
polyclonal antiserum to gpUL4 (A) or an anti-ppUL44 monoclonal antibody
(B) as described in Materials and Methods. Molecular size markers are
indicated on the left of each blot. Whole-cell mRNA was examined by
Northern blot analysis with a UL4 probe (A, bottom). The position of
the 18S rRNA migration is indicated.
|
|
 |
DISCUSSION |
Translational repression by uORF2 in the HCMV gpUL4 mRNA occurs by
a highly unusual mechanism. The nascent uORF2 peptide remains covalently attached to tRNAPro, the tRNA that decodes the
final uORF2 codon (3). In addition, ribosomes stall at the
uORF2 termination codon (2). These observations suggest that
the nascent uORF2 peptide interferes with the peptidyl-tRNA hydrolysis
reaction that normally occurs when a ribosome encounters a stop codon.
Consequently, ribosomes remain at the uORF termination site on the
mRNA, creating an obstacle that prevents other ribosomes from scanning
to the downstream cistron (Fig. 7).

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 7.
Model of uORF2 peptide interactions with ribosomes or
ribosome-associated translation factors. When a ribosome reaches the
uORF2 termination codon (UAA), the nascent uORF peptide (chain of
circles) remains linked to the tRNA decoding the final uORF2 proline
codon, CCU. The ribosome stalls at this site, creating a roadblock that
obstructs other ribosomes from scanning to the downstream cistron.
Changes in uORF2 amino acids that fully (black circles) or partially
(dark-gray circles) alleviate uORF2 inhibitory function, do not affect
it (white circles), or for which insufficient data are available
(light-gray circles) are shown. The repressive effects of uORF2 may be
mediated through its interactions with ribosomal components, such as
the peptidyl transferase center (PTC) and the peptide exit domain, or
translation factors involved in peptidyl-tRNA hydrolysis, such as
eukaryotic release factors.
|
|
A distinctive feature of this mechanism is its strict dependence on the
uORF2 peptide sequence for inhibition of peptidyl-tRNA hydrolysis,
ribosomal stalling, and inhibition of downstream translation (2,
3, 6). In the present study, we discovered that sequences located
in the amino-terminal region, like those at the carboxy terminus, are
also required for translational inhibition. Mutation of certain amino
acid positions (e.g., codons 7, 8, and 12) alleviated much or all of
the uORF2 repressive activity. Mutations at other positions had less
(e.g., codons 3 through 6) or no (e.g., codons 9 through 11) effect on
uORF2 inhibitory activity. Since only one amino acid substitution was
analyzed for most codons in uORF2, we cannot exclude the possibility
that other amino acid substitutions might have different effects. In
fact, nonconservative mutations at codons 7 and 8 (Fig. 4) completely
eliminated the inhibitory effect of uORF2 while conservative mutations
affecting codons 7 and 8 along with codons 3 through 11 (Fig. 2) only
partially reduced the uORF2 inhibitory effect. On the other hand,
multiple mutations at codons 9 (K9V, K9Q, and K9E), 10 (K10V and K10E), 11 (L11M and L11Q), 16 (T16A and T16I), 21 (P21A and P21S), and 22 (P22A and P22T) (reference 6 and Fig. 4) have been
tested and in all these cases alternative mutations affected uORF2
function in a concordant manner. Thus, these transfection data provide a provisional guide to uORF2 codons that are essential and dispensable for inhibition of downstream translation.
Only a few other eukaryotic genes contain uORFs that have been shown to
function in a peptide sequence-dependent manner like uORF2. Inhibition
of mammalian S-adenosylmethionine decarboxylase translation
requires specific amino acids at the three carboxy-terminal codons of
the 6-amino-acid uORF (9), while codons 2 and 3 can be
altered without affecting the inhibitory effect. Analyses of the uORF
sequence requirements in the cases of Saccharomyces cerevisiae CPA1 and its Neurospora crassa homologue
arg-2 (12, 22), the mammalian
2-adrenergic
receptor (13), and the mammalian retinoic acid receptor
2
(15) are less complete, but at least some codons located
near the middle regions of these uORFs are essential for translational
inhibition. We now have evidence that codons dispersed throughout uORF2
in the gpUL4 mRNA are required for the inhibitory mechanism.
Comparisons of the uORF sequences among these few examples of
sequence-dependent uORFs and those shown to act in a
sequence-independent manner (5, 10, 14, 21) do not reveal
any distinguishing motifs. Thus, sequence data alone are insufficient
for accurately predicting which uORFs, among those found in 5 to 10%
of cellular genes and in a strikingly high percentage of some subsets
such as oncogenes (11), act in a sequence-dependent manner.
Prompted by the finding that some codons that are critical for uORF2
function are ones that are polymorphic among clinical isolates of HCMV,
we investigated the structural and functional diversity of uORF2. In
the majority of the 19 clinical HCMV isolates studied here, the uORF2
peptide sequence was the same as that found in the laboratory strains
Towne and AD169, both of which preserve the inhibitory effect on
downstream translation (17). However, in ~15% of the
isolates surveyed, polymorphisms that affect critical codons in uORF2
were present, and thus these strains may express gpUL4 at higher
levels. Consistent with these predictions, polymorphisms present in C1
and C6 both allowed high levels of
-Gal expression while those
present in C4 did not (Fig. 5B). Further, with C6, of the four codons
that differ from those of uORF2 in the prototypic strain Towne, the S7L
polymorphism accounted for the loss of repression by the C6 uORF2 (Fig.
5D) as predicted by analyses of engineered mutations (Fig. 4).
The transfection results led us to evaluate whether gpUL4 translation
is increased in cells infected with isolates having noninhibitory uORF2
variants. Indeed, gpUL4 protein is more abundant after infection with
C1 and C6 than after infection with HCMV (Towne) or C4 despite similar
levels of UL4 RNA (Fig. 6). We cannot exclude the possibility that
other genetic differences among isolates somehow contributed to the
differences in gpUL4 expression. However, these findings strongly
support the hypothesis that uORF2 polymorphisms are major determinants
of gpUL4 expression. Studies of isogenic viruses with and without uORF2
will be needed to definitively establish the role of uORF2 in
controlling gpUL4 expression during viral infection.
The observed high-level expression of gpUL4 after C1 and C6 infection
of cells in culture demonstrates that the uORF2 repressive mechanism is
not essential for viral growth in cell culture. Since these and several
other isolates predicted to contain uORF2 sequences that allow
efficient downstream translation are low-number-passage clinical
isolates, it seems likely that the uORF2 inhibitory mechanism is also
not essential for viral replication in humans. However, it is possible
that the uORF2 polymorphisms that are inactive in HF in cell culture
remain active in other cell types in infected patients. In addition,
although the isolates were passaged only a few times in culture, some
of these polymorphisms may have arisen ex vivo. Determining whether
polymorphisms in uORF2 sequence and function affect the pathogenesis or
replication efficiency of HCMV during natural infections will require
additional studies. The polymorphisms identified here may be useful for
typing of HCMV isolates in efforts to discover linkages between viral
genetic loci and disease manifestations (16, 20).
Although we do not know the precise molecular interactions between the
uORF2 peptide and the cellular translational machinery that repress
translation termination, our experiments support the model depicted in
Fig. 7. The uORF2 peptide prevents the peptidyl-tRNA hydrolysis
reaction during translation termination, resulting in ribosomal
stalling and inhibition of downstream translation. Thus, we hypothesize
that the nascent uORF2 peptide interacts with a ribosomal constituent
or a translation factor involved in the translation termination
reaction. The identification of amino acids dispersed throughout the 22 codons of uORF2 that are necessary for inhibiting translation should be
useful in guiding attempts to identify the factors with which the
nascent uORF2 peptide interacts.
 |
ACKNOWLEDGMENTS |
We thank Beverley Torok-Storb and the Clinical Virology
Laboratory of the Fred Hutchinson Cancer Research Center for providing clinical isolates of HCMV; Mark Stinski for providing gpUL4 antiserum; Stephanie Child for technical assistance; Ed Mocarski, Catherine Degnin, and Mark Schleiss for providing plasmids; and Michael Bates,
Wei-Chun Goh, and Michael Katze for helpful comments on the manuscript.
We also thank the Biotechnology, Biocomputing, and Image Analysis
Resources of the Fred Hutchinson Cancer Research Center for technical assistance.
This work was support by Public Health Service grant AI-26672 from the
National Institute of Allergy and Infectious Diseases.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Human Biology, Fred Hutchinson Cancer Research Center, 1100 Fairview
Ave., North, Mailstop C2-023, P.O. Box 19024, Seattle, WA 98109-1024. Phone: (206) 667-5122. Fax: (206) 667-6523. E-mail:
ageballe{at}fhcrc.org.
 |
REFERENCES |
| 1.
|
Biegalke, B. J., and A. P. Geballe.
1990.
Translational inhibition by cytomegalovirus transcript leaders.
Virology
177:657-667[Medline].
|
| 2.
|
Cao, J., and A. P. Geballe.
1996.
Coding sequence-dependent ribosomal arrest at termination of translation.
Mol. Cell. Biol.
16:603-608[Abstract].
|
| 3.
|
Cao, J., and A. P. Geballe.
1996.
Inhibition of nascent-peptide release at translation termination.
Mol. Cell. Biol.
16:7109-7114[Abstract].
|
| 4.
|
Cao, J., and A. P. Geballe.
1995.
Translational inhibition by a human cytomegalovirus upstream open reading frame despite inefficient utilization of its AUG codon.
J. Virol.
69:1030-1036[Abstract].
|
| 5.
| Child, S. J., M. K. Miller, and A. P. Geballe. Translational control by an upstream open reading frame
in the HER-2/neu transcript. J. Biol. Chem., in press.
|
| 6.
|
Degnin, C. R.,
M. R. Schleiss,
J. Cao, and A. P. Geballe.
1993.
Translational inhibition mediated by a short upstream open reading frame in the human cytomegalovirus gpUL4 (gp48) transcript.
J. Virol.
67:5514-5521[Abstract/Free Full Text].
|
| 7.
|
Geballe, A. P.,
F. S. Leach, and E. S. Mocarski.
1986.
Regulation of cytomegalovirus late gene expression: gamma genes are controlled by posttranscriptional events.
J. Virol.
57:864-874[Abstract/Free Full Text].
|
| 8.
|
Geballe, A. P.,
R. R. Spaete, and E. S. Mocarski.
1986.
A cis-acting element within the 5' leader of a cytomegalovirus beta transcript determines kinetic class.
Cell
46:865-872[Medline].
|
| 9.
|
Hill, J. R., and D. R. Morris.
1993.
Cell-specific translational regulation of S-adenosylmethionine decarboxylase mRNA. Dependence on translation and coding capacity of the cis-acting upstream open reading frame.
J. Biol. Chem.
268:726-731[Abstract/Free Full Text].
|
| 10.
|
Hinnebusch, A. G.
1996.
Translational control of GCN4: gene specific regulation by phosphorylation of eIF2, p. 199-244.
In
J. W. B. Hershey, M. B. Matthews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 11.
|
Kozak, M.
1991.
An analysis of vertebrate mRNA sequences: intimations of translational control.
J. Cell Biol.
115:887-903[Abstract/Free Full Text].
|
| 12.
|
Luo, Z., and M. S. Sachs.
1996.
Role of an upstream open reading frame in mediating arginine-specific translational control in Neurospora crassa.
J. Bacteriol.
178:2172-2177[Abstract/Free Full Text].
|
| 13.
|
Parola, A. L., and B. K. Kobilka.
1994.
The peptide product of a 5' leader cistron in the beta 2 adrenergic receptor mRNA inhibits receptor synthesis.
J. Biol. Chem.
269:4497-4505[Abstract/Free Full Text].
|
| 14.
|
Polymenis, M., and E. V. Schmidt.
1997.
Coupling of cell division to cell growth by translational control of the G1 cyclin CLN3 in yeast.
Genes Dev.
11:2522-2531[Abstract/Free Full Text].
|
| 15.
|
Reynolds, K.,
A. M. Zimmer, and A. Zimmer.
1996.
Regulation of RAR beta 2 mRNA expression: evidence for an inhibitory peptide encoded in the 5'-untranslated region.
J. Cell Biol.
134:827-835[Abstract/Free Full Text].
|
| 16.
|
Rosen, H. R.,
C. L. Corless,
J. Rabkin, and S. Chou.
1998.
Association of cytomegalovirus genotype with graft rejection after liver transplantation.
Transplantation
66:1627-1631[Medline].
|
| 17.
|
Schleiss, M. R.,
C. R. Degnin, and A. P. Geballe.
1991.
Translational control of human cytomegalovirus gp48 expression.
J. Virol.
65:6782-6789[Abstract/Free Full Text].
|
| 18.
|
Siebert, P. D., and A. Chenchik.
1993.
Modified acid guanidinium thiocyanate-phenol-chloroform RNA extraction method which greatly reduces DNA contamination.
Nucleic Acids Res.
21:2019-2020[Free Full Text].
|
| 19.
|
Tam, J. P.
1988.
Synthetic peptide vaccine design: synthesis and properties of a high-density multiple antigenic peptide system.
Proc. Natl. Acad. Sci. USA
85:5409-5413[Abstract/Free Full Text].
|
| 20.
|
Torok-Storb, B.,
M. Boeckh,
C. Hoy,
W. Leisenring,
D. Myerson, and T. Gooley.
1997.
Association of specific cytomegalovirus genotypes with death from myelosuppression after marrow transplantation.
Blood
90:2097-2102[Abstract/Free Full Text].
|
| 21.
|
Wang, L., and S. R. Wessler.
1998.
Inefficient reinitiation is responsible for upstream open reading frame-mediated translational repression of the maize R gene.
Plant Cell
10:1733-1746[Abstract/Free Full Text].
|
| 22.
|
Werner, M.,
A. Feller,
F. Messenguy, and A. Pierard.
1987.
The leader peptide of yeast gene CPA1 is essential for the translational repression of its expression.
Cell
49:805-813[Medline].
|
Journal of Virology, October 1999, p. 8330-8337, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Imai, A., Hanzawa, Y., Komura, M., Yamamoto, K. T., Komeda, Y., Takahashi, T.
(2006). The dwarf phenotype of the Arabidopsis acl5 mutant is suppressed by a mutation in an upstream ORF of a bHLH gene. Development
133: 3575-3585
[Abstract]
[Full Text]
-
Hanfrey, C., Elliott, K. A., Franceschetti, M., Mayer, M. J., Illingworth, C., Michael, A. J.
(2005). A Dual Upstream Open Reading Frame-based Autoregulatory Circuit Controlling Polyamine-responsive Translation. J. Biol. Chem.
280: 39229-39237
[Abstract]
[Full Text]
-
Wang, X.-Q., Rothnagel, J. A.
(2004). 5'-Untranslated regions with multiple upstream AUG codons can support low-level translation via leaky scanning and reinitiation. Nucleic Acids Res
32: 1382-1391
[Abstract]
[Full Text]
-
Meijer, H. A., Thomas, A. A. M.
(2003). Ribosomes stalling on uORF1 in the Xenopus Cx41 5' UTR inhibit downstream translation initiation. Nucleic Acids Res
31: 3174-3184
[Abstract]
[Full Text]
-
Janzen, D. M., Frolova, L., Geballe, A. P.
(2002). Inhibition of Translation Termination Mediated by an Interaction of Eukaryotic Release Factor 1 with a Nascent Peptidyl-tRNA. Mol. Cell. Biol.
22: 8562-8570
[Abstract]
[Full Text]
-
Rasmussen, L., Geissler, A., Cowan, C., Chase, A., Winters, M.
(2002). The Genes Encoding the gCIII Complex of Human Cytomegalovirus Exist in Highly Diverse Combinations in Clinical Isolates. J. Virol.
76: 10841-10848
[Abstract]
[Full Text]
-
Alderete, J. P., Child, S. J., Geballe, A. P.
(2001). Abundant Early Expression of gpUL4 from a Human Cytomegalovirus Mutant Lacking a Repressive Upstream Open Reading Frame. J. Virol.
75: 7188-7192
[Abstract]
[Full Text]
-
JANZEN, D.M., GEBALLE, A.P.
(2001). Modulation of Translation Termination Mechanisms by cis- and trans-Acting Factors. Cold Spring Harb Symp Quant Biol
66: 459-468
[Abstract]
-
Morris, D. R., Geballe, A. P.
(2000). Upstream Open Reading Frames as Regulators of mRNA Translation. Mol. Cell. Biol.
20: 8635-8642
[Full Text]
-
Chen, J., Stinski, M. F.
(2000). Activation of Transcription of the Human Cytomegalovirus Early UL4 Promoter by the Ets Transcription Factor Binding Element. J. Virol.
74: 9845-9857
[Abstract]
[Full Text]
-
Hemmings-Mieszczak, M., Hohn, T., Preiss, T.
(2000). Termination and Peptide Release at the Upstream Open Reading Frame Are Required for Downstream Translation on Synthetic Shunt-Competent mRNA Leaders. Mol. Cell. Biol.
20: 6212-6223
[Abstract]
[Full Text]
-
Wang, Z., Gaba, A., Sachs, M. S.
(1999). A Highly Conserved Mechanism of Regulated Ribosome Stalling Mediated by Fungal Arginine Attenuator Peptides That Appears Independent of the Charging Status of Arginyl-tRNAs. J. Biol. Chem.
274: 37565-37574
[Abstract]
[Full Text]
-
Pooggin, M. M., Hohn, T., Futterer, J.
(2000). Role of a Short Open Reading Frame in Ribosome Shunt on the Cauliflower Mosaic Virus RNA Leader. J. Biol. Chem.
275: 17288-17296
[Abstract]
[Full Text]
-
Fang, P., Wang, Z., Sachs, M. S.
(2000). Evolutionarily Conserved Features of the Arginine Attenuator Peptide Provide the Necessary Requirements for Its Function in Translational Regulation. J. Biol. Chem.
275: 26710-26719
[Abstract]
[Full Text]