Previous Article | Next Article 
Journal of Virology, October 1999, p. 8112-8119, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Human T-Cell Leukemia Virus Type 2 Rex Protein
Increases Stability and Promotes Nuclear to Cytoplasmic Transport
of gag/pol and env RNAs
Koichi
Kusuhara,1,
Matthew
Anderson,1
Sherrie M.
Pettiford,1 and
Patrick L.
Green2,*
Department of Microbiology and Immunology,
Vanderbilt University School of Medicine, Nashville, Tennessee
37232-2363,1 and Department of
Veterinary Biosciences and Molecular Virology, Immunology, and
Medical Genetics, Center for Retrovirus Research, and Comprehensive
Cancer Center, The Ohio State University, Columbus, Ohio
43210-10932
Received 13 April 1999/Accepted 6 July 1999
 |
ABSTRACT |
The human T-cell leukemia virus (HTLV) Rex protein is essential for
efficient expression of the viral structural and enzymatic gene
products. In this study, we assessed the role of the HTLV-2 rex gene in viral RNA expression and Gag protein
production. Following transfection of human JM4 T cells with wild-type
and rex mutant full-length proviral constructs, PCR was
used for semiquantitative analysis of specific viral RNA transcripts.
In the presence of Rex, the total amount of steady-state viral RNA was
increased fourfold. Rex significantly up-regulated the level of
incompletely spliced RNAs by increasing RNA stability and was
associated with a twofold down-regulation of the completely spliced
tax/rex RNA. PCR analysis of subcellular RNA fractions,
isolated from transfected cells, indicated that the level of
gag/pol and env cytoplasmic RNAs were increased
7- to 9-fold in the presence of Rex, whereas Gag protein production was
increased 130-fold. These data indicate that HTLV-2 Rex increases the
stability and promotes nucleus-to-cytoplasm transport of the
incompletely spliced viral RNAs, ultimately resulting in increased
structural protein production. Moreover, this model system provides a
sensitive approach to further characterize HTLV gene expression from
full-length proviral clones following transfection of human T cells.
 |
INTRODUCTION |
Human T-cell leukemia virus types 1 and 2 (HTLV-1 and HTLV-2) are complex oncogenic retroviruses that
transform primary human T cells in culture and are associated with
leukemia and neurological disorders in humans (reviewed in
reference 19). In addition to the essential
gag, pol, and env structural and
enzymatic genes expressed by all replication-competent retroviruses,
the HTLVs contain at least two additional trans-regulatory
genes that regulate expression of all viral genes. The HTLV provirus is
expressed as three major RNA species which are derived from the
full-length transcript by differential splicing. The completely spliced
RNA codes for the regulatory gene products Tax and Rex (25, 30, 34, 36). Tax is an important modulator of both viral and cellular gene expression and is essential for HTLV-mediated transformation of
human T lymphocytes in culture (18, 32). Tax localizes to
the nucleus of infected cells (17, 38) and acts to increase the rate of transcription initiation by facilitating the binding of the
CREB and ATF cellular proteins to the viral promoter (1, 2, 9, 15,
35, 39). The interaction of Tax with cellular proteins results in
the activation of NF
B/Rel-, CREB/ATF-, and serum response
factor-responsive genes (reviewed in references 12
and 16) and the dysregulation of cell cycle control
(28, 31).
The Rex protein is required for the expression of the structural and
enzymatic proteins that are translated from the unspliced gag/pol/genome and singly spliced env viral
transcripts (23, 27, 29). Rex function is mediated by a
cis-acting RNA Rex response element (RxRE) located in the R
region of the viral long terminal repeat (5, 7, 40).
Specific binding of Rex to the RxRE is correlated with function and is
regulated by phosphorylation (6, 22). Previous studies have
addressed the mechanism of HTLV-1 Rex (Rex-1) function using stably
infected cells or by transfection of indicator plasmids or subgenomic
constructs into cells in which amplification of the transfected DNA
occurs (23, 24, 26). These approaches, necessitated by
difficulties in detecting and quantitating low-abundance HTLV mRNA
species, have demonstrated that Rex-1 increases the amounts of
unspliced viral RNA by reducing the rates of splicing and degradation
in the nucleus and stimulating the nucleocytoplasmic transport of
incompletely spliced viral RNA. This study uses the transfection of
infectious wild-type and mutant molecular proviral clones of HTLV-2
into JM4 human T cells, subcellular RNA fractionation, and
semiquantitative PCR analysis of specific viral RNA species to evaluate
the mechanism of HTLV-2 Rex (Rex-2) function. This approach allows us
to study the regulation of HTLV gene expression in the context of
proviral DNA transfected into T cells, the natural target for HTLV
pathogenesis, and provides a basis for comparison of Rex-2, Rex-1, and
the analogous human immunodeficiency virus type 1 (HIV-1) Rev function.
Our results demonstrate that Rex increases the stability and promotes nucleus-to-cytoplasm transport of the gag/pol and
env RNAs.
 |
MATERIALS AND METHODS |
Cells and plasmids.
B-cell line 729-6 (hereafter called
729), HTLV-2 chronically infected cell line 729pH6neo (37),
and human leukemic T-cell line JM4 (33) were maintained in
Iscove's medium supplemented with 10% fetal calf serum (FCS),
penicillin (100 U/ml), streptomycin (100 µg/ml), and 2 mM glutamine.
The wild-type and rex mutant proviral plasmid clones of
HTLV-2, pH6neo and pH6neoSph, have been described elsewhere
(20) and are designated wtHTLV-2 and HTLV-2(rex
),
respectively. The rex cDNA expression vector BCRex
(20), tax expression vector BC20.2Sph
(32), and the control and filler plasmids Sv2neo
(21) and BC12 (11) were previously described.
Transfections.
Plasmid DNA was introduced into cells by
electroporation as previously described (8). Briefly, cells
were washed with phosphate-buffered saline and resuspended (2 × 107 cells/ml) in RPMI 1640 medium supplemented with 20%
FCS, penicillin (100 U/ml), streptomycin (100 µg/ml), and 2 mM
glutamine. A total of 107 cells were electroporated with 35 µg of total DNA (900-µF charge, 250-V potential) which included 5 µg of expression vector pCMV
Gal. Cells were transferred to 3 ml of
medium, incubated at 37°C, harvested and enumerated 48 to 72 h
posttransfection, and subjected to a
-galactosidase (
-Gal)
colorimetric assay to normalize for transfection efficiency. Briefly,
106 cells were lysed by sonication in 60 µl of 0.25 mM
Tris (pH 7.8) and centrifuged 15 min at 4°C; 30 µl of extract was
incubated for 1 to 5 h at room temperature in 1 mM
MgCl2-50 mM
-mercaptoethanol-66 mM
NaHPO4-Na2PO4-0.9 mg of
o-nitrophenyl-
-D-galactopyranoside per ml.
The reaction was stopped by addition of Na2CO3,
and the absorbance was read at 410 nm. The remainder of the cells were used for Gag protein production analysis, total RNA isolation, or
nuclear and cytoplasmic RNA isolation.
Gag protein analysis.
At 96 h posttransfection, culture
supernatants were analyzed by a specific enzyme-linked immunosorbent
assay (ELISA) using a monoclonal antibody to either p24Gag
(Coulter) or p19Gag (Cellular Products) for the presence of
structural Gag antigen as described by the manufacturers. To assess
cell-associated p24Gag levels in JM4 T cells 48 h
posttransfection, cells were metabolically labeled with
[35S]methionine-cysteine (Trans35S-label, 100 µCi/ml; ICN Biochemicals, Inc.) in methionine-cysteine-free RPMI 1640 medium supplemented with 10% dialyzed FCS. Cells were lysed in
radioimmunoprecipitation assay buffer (0.05 M Tris-HCl [pH 8.0],
0.1% sodium dodecyl sulfate [SDS], 1.0% Triton X-100, 0.15 M NaCl,
2.0 mM phenylmethylsulfonyl fluoride), and lysates were clarified by
centrifugation at 100,000 × g (1 h, 4°C). Various amounts of clarified extracts were immunoprecipitated with antisera specific for HTLV-2 p24Gag in the presence of protein
A-Sepharose (Pharmacia). Immunoreactive proteins were fractionated by
SDS-polyacrylamide gel electrophoresis (SDS-PAGE), visualized by
autoradiography, and quantified by phosphorimage analysis.
Preparation and analysis of RNA.
Total cellular RNA was
extracted from transfected 729, 729pH6neo, or JM4 T cells by the Tri
Reagent procedure as described elsewhere (10). A three-step
fractionation protocol (14) in conjunction with the Tri
Reagent procedure was used to obtain one nuclear and two cytoplasmic
RNA fractions. Briefly, cells were initially lysed by a low
concentration of NP-40 (0.05%) to fractionate cytoplasmic fraction 1, which contains soluble cytoplasmic components and the bulk of the tRNA.
The remaining pellet was treated with a higher concentration of NP-40
(0.65%) to release additional cytoplasmic RNA. This more stringent
cytoplasmic fraction 2 contains less soluble cytoplasmic components,
including much of the 18S and 28S RNAs and RNAs associated with
membrane-bound polysomes. The remaining pellet contains the nuclear
fraction. All RNA was treated three times with RNase-free DNase
(Boehringer Mannheim), precipitated, and quantified by absorbance at
260 nm.
Approximately 200 ng of RNA (equivalent amounts of RNA based on
transfection efficiency) was subjected to a coupled primer
extension-25-cycle PCR using HTLV-2-specific oligonucleotide primer
pairs. The 50-µl volume coupled primer extension-PCR mixture
contained
RNA, 0.25 mM deoxynucleoside triphosphates, 50 mM KCl, 10 mM
Tris
(pH 8.0), 1.5 mM MgCl
2, 0.01% gelatin, 100 ng of 3'
(antisense)
oligonucleotide, 50 ng of 5' (sense) oligonucleotide end
labeled
with T4 DNA kinase to a specific activity of approximately
2 ×
10
8 cpm/µg, and 2.5 U of
Taq DNA
polymerase (Promega) in the presence
or absence of 5 U of murine
leukemia virus reverse transcriptase
(Amersham). The reaction was
performed in a Perkin-Elmer model
9600 thermal cycler as follows:
65°C for 10 min, 50°C for 8 min,
and 95°C for 5 min, followed by
25 cycles of 95°C for 1 min, 55°C
for 2 min, and 72°C for 2 min.
PCR-amplified products were separated
on a 6% polyacrylamide gel and
visualized by autoradiography or
phosphorimage analysis (Fuji Imaging
Systems). Sequences of the
HTLV-2-specific oligonucleotides and
proviral nucleotide locations,
based on the pH6neo proviral clone
(
36), are as follows: 1-T,
5' CTCGGCACCTCCTGAACTGC 3'
(nucleotides [nt] 420 to 439), 20,
AGCCCCCAGTTCATGCAGACC
3' (nt 1314 to 1334), 19, 5' GAGGGAGGAGCATAGGTACTG
3' (nt
1412 to 1392), LA79, 5' CCGGTGGATCCCGTGGCGAT 3' (nt 5085
to
5104), 39, 5' AAAAGTAGGAAGAAAACATTA 3' (nt 5203 to 5184),
LA78,
5' GTCCAAATCCTGGGAAATGGG 3' (nt 7234 to 7214), M670,
5' CGGATACCCAGTCTACGTGT
3' (nt 7248 to 7267), M671, 5'
GAGCTGACAACGCGTCCATCA 3' (nt 7406
to 7386), KK1, 5'
CCCTCCTATCTACTCTCTC 3' (nt 8071 to 8089), and
KK2, 5'
CGCCTCTTCTTTATTAAATAAAATAGAGACAGGG 3' (nt 8187 to 8154).
The
primer pairs (see Fig.
2) were designed to amplify total viral
RNA
detected by M670-M671 (159 bp) or KK1-KK2 (112 bp),
env-specific
RNA (182 bp),
tax/rex-specific RNA
(122 bp), and genome or
gag/pol-specific
RNA (99 bp).
Oligonucleotide primer pairs that detect
-actin unspliced
pre-RNA (ActE5 [5' TGGCACCCAGCACAATGAAG 3'] and ActI5
[5' TGGATGTGACAGCTCCCCAC 3']) and
GAPDH spliced
RNA (gapdh+ [5'
GGTGAAGGTCGGAGTCAACG 3'] and
gapdh-[5' GTTGAGGTCAATGAAGGGGTC 3'])
were used to control
for nuclear/cytoplasmic separation and/or
RNA
loading.
To determine the decay rates of HTLV-2
gag/pol and
tax/rex RNAs in the presence and absence of Rex, RNA
polymerase II-dependent
de novo transcription was inhibited by adding
actinomycin D (5
µg/ml) to the culture supernatant of JM4 T cells
48 h post-transfection.
Total RNA was isolated at different times
after the addition of
drug and subjected to reverse transcriptase PCR
(RT-PCR) analysis.
The estimates of transcript stability are based on
phosphorimage
analysis of the specific PCR-amplified product over the
time course.
RNA stability analysis was performed multiple times in
independent
experiments without significant
differences.
 |
RESULTS |
HTLV-2 Rex is necessary for production of Gag antigen in human B
and T cells.
The function of Rex in the expression of Gag proteins
was determined by using the previously characterized proviral plasmid clones wtHTLV-2 and HTLV-2(rex
) along with Rex and Tax cDNA
expression vectors. To compare Rex function in two human cell lines,
plasmids were transfected into 729 B cells or JM4 CD4+ T
cells. At 96 h posttransfection, culture supernatants were analyzed by p24Gag or p19Gag ELISA for the
presence of structural Gag antigen. The results are summarized in Table
1. wtHTLV-2 gave rise to high levels of
Gag antigen in both cell types tested. No viral Gag antigen was
detected with vector controls or HTLV-2(rex
). Complementation experiments were performed to determine whether it was possible to
rescue Gag protein production from HTLV-2(rex
). Gag proteins were
produced when the HTLV-2(rex
) was coelectroporated with a
cytomegalovirus promoter-driven rex expression vector. In
contrast, coelectroporation of a tax expression vector did
not rescue Gag protein production, indicating that the decreased Gag
production is not influenced by the transactivator protein Tax. These
results indicate that Rex is essential for efficient Gag production in the cell supernatant and that Rex functions in trans to
allow Gag expression in human B and T cells.
A threshold level of cell-associated Gag (necessary for budding) is
likely required for significant levels of Gag to be detected
in the
culture supernatant. Therefore, we next assessed the amount
of
cell-associated p24 Gag in JM4 T cells 48 h after transfection
of
wtHTLV-2 or HTLV-2(rex

). We failed to detect cell-associated
Gag
protein with the p19
Gag ELISA in the absence of Rex (data
not shown). However, immunoprecipitation
of metabolically labeled cell
lysates with a p24
Gag-specific antisera allowed detection
of a low level of p24
Gag in the absence of Rex, but only
with 20-fold more lysate than
for wtHTLV-2-transfected cells (Fig.
1; compare lanes 3 and 5).
Phosphorimage
analysis indicated that p24Gag protein production
was increased on
average 130-fold in the presence of Rex. These
results indicate that a
low level of Gag is produced in the absence
of Rex but efficient Gag
expression requires Rex.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 1.
Quantitation of intracellular radiolabeled p24 Gag in
transfected T cells. JM4 human T cells (107) were
cotransfected by electroporation with 5 µg of pCMV Gal and 25 µg
of wtHTLV-2 proviral clone/5 µg of BC12 (control), 25 µg of
HTLV-2(rex ) proviral clone/5 µg of BC12, or 25 µg of
HTLV-2(rex ) proviral clone/5 µg of BCRex (rex cDNA
expression vector); 48 h posttransfection, 106 cells
were subjected to a -Gal colorimetric assay to normalize for
transfection efficiency. Cells were normalized for transfection
efficiency and labeled for 3 h with
[35S]methionine-cysteine, and cell lysates were made.
Various amounts of cell lysate [100 µl of mock, wtHTLV, and
HTLV(rex ) + rex (lanes 2, 3, and 6), 200 µl of
HTLV(rex ) (lane 4), and 2 ml of HTLV(rex ) (lane 5)] were
immunoprecipitated with human HTLV-2-specific antisera that detect
primarily p24 Gag and Gag precursors in the presence of protein
A-Sepharose. Immunoprecipitated proteins were resolved by SDS-PAGE,
visualized by autoradiography, and quantified by phosphorimage
analysis. Quantification indicates 130-fold increase in
p24Gag in the presence of Rex. The sizes in kilodaltons (K)
of markers (lane 1) are indicated on the left.
|
|
Detection of HTLV-2 RNA species by quantitative PCR analysis.
To provide a sensitive and quantitative measure of RNA species, we
developed a PCR approach to detect viral RNA transcripts in
HTLV-2-transfected or -infected cells. Low-level viral gene expression
and low transfection efficiency of full-length proviral constructs into
human T cells necessitate the use of RT-PCR. We used specific
oligonucleotide primer pairs to generate a profile of viral RNA
expression. Oligonucleotide primers were designed to detect (i) all
transcripts/total viral RNA, (ii) full-length gag/pol/genomic RNA, (iii) singly spliced env
RNA, and (iv) doubly spliced tax/rex RNA. The locations of
the oligonucleotide pairs in the HTLV-2 genome with respect to the
major splice donor and acceptor sites and the predicted sizes of the
HTLV-2-specific PCR products generated with each oligonucleotide pair
are shown in Fig. 2. Oligonucleotide
primer pairs M670-M671 and KK1-KK2 are designed to detect all HTLV-2
RNAs. Oligonucleotide primers 19 and 20 should generate a product
specific for full-length gag/pol or genomic RNA.
Oligonucleotide primers 1-T and 39 should direct the synthesis of a
product corresponding to the singly spliced env RNA, and
primer pair LA79-LA78 will amplify a product specific for the doubly
spliced tax/rex RNA.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Oligonucleotide primer pairs for RT-PCR using HTLV-2
RNAs. (A) Schematic representation of the HTLV genome showing locations
and orientations of the oligonucleotides used for PCR. For sequences of
the oligonucleotides and proviral nucleotide locations, see Materials
and Methods. The major splice donor (SD) and splice acceptor (SA) sites
and long terminal repeat (LTR) are shown. The three major species of
HTLV RNA are depicted below the schematic diagram. (B) Sizes of the
predicted amplified products generated by RT-PCR with pairs of
oligonucleotide primers specific for HTLV-2 RNAs. ND, RNA species for
which specific products were not detected because of their large
theoretical size or absence of complementary binding site in the
specific RNA.
|
|
Total RNAs were isolated from uninfected and HTLV-2 chronically
infected human lymphocytes. Equivalent amounts of uninfected
and HTLV-2
chronically infected cell RNAs were subjected to a
reverse
transcriptase step coupled to 25 cycles of PCR amplification.
Each
reaction contained the appropriate primer pair with the oligonucleotide
corresponding to the sense strand end labeled with
32P.
This allowed direct detection of the amplified products following
SDS-PAGE and autoradiography or phosphorimage analysis. A major
product
of the predicted size was RT-PCR amplified from HTLV-2-infected
cell
RNA by using each of the HTLV-specific oligonucleotide pairs
(Fig.
3A). These products are not detected in
uninfected total-cell
RNA (Fig.
3A). Oligonucleotide pairs M670-M671,
KK1-KK2, and 19-20
can specifically detect HTLV-2 plasmid or proviral
DNA. However,
reactions in which reverse transcriptase was omitted
showed that
no amplified product resulted from DNA contaminated RNA.

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 3.
Detection of HTLV-2-specific RNAs by RT-PCR using RNA
isolated from chronically infected and uninfected human lymphocytes.
RNA was extracted from HTLV-2-infected (In) and uninfected (Un) 729 B
cells. (A) RNA from 5 × 105 cells was subjected to
coupled primer extension-25-cycle PCR as described in Materials and
Methods in the presence (+) or absence ( ) of 5 U of murine leukemia
virus reverse transcriptase (Amersham). The primer pairs were designed
to amplify total viral RNA detected by M670-M671 (159 bp) or KK1-KK2
(112 bp), env-specific RNA (182 bp),
tax/rex-specific RNA (122 bp), and genome or
gag/pol-specific RNA (99 bp). PCR-amplified products were
separated on a 6% polyacrylamide gel and visualized by autoradiography
or phosphorimage analysis (Fuji Imaging Systems). M, size markers
(positions are indicated in base pairs). (B) Quantitation of RT-PCR
data. HTLV-2-infected-cell RNA (106 to 500 cell
equivalents) was subjected to RT-PCR and analyzed as described for
panel A.
|
|
To determine whether HTLV-2-specific RNAs could be detected
quantitatively, total cellular RNA was isolated from the HTLV-2
chronically infected cell line 729pH6neo. Sequential twofold dilutions
of total RNA (from 10
6 to 500 cell equivalents) were
subjected to 25-cycle RT-PCR analyses
(Fig.
3B). The signals produced
were quantitative across a wide
range of RNA concentrations
(2,000-fold) with all oligonucleotide
pairs tested. In all cases,
increasing signal intensities were
detected from increasing amounts of
RNA. However, at high concentrations
of target RNA, the increase in
signal was not linear and reached
a plateau likely resulting from
nucleotide or oligonucleotide
concentration limitations. Therefore,
this assay specifically
detects HTLV-2 RNA from as few as 1,000 to
2,000 cells and will
allow detection of low-level RNA species expressed
following the
introduction of proviral constructs into cells by
transfection.
Effect of Rex on steady-state levels of gag/pol,
env, and tax/rex RNAs.
To examine the
block to Gag production exhibited by HTLV-2(rex
) the expression of
HTLV-specific RNAs in electroporated JM4 human T cells was analyzed by
RT-PCR (Fig. 4). RNA, normalized for
transfection efficiency, was subjected to RT-PCR using the panel of
HTLV-2-specific oligonucleotide primer pairs. The steady-state RNA
profile of the rex mutant clone was distinct from that of the wild-type clone. The rex mutant produced reduced levels
of the full-length gag/pol and singly spliced env
RNAs and a slight increase in the completely spliced tax/rex
RNA relative to wild-type RNA (Fig. 4). The magnitude of the
differences was determined by phosphorimage analyses of the PCR signals
(Table 2). The level of unspliced and
singly spliced transcripts (gag/pol and env, respectively) was 2.5- to 20-fold lower in the mutant, whereas the
level of tax/rex RNA was reproducibly 2-fold higher than in the wild-type construct. Coelectroporation of a rex
expression vector with the rex mutant proviral clone
resulted in the restoration of wild-type RNA levels, indicating that
Rex functions in trans (Fig. 4 and Table 2). In addition,
the overall amount of HTLV-2 RNA was increased fourfold in the presence
of Rex. Given that Rex functions posttranscriptionally, this result
suggests that Rex has a positive effect on RNA stability.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of Rex on HTLV-2 RNA accumulation. JM4 human T
cells (107) were cotransfected by electroporation with 5 µg of pCMV Gal and 25 µg of wtHTLV-2 proviral clone/5 µg of
BC12 (control), 25 µg of HTLV-2(rex ) proviral clone/5 µg of BC12,
or 25 µg of HTLV-2(rex ) proviral clone/5 µg of BCRex
(rex cDNA expression vector); 48 h posttransfection,
106 cells were subjected to a -Gal colorimetric assay to
normalize for transfection efficiency. Total cellular RNA was isolated
from the remainder of the cells. Approximately 200 ng of RNA
(equivalent amounts of RNA based on transfection efficiency) was
subjected to a coupled primer extension-25-cycle PCR in the presence
(+) or absence ( ) of reverse transcriptase as described in Materials
and Methods. The primer pairs were designated to amplify total viral
mRNA, full-length gag/pol/genome RNA, env RNA,
and tax/rex RNA. PCR products were separated on a 6%
polyacrylamide gel and visualized by autoradiography. RNA was
quantified by phosphorimage analysis and presented as experiment 1 in
Table 2.
|
|
Rex affects viral RNA stability.
We next determined the
stability of viral RNAs in the presence and absence of Rex expression
by inhibiting RNA polymerase II-dependent de novo transcription by
treatment with actinomycin D. JM4 T cells transfected with proviral
clones were treated with actinomycin D beginning 48 h
posttransfection. At different times after drug addition, total RNA was
isolated and subjected to RT-PCR. RNA stability was determined by
phosphorimage analysis of the RT-PCR-amplified product over time. The
half-life of the completely spliced tax/rex RNA was
approximately 10 h and was not affected by the presence of Rex
(Fig. 5B). In contrast, the half-life of the unspliced gag/pol RNA was 10 h in the presence of
Rex and approximately 1 h in the absence of Rex (Fig. 5A). These
results clearly demonstrate that Rex stabilizes unspliced HTLV-2
transcripts in transfected T cells.


View larger version (50K):
[in this window]
[in a new window]
|
FIG. 5.
Rex increases the stability of unspliced
gag/pol RNA in transfected JM4 T cells. JM4 human T cells
(107) were transfected by electroporation with 25 µg of
wtHTLV-2 or 25 µg of HTLV-2(rex ); 48 h posttransfection, cells
were divided equally into a six-well tissue culture plate. Total
cellular RNA was extracted at various times (0, 1, 3, 6, 12, and
20 h) following incubation with actinomycin D (5 µg/ml).
Approximately 200 ng of RNA from each time point was subjected to a
coupled primer extension-25-cycle PCR in the presence (+) or absence
( ) of reverse transcriptase as described in Materials and Methods.
The primer pairs were designated to amplify full-length
gag/pol/genome RNA (A), tax/rex RNA (B), and
control gapdh RNA (C). PCR products were separated on a 6%
polyacrylamide gel and visualized by autoradiography. RNA was
quantified by phosphorimage analysis.
|
|
Rex affects cellular distribution of HTLV RNAs.
To determine
whether Rex affects the subcellular distribution of HTLV-2 RNAs,
electroporated JM4 T cells were fractionated into one nuclear and two
cytoplasmic RNA fractions by a three-step fractionation protocol
(14) as described in Materials and Methods. It is important
to note that the majority of RNA in the cell is found in cytoplasmic
fraction 2. RNAs prepared from these fractions were normalized for
transfection efficiency and subjected to RT-PCR. To control for the
fractionation of authentic nuclear and cytoplasmic RNA, PCR products
were generated from unspliced
-actin pre-mRNA and spliced
GAPDH RNA by complementary human oligonucleotide pairs. From
the RT-PCR analysis (Fig. 6 and Table
3), it is clear that Rex increases the
overall amount of HTLV-2 RNA in the three fractions three- to fivefold,
consistent with a positive effect of Rex on RNA stability. In cells
transfected with the rex proviral mutant, the full-length
RNA (unspliced, gag/pol) was detectable at low levels in the
nuclear fraction and cytoplasmic fraction 1 but not in cytoplasmic
fraction 2.
-Actin and GAPDH RNAs were
detected in the nuclear and cytoplasmic compartments as expected (Fig. 6 and Table 3). Expression of the full-length gag/pol RNA in the cytoplasmic fractions was restored by cotransfection of a rex cDNA expression vector along with the mutant
rex proviral construct. env RNA was not
detectable in the nucleus from the rex mutant provirus but
was detected in both cytoplasmic fractions, indicating that once
splicing occurs, transport to the cytoplasm is efficient. As was the
case with full-length viral RNA, expression of env RNA was
rescued in all fractions by cotransfection of a rex cDNA
expression vector. The level of tax/rex RNA was only slightly varied in the cytoplasmic fractions in the absence of rex, with the major difference (1.4-fold increase) seen in
cytoplasmic fraction 2. By phosphorimage analysis, very low levels of
tax/rex RNA could be detected in the nuclear fraction;
however, the majority of tax/rex RNA detected in cells
transfected with both rex mutant and wild-type proviral
constructs was found in the cytoplasmic fractions as expected.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of Rex on nuclear and cytoplasmic RNA
distribution. JM4 human T cells (107) were cotransfected
with 5 µg of pCMV Gal and 25 µg of wtHTLV-2 proviral clone/5 µg
of BC12 (control), 25 µg of HTLV-2(rex ) proviral clone/5 µg of
BC12, or 25 µg of HTLV-2(rex ) proviral clone/5 µg of BCRex
(rex cDNA expression vector); 48 h posttransfection,
106 cells were subjected to a -Gal assay. One nuclear
and two cytoplasmic RNA fractions were extracted from the remainder of
the cells. Approximately 200 ng of RNA (equivalent amounts of RNA based
on transfection efficiency) was subjected to a coupled primer
extension-25-cycle PCR with oligonucleotide primer pairs to detect the
indicated RNA species. Oligonucleotide primer pairs that detect
-actin unspliced pre-RNA and GAPDH spliced RNA
were used to control for nuclear/cytoplasmic separation. PCR products
were separated on a 6% polyacrylamide gel and visualized by
autoradiography. RNA was quantified by phosphorimage analysis, and the
data are presented in Table 3.
|
|
 |
DISCUSSION |
In this study, we used transient transfection, in conjunction with
a sensitive and semiquantitative RT-PCR assay, to examine Rex function
in its natural context. This approach allowed the detection and
quantitation of specific low-abundance viral RNAs expressed from HTLV-2
proviral clones transfected into human T cells, thus providing an
opportunity to investigate the effects of Rex on viral RNA expression,
stability, and cellular distribution prior to tissue culture and
cellular selection processes. Our results demonstrate that Rex-2
increases the stability of the unspliced gag/pol RNA and
promotes the nuclear-cytoplasmic transport of the incompletely spliced
RNAs, ultimately resulting in efficient structural and enzymatic
protein expression and virion production.
We show that Rex increases the full-length unspliced viral RNA in the
cytoplasm but has a less dramatic effect on the singly spliced
env RNA. Thus, Rex functions to promote nuclear-cytoplasmic transport of incompletely spliced RNAs. Although not dramatic, this
increase in the incompletely spliced RNAs is associated with a slight
reduction in completely spliced tax/rex RNA. This is clearly
apparent by comparison of the tax/rex RNA signals in total cellular RNA from T cells transfected with wild-type and rex
mutant proviral clones (Fig. 4). Although less apparent, this reduction is also observed in cytoplasmic fraction 2 (Fig. 6), where the bulk of
total cellular RNA fractionates. One possibility consistent with this
result is that Rex inhibits RNA splicing. One report has provided
evidence that HTLV-2 Rex inhibits pre-mRNA splicing in vitro
(4). However, another likely possibility is that Rex increases RNA stability, resulting in a redirection of the incompletely spliced RNA pools. Indeed, analysis of RNA half-lives indicated that
gag/pol/genome transcripts are unstable in the absence of Rex (approximately 1 h). In contrast, these RNAs had a half-life of approximately 10 h in the presence of Rex, whereas Rex had no
effect on the half-life of the completely spliced RNAs (Fig. 5). A
similar effect on the stability of viral RNA was exerted by Rex-1 in
T-cell lines stably transformed by recombinant rhadinoviruses expressing Tax and/or Rex (23). Therefore, not only can we
conclude that Rex-2 has a function similar to that of Rex-1, but more
importantly the findings obtained with our approach help validate
results of previous studies using reporter constructs and stably
transfected or infected and transformed T-cell lines.
We show that Rex increases the incompletely spliced RNAs in the
cytoplasm 7- to 9-fold (Fig. 6 and Table 3), while Gag protein production increases 130-fold (Fig. 2). It has been reported that HIV-1
Rev significantly (800-fold) increases the utilization or translation
efficiency of the incompletely spliced RNA (3, 13). Our
results may suggest that Rex has an effect on translation efficiency,
but if so, it appears to be less than that reported for Rev and HIV-1.
Further studies will be required to determine the effect of Rex on
translation efficiency. We feel that this sensitive experimental
approach should facilitate Rex structure-function analysis in the
context of a full-length proviral clone, which will likely be required
to more precisely determine the mechanism of Rex action.
 |
ACKNOWLEDGMENTS |
We thank Zhi-Yu Fang for technical assistance and Kathleen
Boris-Lawrie and Michael Lairmore for critical comments.
This work was supported by grants from the National Institutes of
Health (CA59581 and P30CA16058) and Leukemia Society of America
(1030-94). P.L.G. is a scholar of the Leukemia Society of America.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Veterinary Biosciences, The Ohio State University, 1925 Coffey Rd.,
Columbus, OH 43210-1093. Phone: (614) 688-4899. Fax: (614) 292-6473. E-mail: green.466{at}osu.edu.
Present address: Department of Pediatrics, Faculty of Medicine,
Kyushu University, Higashi-ku, Fukuoka 812-8582, Japan.
 |
REFERENCES |
| 1.
|
Adya, N.,
L.-J. Zhao,
W. Huang,
I. Boros, and C.-Z. Giam.
1994.
Expansion of CREB's DNA recognition specificity by Tax results from interaction with Ala-Ala-Arg at positions 282-284 near the conserved DNA-binding domain of CREB.
Proc. Natl. Acad. Sci. USA
91:5642-5646[Abstract/Free Full Text].
|
| 2.
|
Anderson, M. G., and W. S. Dynan.
1994.
Quantitative studies of the effect of HTLV-1 Tax protein on CREB protein-DNA binding.
Nucleic Acids Res.
22:3194-3201[Abstract/Free Full Text].
|
| 3.
|
Arrigo, S. J., and I. S. Y. Chen.
1991.
Rev is necessary for the translation but not cytoplasmic accumulation of HIV-1 vif, vpr, and env/vpu 2 RNAs.
Genes Dev.
5:808-818[Abstract/Free Full Text].
|
| 4.
|
Bakker, A. L. X.,
C. T. Ruland,
D. W. Stephens,
A. C. Black, and J. D. Rosenblatt.
1996.
Human T-cell leukemia virus type 2 Rex inhibits pre-mRNA splicing in vitro at an early stage of spliceosome formation.
J. Virol.
70:5511-5518[Abstract/Free Full Text].
|
| 5.
|
Ballaun, C.,
G. R. Farrington,
M. Dobrovnik,
J. Rusche,
J. Hauber, and E. Bohnlein.
1991.
Functional analysis of human T-cell leukemia virus type I Rex-response element: direct RNA binding of Rex protein correlates with in vivo binding activity.
J. Virol.
65:4408-4413[Abstract/Free Full Text].
|
| 6.
|
Black, A. C.,
C. T. Ruland,
M. T. Yip,
J. Luo,
B. Tran,
A. Kalsi,
E. Quan,
I. S. Y. Chen, and J. D. Rosenblatt.
1991.
Human T-cell leukemia virus type II Rex binding and activity requires an intact splice donor site and a specific RNA secondary structure.
J. Virol.
65:6545-6653.
|
| 7.
|
Bogerd, H. P.,
G. L. Huckaby,
Y. F. Ahmed,
S. M. Hanly, and W. C. Greene.
1991.
The type 1 human T-cell leukemia virus (HTLV-I) Rex trans-activator binds directly to the HTLV-I Rex and the type 1 human immunodeficiency virus Rev RNA response elements.
Proc. Natl. Acad. Sci. USA
88:5704-5708[Abstract/Free Full Text].
|
| 8.
|
Cann, A. J.,
Y. Koyanagi, and I. S. Y. Chen.
1988.
High efficiency transfection of primary human lymphocytes and studies of gene expression.
Oncogene
3:123-128.
|
| 9.
|
Cann, A. J.,
J. D. Rosenblatt,
W. Wachsman,
N. P. Shah, and I. S. Y. Chen.
1985.
Identification of the gene responsible for human T-cell leukemia virus transcriptional regulation.
Nature
318:571-574[Medline].
|
| 10.
|
Chomczynski, P.
1993.
A reagent for the single step simultaneous isolation of RNA, DNA, and proteins from cell and tissue samples.
BioTechniques
15:532-537[Medline].
|
| 11.
|
Cullen, B.
1986.
Trans-activation of human immunodeficiency virus occurs via a bimodal mechanism.
Cell
46:973-982[Medline].
|
| 12.
|
Cullen, B. R.
1992.
Mechanism of action of regulatory proteins encoded by complex retroviruses.
Microbiol. Rev.
56:375-394[Abstract/Free Full Text].
|
| 13.
|
D'Agostino, D.,
B. Felber,
J. Harrison, and G. Pavlakis.
1992.
The Rev protein of human immunodeficiency virus type 1 promotes polysomal association and translation of gag/pol and vpu/env mRNAs.
Mol. Cell. Biol.
12:1375-1386[Abstract/Free Full Text].
|
| 14.
|
Favaro, J. P., and S. J. Arrigo.
1997.
Characterization of Rev function using subgenomic and genomic constructs in T and COS cells.
Virology
228:29-38[Medline].
|
| 15.
|
Felber, B. K.,
H. Paskalis,
C. Kleinman-Ewing,
F. Wong-Staal, and G. N. Pavlakis.
1985.
The pX protein of HTLV-I is a transcriptional activator of its long terminal repeats.
Science
229:675-679[Abstract/Free Full Text].
|
| 16.
|
Franklin, A. A., and J. K. Nyborg.
1995.
Mechanisms of Tax regulation of human T-cell leukemia virus type I gene expression.
J. Biomed. Sci.
2:17-29[Medline].
|
| 17.
|
Goh, W. C.,
J. Sodroski,
C. Rosen,
M. Essex, and W. A. Haseltine.
1985.
Subcellular localization of the product of the long open reading frame of human T-cell leukemia virus type I.
Science
227:1227-1228[Abstract/Free Full Text].
|
| 18.
|
Grassmann, R.,
S. Berchtolds,
I. Radant,
M. Alt,
B. Fleckenstein,
J. G. Sodroski,
W. A. Haseltine, and U. Ramstedt.
1992.
Role of the human T-cell leukemia virus type 1 X region proteins in immortalization of primary human lymphocytes in culture.
J. Virol.
66:4570-4575[Abstract/Free Full Text].
|
| 19.
|
Green, P. L., and I. S. Y. Chen.
1994.
Molecular features of the human T-cell leukemia virus: mechanisms of transformation and leukemogenicity, p. 227-311.
In
J. A. Levy (ed.), The Retroviridae, vol. 3. Plenum Press, New York, N.Y.
|
| 20.
|
Green, P. L.,
T. M. Ross,
I. S. Y. Chen, and S. Pettiford.
1995.
Human T-cell leukemia virus type II nucleotide sequences between env and the last exon of tax/rex are not required for viral replication or cellular transformation.
J. Virol.
69:387-394[Abstract].
|
| 21.
|
Green, P. L.,
Y. Xie, and I. S. Y. Chen.
1990.
The internal methionine codons of the human T-cell leukemia virus type-II rex gene are not required for p24Rex production or virus replication and transformation.
J. Virol.
64:4914-4921[Abstract/Free Full Text].
|
| 22.
|
Green, P. L.,
M. T. Yip,
Y. Xie, and I. S. Y. Chen.
1992.
Phosphorylation regulates RNA binding by the human T-cell leukemia virus Rex protein.
J. Virol.
66:4325-4330[Abstract/Free Full Text].
|
| 23.
|
Gröne, M.,
C. Koch, and R. Grassmann.
1996.
The HTLV-1 Rex protein induces nuclear accumulation of unspliced viral RNA by avoiding intron excision and degradation.
Virology
218:316-325[Medline].
|
| 24.
|
Hanly, S. M.,
L. T. Rimsky,
M. H. Malim,
J. H. Kim,
J. Hauber,
M. Duc Dodon,
S.-Y. Le,
J. V. Maizel,
B. R. Cullen, and W. C. Greene.
1989.
Comparative analysis of the HTLV-I Rex and HIV-1 Rev trans-regulatory proteins and their RNA response elements.
Genes Dev.
3:1534-1544[Abstract/Free Full Text].
|
| 25.
|
Haseltine, W. A.,
J. Sodroski,
R. Patarca,
D. Briggs,
D. Perkins, and F. Wong-Staal.
1984.
Structure of 3' terminal region of type II human T lymphotropic virus: evidence of new coding region.
Science
225:419-421[Abstract/Free Full Text].
|
| 26.
|
Inoue, J.,
M. Itoh,
T. Akizawa,
H. Toyoshima, and M. Yoshida.
1991.
HTLV-1 Rex protein accumulates unspliced RNA in the nucleus as well as in cytoplasm.
Oncogene
6:1753-1757[Medline].
|
| 27.
|
Inoue, J. I.,
M. Yoshida, and M. Seiki.
1987.
Transcriptional (p40x) and post-transcriptional (p27xIII) regulators are required for the expression and replication of human T-cell leukemia virus type I genes.
Proc. Natl. Acad. Sci. USA
84:3653-3657[Abstract/Free Full Text].
|
| 28.
|
Jin, D. Y.,
F. Spencer, and K. T. Jeang.
1998.
Human T-cell leukemia virus type 1 oncoprotein Tax targets the human mitotic checkpoint protein MAD1.
Cell
93:1-20[Medline].
|
| 29.
|
Kiyokawa, T.,
M. Seiki,
S. Iwashita,
K. Imagawa,
F. Shimizu, and M. Yoshida.
1985.
p27xIII and p21xIII proteins encoded by the pX sequence of human T-cell leukemia virus type I.
Proc. Natl. Acad. Sci. USA
82:8359-8363[Abstract/Free Full Text].
|
| 30.
|
Lee, T. H.,
J. E. Coligan,
J. G. Sodroski,
W. A. Haseltine,
S. Z. Salahuddin,
F. Wong-Staal,
R. C. Gallo, and M. Essex.
1984.
Antigens encoded by the 3'-terminal region of human T-cell leukemia virus: evidence for a functional gene.
Science
226:57-61[Abstract/Free Full Text].
|
| 31.
|
Low, K. G.,
L. F. Dorner,
D. B. Fernando,
J. Grossman,
K. T. Jeang, and M. J. Comb.
1997.
Human T-cell leukemia virus type I Tax releases cell cycle arrest induced by p16INK4a.
J. Virol.
71:1956-1962[Abstract].
|
| 32.
|
Ross, T. M.,
S. M. Pettiford, and P. L. Green.
1996.
The tax gene of human T-cell leukemia virus type 2 is essential for transformation of human T lymphocytes.
J. Virol.
70:5194-5202[Abstract/Free Full Text].
|
| 33.
|
Schneider, U.,
H. Schwenk, and G. Bornkamm.
1977.
Characterization of EBV genome-negative "null" and T cell lines derived from children with acute lymphoblastic leukemia and leukemic transformed non-Hodgkins lymphoma.
Int. J. Cancer
19:621-626[Medline].
|
| 34.
|
Seiki, M.,
S. Hattori,
Y. Hirayama, and M. Yoshida.
1983.
Human T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA.
Proc. Natl. Acad. Sci. USA
80:3618-3622[Abstract/Free Full Text].
|
| 35.
|
Seiki, M.,
J. Inoue,
T. Takeda, and M. Yoshida.
1986.
Direct evidence that p40xI of human T-cell leukemia virus type I is a trans-acting transcriptional activator.
EMBO J.
5:561-565[Medline].
|
| 36.
|
Shimotohno, K.,
Y. Takahashi,
N. Shimizu,
T. Goiobori,
I. S. Y. Chen,
D. W. Golde,
M. Miwa, and T. Sugimura.
1985.
Complete nucleotide sequence of an infectious clone of human T-cell leukemia virus type I and type II long terminal repeats for trans-activation of transcription.
Proc. Natl. Acad. Sci. USA
82:3101-3105[Abstract/Free Full Text].
|
| 37.
|
Shimotohno, K.,
W. Wachsman,
Y. Takahashi,
D. W. Golde,
M. Miwa,
T. Sugimura, and I. S. Y. Chen.
1984.
Nucleotide sequence of the 3' region of an infectious human T-cell leukemia virus type II genome.
Proc. Natl. Acad. Sci. USA
81:6657-6661[Abstract/Free Full Text].
|
| 38.
|
Slamon, D. J.,
W. J. Boyle,
D. E. Keith,
M. F. Press,
D. W. Golde, and L. M. Souza.
1988.
Subnuclear localization of the trans-acting protein of human T-cell leukemia virus type I.
J. Virol.
62:680-686[Abstract/Free Full Text].
|
| 39.
|
Sodroski, G. J.,
C. A. Rosen, and W. A. Haseltine.
1984.
Trans-acting transcriptional activation of the long terminal repeat of human T-lymphotropic viruses in infected cells.
Science
225:381-385[Abstract/Free Full Text].
|
| 40.
|
Yip, M. T.,
W. S. Dynan,
P. L. Green,
A. C. Black,
S. J. Arrigo,
A. Torbati,
S. Heaphy,
C. Ruland,
J. D. Rosenblatt, and I. S. Y. Chen.
1991.
Human T-cell leukemia virus (HTLV) type II Rex protein binds specifically to RNA sequences of the HTLV long terminal repeat but poorly to the human immunodeficiency virus type 1 Rev-responsive element.
J. Virol.
65:2261-2272[Abstract/Free Full Text].
|
Journal of Virology, October 1999, p. 8112-8119, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Groom, H. C. T., Anderson, E. C., Lever, A. M. L.
(2009). Rev: beyond nuclear export. J. Gen. Virol.
90: 1303-1318
[Abstract]
[Full Text]
-
Xie, L., Kesic, M., Yamamoto, B., Li, M., Younis, I., Lairmore, M. D., Green, P. L.
(2009). Human T-Cell Leukemia Virus Type 2 Rex Carboxy Terminus Is an Inhibitory/Stability Domain That Regulates Rex Functional Activity and Viral Replication. J. Virol.
83: 5232-5243
[Abstract]
[Full Text]
-
Arnold, J., Zimmerman, B., Li, M., Lairmore, M. D., Green, P. L.
(2008). Human T-cell leukemia virus type-1 antisense-encoded gene, Hbz, promotes T-lymphocyte proliferation. Blood
112: 3788-3797
[Abstract]
[Full Text]
-
Arnold, J., Yamamoto, B., Li, M., Phipps, A. J., Younis, I., Lairmore, M. D., Green, P. L.
(2006). Enhancement of infectivity and persistence in vivo by HBZ, a natural antisense coded protein of HTLV-1. Blood
107: 3976-3982
[Abstract]
[Full Text]
-
Xie, L., Yamamoto, B., Haoudi, A., Semmes, O. J., Green, P. L.
(2006). PDZ binding motif of HTLV-1 Tax promotes virus-mediated T-cell proliferation in vitro and persistence in vivo. Blood
107: 1980-1988
[Abstract]
[Full Text]
-
Younis, I., Yamamoto, B., Phipps, A., Green, P. L.
(2005). Human T-Cell Leukemia Virus Type 1 Expressing Nonoverlapping Tax and Rex Genes Replicates and Immortalizes Primary Human T Lymphocytes but Fails To Replicate and Persist In Vivo. J. Virol.
79: 14473-14481
[Abstract]
[Full Text]
-
Younis, I., Khair, L., Dundr, M., Lairmore, M. D., Franchini, G., Green, P. L.
(2004). Repression of Human T-Cell Leukemia Virus Type 1 and Type 2 Replication by a Viral mRNA-Encoded Posttranscriptional Regulator. J. Virol.
78: 11077-11083
[Abstract]
[Full Text]
-
Narayan, M., Younis, I., D'Agostino, D. M., Green, P. L.
(2003). Functional Domain Structure of Human T-Cell Leukemia Virus Type 2 Rex. J. Virol.
77: 12829-12840
[Abstract]
[Full Text]
-
Ye, J., Silverman, L., Lairmore, M. D., Green, P. L.
(2003). HTLV-1 Rex is required for viral spread and persistence in vivo but is dispensable for cellular immortalization in vitro. Blood
102: 3963-3969
[Abstract]
[Full Text]
-
Ye, J., Xie, L., Green, P. L.
(2003). Tax and Overlapping Rex Sequences Do Not Confer the Distinct Transformation Tropisms of Human T-Cell Leukemia Virus Types 1 and 2. J. Virol.
77: 7728-7735
[Abstract]
[Full Text]
-
Zhang, W., Nisbet, J. W., Albrecht, B., Ding, W., Kashanchi, F., Bartoe, J. T., Lairmore, M. D.
(2001). Human T-Lymphotropic Virus Type 1 p30II Regulates Gene Transcription by Binding CREB Binding Protein/p300. J. Virol.
75: 9885-9895
[Abstract]
[Full Text]
-
Narayan, M., Kusuhara, K., Green, P. L.
(2001). Phosphorylation of Two Serine Residues Regulates Human T-Cell Leukemia Virus Type 2 Rex Function. J. Virol.
75: 8440-8448
[Abstract]
[Full Text]
-
Ding, W., Albrecht, B., Luo, R., Zhang, W., Stanley, J. R. L., Newbound, G. C., Lairmore, M. D.
(2001). Endoplasmic Reticulum and cis-Golgi Localization of Human T-Lymphotropic Virus Type 1 p12I: Association with Calreticulin and Calnexin. J. Virol.
75: 7672-7682
[Abstract]
[Full Text]
-
Richard, V., Lairmore, M. D., Green, P. L., Feuer, G., Erbe, R. S., Albrecht, B., D'Souza, C., Keller, E. T., Dai, J., Rosol, T. J.
(2001). Humoral Hypercalcemia of Malignancy : Severe Combined Immunodeficient/Beige Mouse Model of Adult T-Cell Lymphoma Independent of Human T-Cell Lymphotropic Virus Type-1 Tax Expression. Am. J. Pathol.
158: 2219-2228
[Abstract]
[Full Text]
-
Neumann, M, Afonina, E, Ceccherini-Silberstein, F, Schlicht, S, Erfle, V, Pavlakis, G., Brack-Werner, R
(2001). Nucleocytoplasmic transport in human astrocytes: decreased nuclear uptake of the HIV Rev shuttle protein. J. Cell Sci.
114: 1717-1729
[Abstract]