Previous Article | Next Article 
Journal of Virology, October 1999, p. 8064-8072, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Naturally Occurring Mutations within 39 Amino Acids
in the Envelope Glycoprotein of Maedi-Visna Virus Alter the
Neutralization Phenotype
Robert
Skraban,1
Sigrídur
Matthíasdóttir,1
Sigurbjörg
Torsteinsdóttir,1
Gudrún
Agnarsdóttir,1
Bjarki
Gudmundsson,1
Gudmundur
Georgsson,1
Rob H.
Meloen,2
Ólafur S.
Andrésson,1
Katherine A.
Staskus,3
Halldor
Thormar,4 and
Valgerdur
Andrésdóttir1,*
Institute for Experimental Pathology,
University of Iceland, Keldur,1 and
Institute of Biology, University of Iceland,
Reykjavík,4 Iceland; Institute
for Animal Science and Health, 8200 AB Lelystad, The
Netherlands2; and Department of
Microbiology, University of Minnesota, Minneapolis, Minnesota
554553
Received 27 April 1999/Accepted 25 June 1999
 |
ABSTRACT |
Infectious molecular clones have been isolated from two maedi-visna
virus (MVV) strains, one of which (KV1772kv72/67) is an antigenic
escape mutant of the other (LV1-1KS1). To map the type-specific neutralization epitope, we constructed viruses containing chimeric envelope genes by using KV1772kv72/67 as a backbone and replacing various parts of the envelope gene with equivalent sequences from LV1-1KS1. The neutralization phenotype was found to map to a region in
the envelope gene containing two deletions and four amino acid changes
within 39 amino acids (positions 559 to 597 of Env). Serum obtained
from a lamb infected with a chimeric virus, VR1, containing only the 39 amino acids from LV1-1KS1 in the KV1772kv72/67 backbone neutralized
LV1-1KS1 but not KV1772kv72/67. The region in the envelope gene that we
had thus shown to be involved in escape from neutralization was cloned
into pGEX-3X expression vectors, and the resulting fusion peptides from
both molecular clones were tested in immunoblots for reactivity with
the KV1772kv72/67 and VR1 type-specific antisera. The type-specific
KV1772kv72/67 antiserum reacted only with the fusion peptide from
KV1772kv72/67 and not with that from LV1-1KS1, and the type-specific
VR1 antiserum reacted only with the fusion peptide from LV1-1KS1 and
not with that from KV1772kv72/67. Pepscan analysis showed that the
region contained two linear epitopes, one of which was specific to each
of the molecularly cloned viruses. This linear epitope was not bound by
all type-specific neutralizing antisera, however, which indicates that
it is not by itself the neutralization epitope but may be a part of it.
These findings show that mutations within amino acids 559 to 597 in the
envelope gene of MVV virus result in escape from neutralization.
Furthermore, the region contains one or more parts of a discontinuous
neutralization epitope.
| |
INTRODUCTION |
Maedi-visna virus (MVV) is a member
of the lentivirus subgroup of retroviruses (40, 41). This
virus causes slowly progressive diseases that affect mainly the central
nervous system and the lungs of sheep (reviewed in reference
14). The primary target cells of MVV infection are
cells of the monocyte/macrophage lineage, and virus gene expression is
activated upon macrophage maturation (12, 28). In MVV
infection, type-specific neutralizing antibodies appear after 1 to 6 months, and in most sheep other more broadly neutralizing antibodies
appear up to 3 years later. A similar pattern has been found in human
immunodeficiency virus (HIV) infection. Domains in the envelope
glycoprotein that induce virus-neutralizing antibodies in HIV-1
infection have been well characterized (16, 20, 25, 45, 48).
The type-specific antibodies which arise shortly after infection are
directed mainly against the V3 loop (29, 33).
The ability of viruses to escape neutralization has been described for
various lentivirus systems. There have been several reports on the
emergence of HIV-1 neutralization escape mutants, both in vitro and in
vivo (1, 10, 23). Most of these escape mutants have
mutations that map in the V3 loop (10, 26, 51). The major
neutralizing epitopes in simian immunodeficiency virus (SIV) are
thought to be conformational or discontinuous, and it has been shown
that the V3-corresponding region of SIVmac does not serve as a target
of neutralizing antibodies (18). Neutralization-resistant variants of SIV have been mapped in the V4 region of the SIV envelope glycoprotein (7, 19). In feline immunodeficiency virus
(FIV), a single amino acid substitution in V5 of the envelope protein allows escape from virus neutralization (38).
Many studies have demonstrated the occurrence of
neutralization-resistant mutants during long-term MVV infection of
sheep (17, 21, 27, 46). The characterization of these
mutants was, however, hampered by the lack of molecular clones. In this study we have used two molecular clones of MVV which elicit a different
neutralization response. The two molecular clones, KV1772kv72/67 and
LV1-1KS1, differ by 22 amino acids, and there are two deletions in the
envelope gene in strain KV1772kv72/67 (3, 44).
To identify the type-specific neutralization epitope, we constructed
recombinant viruses in which env sequences of strain KV1772kv72/67 were replaced by those of strain LV1-1KS1. The
neutralization phenotype was transferred with a fragment from the
envelope gene containing two deletions and four amino acid changes
within 39 amino acids (aa 559 to 597).
| |
MATERIALS AND METHODS |
Virus, cells, and sera.
The molecularly cloned virus
KV1772kv72/67 is derived from visna virus KV1772, which was selected
for neurovirulence by serial passage of strain K1514 in sheep (13,
22). The molecularly cloned virus LV1-1KS1 was reported to be
derived from K1514 (44), but sequencing data from a number
of virus isolates indicates that it is most closely related to K796, a
virus appearing early in the lineage of visna virus strains (see Fig.
2).
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic presentation of the construction of chimeric
MVV clone VR1 (see the text for details). The sheep flanking sequence
is indicated by a bold zigzag line, and the vector is indicated by a
thin zigzag line. Restriction enzyme cleavage sites are indicated as
follows: X, XbaI; St, StuI; H, HincII;
S, StyI; B, BamHI.
|
|
Sheep choroid plexus (SCP) cells established as described previously
(31, 42) were grown at 37°C in a humidified atmosphere of
5% CO2 in Dulbecco's minimal essential medium (Gibco)
supplemented with 2 mM glutamine, 100 IU of penicillin per ml, 100 IU
of streptomycin per ml and either 10% normal lamb serum (growth
medium) or 1% lamb serum (maintenance medium). Macrophage cultures
were established as follows. Heparinized blood (100 ml) was collected
from normal sheep, and peripheral blood mononuclear cells obtained by
sedimentation on Histopaque-1077 (Sigma) were washed repeatedly in
phosphate-buffered saline and resuspended at 12 × 106
cells/ml in growth medium supplemented with 5 × 10
5
M mercaptoethanol. They were then seeded into plastic four-chamber (1-ml) tissue culture slides (180 mm2; Permanox, Nunc Inc.)
or into 24-well plates. After incubation at 37°C in a humidified
atmosphere of 5% CO2 for 24 h, supernatant and
unattached cells were removed, the slide was washed twice with
phosphate-buffered saline, and 1 ml of new growth medium was added to
each chamber. Adherent cells were further incubated for at least 7 days
before they were infected.
Transfections were performed by using subconfluent monolayers of ovine
fetal synovial (FOS) cells. DNA was transfected with
Lipofectamine as
specified by the manufacturer (Life Sciences,
Inc.). Transfected FOS
cells were passaged (1:3 split) and incubated
in maintenance medium
until syncytia appeared (5 to 8 days). Supernatants
from transfected
cells were also tested for the presence of reverse
transcriptase (RT)
activity before passage into SCP
cells.
The sera used for immunoblots and pepscan were the following: serum
21372 from sheep 1923 after 26 weeks of infection with
KV1772kv72/67,
serum 21160 from sheep 1923 preinfection, serum
20494 from sheep 1896 after 8 weeks of infection with KV1772kv72/67
(this serum neutralized
KV1772kv72/67 at a titer of 2,048 to 4,096
but did not neutralize
LV1-1KS1), serum 20464 from sheep 1896
preinfection, serum 22156 from
sheep 1998 after 16 weeks of infection
with VR1, and serum 22077 from
sheep 1998 preinfection. The KV1772kv72/67
type-specific antiserum used
for neutralization was serum 20494
from sheep
1896.
RT assay.
Viral particles from 0.5 ml of cell-free
supernatants from infected cells were pelleted at 70,000 rpm for 10 min
in a Beckman TLA 100.4 rotor. RT activity was determined as described
previously (49).
Virus neutralization test.
Virus (100 50% tissue culture
infective doses [TCID50]) was mixed with serial twofold
dilutions of serum in DMEM with 2% lamb serum. The samples were
incubated at room temperature for 24 h and then inoculated in
quadruplicate onto monolayers of SCP cells in 96-well tissue culture
plates (Nunc) and kept at 37°C in a humidified atmosphere of 5%
CO2. Cytopathic effect was monitored after 7, 14, 21, and
28 days. The neutralization titer was calculated as the reciprocal of
the serum dilution which caused complete neutralization in 50% of
inoculated cultures. In macrophages, neutralization was assayed by
infecting 24-well plates containing blood-derived macrophages with 100 TCID50 of virus mixed with twofold dilutions of serum, four
wells for each dilution. Growth was monitored by measuring RT activity
in parallel cultures without antiserum; at two time points at maximum
RT activity, all the samples were assayed for RT.
Generation of a clone containing chimeric env
gene.
The construction of chimeric molecular clone VR1 is
schematically presented in Fig. 1. The 5' sector of KV1772kv72/67 in
Bluescript II (Stratagene), called p8XSp5, was used in the first
subcloning step. This clone contains an XbaI fragment of the
KV1772kv72/67 visna virus clone, including 1.5 kb of cellular flanking
sequences and the 5' long terminal repeat through nucleotide (nt) 7768 (4) (Fig. 1A). This plasmid contains a unique
StuI site in the cellular flanking sequence about 700 nt
upstream from the 5' long terminal repeat. The StuI- and
XbaI-generated fragment was subcloned into HincII- and XbaI-digested BluescriptII to
eliminate the HincII site. This clone was named p8XSp5-RK1
(Fig. 1B), and from it a HincII (nt 6393)-XbaI
(nt 7768) fragment was generated and subcloned into HincII-
and XbaI-digested pUC19 (pRK2). PCR was performed to amplify
the segment from the LV1-1KS1 clone containing a StyI (nt
7614) site and an XbaI (nt 7768) site. The amplified
fragment was digested with StyI and XbaI, and the
154-bp fragment was isolated on 4% MetaPhor agarose (FMC BioProducts)
and subcloned into StyI- and XbaI-digested pUC19
clone pRK2 to generate subclone pRK3. From this clone, the
HincII-XbaI fragment was excised and subcloned into HincII- and XbaI-digested p8XSp5-RK1, to
construct a chimeric kv72 clone with an LV1-1KS1
StyI-XbaI fragment (pRK4) (Fig. 1C). This clone
was mixed in equimolar quantities with the 3' clone of KV1772kv72/67 in
BluescriptII, called p67r (4), digested with
XbaI, and ligated. The full-length viral DNA with a chimeric env gene, named VR1, was transfected into FOS cells as
described above. When RT activity could be measured (5 to 8 days),
culture supernatant was transferred to SCP cells, virus progeny were
collected, and proviral DNA was PCR amplified with
env-specific primers, which were biotinylated to allow
direct solid-phase sequencing (Dynal) to confirm the origin of the
virus. Intermediate clone constructs were also confirmed by sequence
analysis. The clones VB1, VB5, and VR2 were constructed in a similar
way by using the restriction sites indicated in Fig. 4.
Construction of pGEX-3X-GST fusion peptide expression
vectors.
The env gene fragment between nt 7499 and 7793 from clones LV1-1KS1 and KV1772kv72/67 was amplified by 30 cycles of
PCR with the following thermal profile: denaturing at 94°C for
30 s, annealing at 55°C for 15 s, and extension at 72°C
for 90 s. The forward primer was
5'GCGGGATCCAAAATAGCACCATAACAGGAA3', and the
reverse primer was 5'CCGGAATTCTGGTATCGYTGCACYAACAT3'.
The primers provide BamHI and EcoRI cloning
sites (underlined) for cloning the KV1772kv72/67 and LV1-1KS1 PCR
products in frame with glutathione S-transferase (GST) of
the pGEX-3X expression vector. The presence of correct inserts was
confirmed by sequence analysis. Expression of GST fusion peptides
followed standard procedures (4).
Immunoblotting.
Immunoblotting was performed with the
Mini-proteanII system (Bio-Rad) as specified by the manufacturer.
Dilutions of fusion peptides were boiled, diluted 1:1 in Laemmli sample
buffer (125 mM Tris buffer supplemented with 5% mercaptoethanol and
2% sodium dodecyl sulfate [SDS] [pH 6.8]) and separated by
SDS-polyacrylamide gel electrophoresis. Half of the gels were used for
silver staining (Bio-Rad) to determine the sizes and amounts of
peptides, and half were transferred to a nitrocellulose membrane in 25 mM Tris glycine buffer (pH 8.8) containing 20% methanol. Transfer of
the fusion peptides was carried out for 60 min at 200 V and 1.2 mA/cm2 in a Milliblot graphite electroblotter I
(Millipore). After the transfer, the nitrocellulose membranes were
blocked for 1 h at room temperature with 0.1 M Tris-HCl-buffered
saline (pH 7.8) containing 0.5% Tween 20. The sera and conjugate were
diluted in 0.1 M Tris-HCl-buffered saline (pH 7.8) containing 0.1%
Tween 20 (TBS-T). After the blocking step, the nitrocellulose membranes were washed once with TBS-T and incubated overnight at 4°C on a
roller with serum samples at a dilution 1/500. Rabbit anti-goat immunoglobulin G conjugated to horseradish peroxidase (Sigma A4174) at
a dilution of 1/10,000 was added for 1 h at room temperature. The
blots were washed extensively in TBS-T between each step. The enhanced
chemiluminescence system from Amersham was used for developing the blots.
Pepscan analysis.
Peptides were synthesized on polyethylene
rods and tested for their reactivity with antisera in an enzyme-linked
immunosorbent assay by established procedures (15).
Twelve-mer peptides were synthesized and tested for reactivity to the
sera at a 1:250 dilution.
| |
RESULTS |
Generation of chimeric virus.
The two molecular clones used in
this study both have their origin in a transmission experiment where
virus was passaged serially through tissue culture and sheep (Fig.
2). The LV1-1KS1 clone was derived from
strain K796, but the KV1772kv72/67 molecular clone is a derivative of
strain K1772, a descendant of strain K1010, which is a neutralization
escape mutant of strain K796 (17). The molecularly cloned
viruses retained the neutralization phenotypes of their parental
strains. The envelope proteins derived from the two molecular clones
differ by 22 amino acids and two deletions of 5 and 1 amino acids (Fig.
3). For mapping the type-specific neutralization epitope, four recombinants were constructed by using
restriction fragments from the env gene of LV1-1KS1 with KV1772kv72/67 as a backbone. All recombinant viruses were tested for
neutralization by KV1772kv72/67 type-specific antiserum (Fig. 4). The KV1772kv72/67 type-specific
antiserum neutralized the KV1772kv72/67 virus very efficiently at a
dilution of 1:2,048, whereas it did not neutralize LV1-1KS1 at a
dilution of 1:8. The XbaI-SacI region of the
envelope gene comprising the carboxyl end of SU and the TM protein did
not affect neutralization (recombinant VB5), and although sequences in
front of the StyI site at nt 7613 influenced the
neutralization (recombinant VR2), mutations in the region between
StyI at nt 7613 and XbaI at nt 7768 were
necessary and sufficient to abolish neutralization (recombinants VB1
and VR1).
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Lineage of MVV strains following passage through sheep
and tissue culture (T.C.). The origin of the molecular clones
KV1772kv72/67 and LV1-1KS1 is given in this diagram.
|
|
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 3.
Comparison of the amino acid sequences of the envelope
genes of the two molecularly cloned MVV strains, KV1772kv72/67 and
LV1-1KS1. Dots represent identical amino acids, and dashes represent
deletions. The proteolytic cleavage site between SU and TM is indicated
by an arrow.
|
|
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 4.
Diagrammatic representation of recombinant maedi-visna
viruses derived from the molecular clones KV1772kv72/67 and LV1-1KS1.
The restriction sites used to construct the viruses are shown. The
neutralization titer of KV1772kv72/67 type-specific antiserum for each
virus is shown on the right.
|
|
Infection of lambs with the chimeric virus.
Two lambs (animals
1997 and 1998) were infected intracerebrally with the recombinant virus
VR1. Both lambs became infected, as evidenced by frequent virus
isolations and strong antibody responses to the virus. Both lambs
seroconverted within 6 weeks, and one of the lambs (animal 1998)
acquired a high titer of neutralizing antibodies to the inoculated
virus. Serum was collected biweekly for the first 8 weeks, and every 4 weeks thereafter until sacrifice at 28 weeks postinfection. The two
parental virus strains and the recombinant virus were tested for
neutralization by antiserum obtained from lamb 1998. Neutralizing
antibodies against the infecting virus, VR1, appeared after 6 weeks,
and its level stayed high till the end of the experiment. LV1-1KS1 was
neutralized almost to the same extent as VR1, whereas KV1772kv72/67 was
not neutralized (Fig. 5). We have thus
shown that the specific neutralization phenotype resides in one or more
of the four substitutions and two deletions that were transferred.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
Neutralization titers of serial antisera from sheep 1998 (infected with the recombinant virus VR1). The neutralization titer was
determined as described in Materials and Methods.
|
|
Growth of chimeric virus in macrophages.
The progeny of the
molecular clone LV1-1KS1 grow less efficiently in macrophages than do
the progeny of the molecular clone KV1772kv72/67 (47). We
tested the growth of the chimeric virus in macrophages to test whether
there was a linkage between macrophage tropism and neutralization
specificity. Figure 6 shows the growth curves of the two parent strains and the chimeric virus in macrophages. The impaired replication of strain LV1-1KS1 in macrophages was not
transferred with the 39-amino-acid fragment.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
Growth curves of the two parental strains KV1772kv72/67
and LV1-1KS1 and the chimeric virus VR1 in sheep monocyte-derived
macrophages as measured by RT activity. p.i., postinfection.
|
|
Neutralization of macrophage-grown virus with type-specific
antiserum.
The neutralization specificity of the antisera was
routinely determined by using SCP cells as a host system. However,
macrophages are considered to be the natural target cells for MVV. We
therefore tested the specificity of the antisera on viruses grown in
macrophages. The virus strains KV1772kv72/67 and VR1 were passed twice
in macrophages, and neutralization assays were carried out with serial
twofold dilutions of antiserum obtained from sheep infected with VR1. The VR1 antiserum neutralized the infecting strain up to a dilution of
4,000 to 8,000 in macrophages as well as in SCP cells. Strain KV1772kv72/67 was not neutralized (Fig.
7).
View larger version (12K):
[in this window]
[in a new window]
|
FIG. 7.
Neutralization of macrophage-grown virus with twofold
serial dilutions of VR1 type-specific antiserum.
|
|
Reactivity of MVV-specific antisera to GST fusion peptides derived
from the two molecular clones, KV1772kv72/67 and LV1-1KS1.
A
293-bp stretch from both parental strains, covering the region where
the neutralization epitope mapped, was cloned in a pGEX3X expression
vector (the region is indicated in Fig.
8). The production of fusion peptides was
examined by silver staining of SDS-polyacrylamide gels and by using
rabbit antiserum to GST on Western blots. Low levels of fusion peptides
were obtained, and these proved to be quite unstable. Expression of a
38.5-kDa peptide, consistent with the predicted size, was observed, as was a series of partial proteolytic fragments. The KV1772kv72/67 and
LV1-1KS1 fusion peptides can be distinguished by their size, since the
KV1772kv72/67 fusion peptide is 6 amino acids (approximately 5%)
smaller (Fig. 9A). Antiserum from a
sheep infected with KV1772kv72/67 reacted with the fusion peptide from
KV1772kv72/67 in immunoblots, whereas it did not bind to the
LV1-1KS1 fusion peptide. With a VR1 type-specific antiserum, which
neutralized LV1-1KS1 and VR1 but not KV1772kv72/67, the reverse was
true. This antiserum bound to the LV1-1KS1 fusion peptide but only
weakly to KV1772kv72/67 (Fig. 9B and C). No reaction was seen with
preinfection sera (data not shown). The region in the Env glycoproteins
defined by these peptides thus contains B-cell epitopes that are
differentially recognized by type-specific antisera.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 8.
Amino acid sequences from the two strains KV1772kv72/67
and LV1-1KS1 of the region cloned into GEX vectors. Dots indicate
identical amino acids; dashes indicate deletions. The region that was
exchanged between the two clones is indicated by boldface letters.
|
|
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 9.
Western blots of the GST fusion peptides with different
sera. Lanes: 1, GST; 2, KV1772kv72/67-GST fusion peptide; 3, LV1-1KS1-GST fusion peptide. (A) Rabbit antiserum to GST; (B)
KV1772kv72/67 type-specific serum (sheep 1998, 23 weeks postinfection);
(C) VR1 type-specific serum; (D) KV1772kv72/67 serum with a high
neutralization titer. The size of the fusion peptides (approximately 40 kDa) is indicated by the arrow.
|
|
The fusion peptides were also reacted with antiserum from a sheep that
was infected with strain KV1772kv72/67 and had developed
a strong
neutralization antibody response by 8 weeks after infection.
This
antiserum showed only a very faint reaction to the KV1772kv72/67
fusion
peptide (Fig.
9D). It therefore appears that the species-specific
linear epitope(s) in this region is not identical to the neutralization
epitope.
A pepscan analysis clarified these results further. Twelve-mer peptides
with an overlapping sequence of 11 amino acids were
synthesized. The
amino acid sequences of the peptides corresponded
to the region covered
by the two fusion peptides, starting with
peptides TTMWNIYQNCSK and
TTMWNIYQNCSR for LV1-1KS1 and KV1772kv72/67,
respectively
(starting at aa 529 [Fig.
8]). The 12-mer peptides
were analyzed for
reactivity with the sera used for the Western
blots. Serum from the
sheep infected with the chimeric virus VR1
revealed two linear epitopes
on the LV1-1KS1 peptide, with the
core sequences TVNDLK and KGSRR (Fig.
10). The corresponding sequences
of the
KV1772kv72/67 peptide were TVNNLK and KSQR, respectively.
The latter of
these epitopes was not recognized on the KV1772kv72/67
peptide; it
differs from that of the other strain by one amino
acid substitution
and a deletion of one amino acid. Type-specific
antiserum against
KV1772kv72/67 recognized the former epitope
on the KV1772kv72/67
peptide but not on the LV1-1KS1 peptide.
The sheep had not developed
antibodies against the latter epitope,
however. When the 8-week
antiserum with the high neutralization
titer against KV1772kv72/67 was
tested, there was no reaction
to either of the epitopes (Fig.
10).
These results indicate that
although there are at least two linear
epitopes in the region,
none of them is by itself the neutralization
epitope but may be
a part of it.
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 10.
Pepscan analysis of three sheep sera by using 12-mer
peptides spanning the region of the neutralizing epitope in the two
parental strains (amino acid positions are shown). (A and B) VR1 serum
16 weeks postinfection; (C and D) KV1772kv72/67 serum (sheep 1998) 23 weeks postinfection; (E and F) KV1772kv72 serum (sheep 1896) with a
high neutralization titer 8 weeks postinfection.
|
|
| |
DISCUSSION |
We have demonstrated that mutations in the region between amino
acids 559 and 597 in the outer envelope glycoprotein gene of MVV result
in escape from neutralization and creation of a new type of
neutralization specificity. This is a variable region in the MVV SU
glycoprotein (2, 35) in an analogous position to V4-V5 in
SIV and in FIV (30). Western blots with GST fusion peptides
of this region from two virus strains with different neutralization
specificities and pepscan analysis revealed two linear epitopes in this
region, which were differentially recognized by type-specific antisera.
The absence of antibodies to these epitopes in a sheep that mounted a
very strong type-specific neutralizing response indicates, however,
that neither of the linear epitopes is by itself the neutralization
epitope. It is more likely that one or both of the linear epitopes are
part of a discontinuous neutralization epitope. This conclusion is
supported by the fact that when this region was sequenced in 10 viral
isolates that were antigenic variants, 7 of them had mutations in
either of the linear epitopes, in addition to a few that were mutated
in a potential glycosylation site (2a). We propose that a
disulfide bond between two conserved cysteines is formed. This would
bring the two linear epitopes into proximity (Fig.
11). We have found two antigenic
variants that have one of the cysteines mutated; one of these strains
shows impaired growth in macrophages, and the growth rate of the other
has not been tested (2a). This is further evidence for the
importance of the cysteine in the spatial structure of the protein.
These cysteines are widely conserved in maedi-visna virus strains
(3, 6, 32, 35, 43, 44) and also in caprine
arthritis-encephalitis virus CAEV (34).
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 11.
The region between amino acids 553 and 586 of LV1-1KS1
(numbering as in reference 34). The proposed
disulfide cross bridge between the two conserved cysteines is shown.
The two linear epitopes are indicated by boxes.
|
|
This cysteine loop, which is in the fourth variable region in the
envelope gene of MVV, V4 (34, 35), may have an analogous function to V3 in HIV-1. The V3 loop of HIV-1 gp120 is the major target
for neutralizing antibodies (33), and it is also a
recognition site for coreceptors and a determinant of viral cell
tropism (9, 11, 24). In FIV, the neutralization domain also
seems to determine cell tropism (50). Virus derived from one
of the molecular clones used in this study, LV1-1KS1, grow poorly in
macrophages but very efficiently in SCP cells (47). For this
particular clone of MVV, however, the change in cell tropism is not
related to neutralization, since the poor growth in macrophages was not
transferred with the fragment that contained the part of the
discontinuous neutralization epitope we have mapped in this study, nor
was it transferred with any part of the MVV gp135 (16a).
Several studies have shown that the neutralization sensitivity of
lentivirus antisera often is dependent on the cell type used to
propagate the virus (5, 8, 36, 52). The mechanism for this
is unclear; in some cases several passages in the cell type are needed
for adaptation of the virus, and mutations are probably involved,
whereas in other cases, cell-type-specific neutralization
characteristics are established within a few passages and are
reversible (36). We routinely use SCP cells to propagate the
virus and for neutralization tests. These cells are fibroblast-like cells from the choroid plexus of sheep and are very efficient for
propagating the virus. Macrophages are, however, the target cells for
MVV in vivo. Our finding that the neutralization specificity was
retained when we used macrophages as host cells indicates that SCP
cells are valid for assessing the neutralization specificity.
Our results can best be explained by a discontinuous neutralization
epitope being located, at least in part, in the V4 region of the MVV
env gene. Other regions of the env gene may also
contribute to the neutralization phenotype. Although the changes in the
StyI-XbaI fragment (nt 7613 to 7768) were
necessary and sufficient to abolish neutralization and create a new
neutralization phenotype, amino acid changes in front of this region
also affected neutralization (Fig. 4). Furthermore, when antiserum to
the recombinant virus containing this StyI-XbaI
fragment from LV1-1KS1 in the KV1772kv72/67 backbone was tested, the
titer against the input recombinant virus was consistently 1 to 3 dilutions higher than that for LV1-1KS1 (Fig. 5), indicating that the
neutralization epitope on the recombinant virus was not completely
identical to the epitope on LV1-1KS1. This is further evidence for the
discontinuous nature of the epitope. Discontinuous neutralization
epitopes appear to be common in other lentiviruses. Although
neutralizing activity can be induced by synthetic linear peptides from
the V3 loop in HIV-1 (29), the initial type-specific
neutralizing antibodies in HIV-1 infection are directed mainly against
a discontinuous epitope in the V3 loop (25, 37). Also, in
SIV and FIV, antigenic variants are found to map in discontinuous
epitopes in the V4-V5 region (7, 18, 19, 39). The cellular
receptor(s) for MVV has not been determined, but by analogy to HIV-1,
it is reasonable to suggest that the V4 region defines a binding site
for a cellular receptor or a coreceptor for MVV.
It is clear from the results presented in this study that the V4 region
of MVV is an important determinant for infection. Further analysis of
this region should lead to an elucidation of its role in virus entry.
| |
ACKNOWLEDGMENTS |
This study was supported by The Icelandic Research Council, The
University of Iceland Research Fund, and The Icelandic Research Fund
for Graduate Students.
We thank Karl Skírnisson for helping with photography. We are
also indebted to Svava Högnadóttir, Steinunn
Árnadóttir, Sigurdur Torfi Gudmundsson and Gudmundur
Einarsson for expert technical help.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute for
Experimental Pathology, University of Iceland, Keldur, IS-112
Reykjavík, Iceland. Phone: 354-5674700. Fax: 354-5673979. E-mail: valand{at}rhi.hi.is.
| |
REFERENCES |
| 1.
|
Albert, J.,
B. Abrahamsson,
K. Nagy,
E. Aurelius,
H. Gaines,
G. Nyström, and E. M. Fenyo.
1990.
Rapid development of isolate-specific neutralizing antibodies after primary HIV-1 infection and consequent emergence of virus variants which resist neutralization by autologous sera.
AIDS
4:107-112[Medline].
|
| 2.
|
Andrésdóttir, V.,
X. Tang,
G. Agnarsdóttir,
Ó. S. Andrésson,
G. Georgsson,
R. Skraban,
S. Torsteinsdóttir,
B. Rafnar,
E. Benediktsdóttir,
S. Matthíasdóttir,
S. Árnadóttir,
S. Högnadóttir,
P. A. Pálsson, and G. Pétursson.
1998.
Biological and genetic differences between lung- and brain-derived isolates of maedi-visna virus.
Virus Genes
16:281-293[Medline].
|
| 2a.
| Andrésdóttir, V., et al. Unpublished
results.
|
| 3.
|
Andrésson, Ó. S.,
J. E. Elser,
G. J. Tobin,
J. D. Greenwood,
M. A. Gonda,
G. Georgsson,
V. Andrésdóttir,
E. Benediktsdóttir,
H. M. Carlsdóttir,
E. O. Mäntylä,
B. Rafnar,
P. A. Pálsson,
J. W. Casey, and G. Pétursson.
1993.
Nucleotide sequence and biological properties of a pathogenic proviral molecular clone of neurovirulent visna virus.
Virology
193:89-105[Medline].
|
| 4.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. More,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1988.
Current protocols in molecular biology.
John Wiley & Sons, Inc., New York, N.Y.
|
| 5.
|
Baldinotti, F.,
D. Matteucci,
P. Mazzetti,
C. Gianelli,
P. Bandecchi,
F. Tozzini, and M. Bendinelli.
1994.
Serum neutralization of feline immunodeficiency virus is markedly dependent on passage history of the virus and host system.
J. Virol.
68:4572-4579[Abstract/Free Full Text].
|
| 6.
|
Braun, M. J.,
J. E. Clements, and M. A. Gonda.
1987.
The visna virus genome: evidence for a hypervariable site in the env gene and sequence homology among lentivirus envelope proteins.
J. Virol.
61:4046-4054[Abstract/Free Full Text].
|
| 7.
|
Choi, W. S.,
C. Collignon,
C. Thiriart,
D. P. W. Burns,
E. J. Stott,
K. A. Kent, and R. C. Desrosiers.
1994.
Effects of natural sequence variation on recognition by monoclonal antibodies that neutralize simian immunodeficiency virus infectivity.
J. Virol.
68:5395-5402[Abstract/Free Full Text].
|
| 8.
|
Cook, R. F.,
S. L. Berger,
K. E. Rushlow,
J. M. McManus,
S. J. Cook,
S. Harrold,
M. L. Raabe,
R. C. Montelaro, and C. J. Issel.
1995.
Enhanced sensitivity to neutralizing antibodies in a variant of equine infectious anemia virus is linked to amino acid substitutions in the surface unit envelope glycoprotein.
J. Virol.
69:1493-1499[Abstract].
|
| 9.
|
Deng, H. K.,
R. Liu,
W. Ellmeier,
S. Choe,
D. Unutmaz,
M. Burkhart,
P. DiMarzio,
S. Marmon,
R. E. Sutton,
C. M. Hill,
C. B. Davis,
S. C. Peiper,
T. J. Schall,
D. R. Littman, and N. R. Landau.
1996.
Identification of a major co-receptor for primary isolates of HIV-1.
Nature
381:661-666[Medline].
|
| 10.
|
di Marzo Verones, F.,
M. S. Reitz,
G. Gupta,
M. Robert-Guroff,
C. Boyer-Thompson,
A. Louie,
R. C. Gallo, and P. Lusso.
1993.
Loss of a neutralizing epitope by a spontaneous point mutation in the V3 loop of HIV-1 isolated from an infected laboratory worker.
J. Biol. Chem.
268:25894-25901[Abstract/Free Full Text].
|
| 11.
|
Feng, Y.,
C. C. Broder,
P. E. Kennedy, and E. A. Berger.
1996.
HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor.
Science
272:872-877[Abstract].
|
| 12.
|
Gendelman, H. E.,
O. Narayan,
S. Kennedy-Stoskopf,
P. G. E. Kennedy,
Z. Ghotbi,
J. E. Clements,
J. Stanley, and G. Pezeshkpour.
1986.
Tropism of sheep lentiviruses for monocytes: susceptibility to infection and virus gene expression increase during maturation of monocytes to macrophages.
J. Virol.
58:67-74[Abstract/Free Full Text].
|
| 13.
|
Georgsson, G.,
D. J. Houwers,
P. A. Pálsson, and G. Pétursson.
1989.
Expression of viral antigens in the central nervous system of visna-infected sheep: an immunohistochemical study on experimental visna induced by virus strains of increased neurovirulence.
Acta Neuropathol.
77:299-306[Medline].
|
| 14.
|
Georgsson, G.
1990.
Maedi-visna: pathology and pathogenesis, p. 19-54.
In
G. Pétursson, and R. Hoff-Jörgensen (ed.), Maedi-visna and related diseases. Kluwer Academic Publishers, Boston, Mass.
|
| 15.
|
Geysen, H. M.,
R. H. Meloen, and S. J. Barteling.
1984.
Use of synthetic peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid.
Proc. Natl. Acad. Sci. USA
81:3998-4002[Abstract/Free Full Text].
|
| 16.
|
Goudsmit, J.,
C. A. B. Boucher,
R. H. Meloen,
L. G. Epstein,
L. Smit,
L. van der Hoek, and M. Bakker.
1988.
Human antibody response to a strain-specific HIV-1 gp120 epitope associated with cell fusion inhibition.
AIDS
2:157-164[Medline].
|
| 16a.
| Gudmundsson, B., et al. Unpublished results.
|
| 17.
|
Gudnadóttir, M.
1974.
Visna-maedi in sheep.
Prog. Med. Virol.
18:336-349[Medline].
|
| 18.
|
Javaherian, K.,
A. J. Langlois,
S. Schmidt,
M. Kaufmann,
N. Cates,
J. P. M. Langedijk,
R. H. Meloen,
R. C. Desrosiers,
D. P. W. Burns,
D. P. Bolognesi,
G. J. LaRosa, and S. D. Putney.
1992.
The principal neutralization determinant of simian immunodeficiency virus differs from that of human immunodeficiency virus.
Proc. Natl. Acad. Sci. USA
89:1418-1422[Abstract/Free Full Text].
|
| 19.
|
Kinsey, N. E.,
M. G. Anderson,
T. J. Unangst,
S. V. Joag,
O. Narayan,
M. C. Zink, and J. E. Clements.
1996.
Antigenic variation of SIV: mutations in V4 alter the neutralization profile.
Virology
221:14-21[Medline].
|
| 20.
|
Lasky, L. A.,
G. Nakamura, and D. J. Smith.
1987.
Delineation of a region of a human immunodeficiency virus type 1 gp 120 glycoprotein critical for interaction with the CD4 receptor.
Cell
50:975-985[Medline].
|
| 21.
|
Lutley, R.,
G. Pétursson,
P. A. Pálsson,
G. Georgsson,
J. Klein, and N. Nathanson.
1983.
Antigenic drift in visna: virus variation during long-term infection of Icelandic sheep.
J. Gen. Virol.
64:1433-1440[Abstract/Free Full Text].
|
| 22.
|
Lutley, R. E.,
G. Pétursson,
G. Georgsson,
P. A. Pálsson, and N. Nathanson.
1985.
Strains of visna virus with increased neurovirulence, p. 45-49.
In
J. M. Sharp, and R. Hoff-Jørgensen (ed.), Slow viruses in sheep, goats and cattle. Directorate-General for Agriculture and Coordination of Agricultural Research, Commission of the European Communities, Luxembourg.
|
| 23.
|
McKeating, J. A.,
J. Gow,
J. Goudsmit,
L. H. Pearl,
C. Mulder, and R. A. Weiss.
1989.
Characterization of HIV-1 neutralization escape mutants.
AIDS
3:777-784[Medline].
|
| 24.
|
McKnight, A.,
R. A. Weiss,
C. Shotton,
Y. Takeuchi,
H. Hoshino, and P. R. Clapham.
1995.
Change in tropism upon immune escape by human immunodeficiency virus.
J. Virol.
69:3167-3170[Abstract].
|
| 25.
|
Moore, J. P., and D. D. Ho.
1993.
Antibodies to discontinuous or conformationally sensitive epitopes on the gp120 glycoprotein of human immunodeficiency virus type 1 are highly prevalent in sera of infected humans.
J. Virol.
67:863-875[Abstract/Free Full Text].
|
| 26.
|
Nara, P.,
L. Smit,
N. Dunlop,
W. Hatch,
M. Merges,
D. Waters,
J. Kelliher,
R. C. Gallo,
P. J. Fischinger, and J. Goudsmit.
1990.
Emergence of viruses resistant to neutralization by V3-specific antibodies in experimental human immunodeficiency virus type 1 IIIB infection of chimpanzees.
J. Virol.
64:3779-3791[Abstract/Free Full Text].
|
| 27.
|
Narayan, O.,
D. E. Griffin, and J. Chase.
1977.
Antigenic shift of visna virus in persistently infected sheep.
Science
197:376-378[Abstract/Free Full Text].
|
| 28.
|
Narayan, O.,
J. S. Wolinsky,
J. E. Clements,
J. D. Strandberg,
D. E. Griffin, and L. C. Cork.
1982.
Slow virus replication: the role of macrophages in the persistence and expression of visna virus in sheep and goats.
J. Gen. Virol.
9:345-356.
|
| 29.
|
Palker, T. J.,
M. E. Clark,
A. J. Langlois,
T. J. Matthews,
K. J. Weinhold,
R. R. Randall,
D. P. Bolognesi, and B. F. Haynes.
1988.
Type-specific neutralization of the human immunodeficiency virus with antibodies to env-encoded synthetic peptides.
Proc. Natl. Acad. Sci. USA
85:1932-1936[Abstract/Free Full Text].
|
| 30.
|
Pancino, G.,
H. Ellerbrok,
M. Sitbon, and P. Sonigo.
1993.
Conserved framework of envelope glycoproteins among lentiviruses.
Curr. Top. Microbiol. Immun.
188:77-100.
|
| 31.
|
Pétursson, G.,
N. Nathanson,
G. Georgsson,
H. Panitch, and P. A. Pálsson.
1976.
Pathogenesis of visna. I. Sequential virologic, serologic, and pathologic studies.
Lab. Investig.
35:402-412[Medline].
|
| 32.
|
Querat, G.,
G. Audoly,
P. Sonigo, and R. Vigne.
1989.
Nucleotide sequence analysis of SA-OMVV, a visna-related ovine lentivirus: phylogenetic history of lentiviruses.
Virology
175:434-447.
|
| 33.
|
Rusche, J. R.,
K. Javaherian,
C. McDanal,
J. Petro,
D. L. Lynn,
A. Grimaila,
A. Langlois,
R. C. Gallo,
L. O. Arthur,
P. J. Fishinger,
D. P. Bolognesi,
S. D. Putney, and T. J. Matthews.
1988.
Antibodies that inhibit fusion of human immunodeficiency virus-infected cells bind a 24-amino-acid sequence of the viral envelope gp120.
Proc. Natl. Acad. Sci. USA
85:3198-3202[Abstract/Free Full Text].
|
| 34.
|
Saltarelli, M.,
G. Querat,
D. A. M. Konings,
R. Vigne, and J. E. Clements.
1990.
Nucleotide sequence and transcriptional analysis of molecular clones of CAEV which generate infectious virus.
Virology
179:347-364[Medline].
|
| 35.
|
Sargan, D. R.,
I. D. Bennet,
C. Cousens,
D. J. Roy,
B. A. Blacklaws,
R. G. Dalziel,
N. J. Watt, and I. McConnell.
1991.
Nucleotide sequence of EV1, a British isolate of maedi-visna virus.
J. Gen. Virol.
72:1893-1903[Abstract/Free Full Text].
|
| 36.
|
Sawyer, L. S. W.,
M. T. Wrin,
L. Crawford-Miksza,
B. Potts,
Y. Wu,
P. A. Weber,
R. D. Alfonso, and C. V. Hanson.
1994.
Neutralization sensitivity of human immunodeficiency virus type 1 is determined in part by the cell in which the virus is propagated.
J. Virol.
68:1342-1349[Abstract/Free Full Text].
|
| 37.
|
Schreiber, M.,
C. Wachsmuth,
H. Muller,
S. Odemuyiwa,
H. Schmitz,
S. Meyer,
B. Meyer, and J. Schneider-Mergener.
1997.
The V3-directed immune response in natural human immunodeficiency virus type 1 infection is predominantly directed against a variable, discontinuous epitope presented by the gp120 V3 domain.
J. Virol.
71:9198-9205[Abstract].
|
| 38.
|
Siebelink, K. H. J.,
G. F. Rimmelzwaan,
M. L. Bosch,
R. H. Meloen, and A. D. M. E. Osterhaus.
1993.
A single amino acid substitution in hypervariable region 5 of the envelope protein of feline immunodeficiency virus allows escape from virus neutralization.
J. Virol.
67:2202-2208[Abstract/Free Full Text].
|
| 39.
|
Siebelink, K. H. J.,
W. Huisman,
J. A. Karlas,
G. F. Rimmelzwaan,
M. L. Bosch, and A. D. M. E. Osterhaus.
1995.
Neutralization of feline immunodeficiency virus by polyclonal feline antibody: simultaneous involvement of hypervariable regions 4 and 5 of the surface glycoprotein.
J. Virol.
69:5124-5127[Abstract].
|
| 40.
|
Sigurdsson, B.,
H. Grimsson, and P. A. Palsson.
1952.
Maedi, a chronic, progressive infection of sheep's lungs.
J. Infect. Dis.
90:233-241[Medline].
|
| 41.
|
Sigurdsson, B., and P. A. Palsson.
1958.
Visna of sheep. A slow demyelinating infection.
Br. J. Exp. Pathol.
39:519-528[Medline].
|
| 42.
|
Sigurdsson, B.,
H. Thormar, and P. A. Pálsson.
1960.
Cultivation of visna virus in tissue culture.
Arch. Gesamte Virusforsch.
10:368-380.
|
| 43.
|
Sonigo, P.,
M. Alizon,
K. Staskus,
D. Klatzmann,
S. Cole,
O. Danos,
E. Retzel,
P. Tiollais,
A. Haase, and S. Wain-Hobson.
1985.
Nucleotide sequence of the visna lentivirus: relationship to the AIDS virus.
Cell
42:369-382[Medline].
|
| 44.
|
Staskus, K. A.,
E. F. Retzel,
E. D. Lewis,
J. L. Silsby,
S. St. Cyr,
J. M. Rank,
S. W. Wietgrefe,
A. T. Haase,
R. Cook,
D. Fast,
P. Gieser,
J. T. Harty,
S. H. Kong,
C. J. Lahti,
T. P. Neufeld,
T. E. Porter,
E. Shoop, and K. R. Zachow.
1991.
Isolation of replication-competent molecular clones of visna virus.
Virology
181:228-240[Medline].
|
| 45.
|
Thali, M.,
J. P. Moore,
C. Furman,
M. Charles,
D. D. Ho,
J. Robinson, and J. Sodroski.
1993.
Characterization of conserved human immunodeficiency virus type 1 gp120 neutralization epitopes exposed upon gp 120-CD4 binding.
J. Virol.
67:3978-3988[Abstract/Free Full Text].
|
| 46.
|
Thormar, H.,
M. R. Barshatzky,
K. Arnesen, and P. B. Kozlowski.
1983.
The emergence of antigenic variants is a rare event in long-term visna virus infection in vivo.
J. Gen. Virol.
64:1427-1432[Abstract/Free Full Text].
|
| 47.
|
Torsteinsdottir, S.,
G. Agnarsdottir,
S. Matthiasdottir,
B. Rafnar,
V. Andresdottir,
O. S. Andresson,
K. Staskus,
G. Petursson,
P. A. Palsson, and G. Georgsson.
1997.
In vivo and in vitro infection with two different molecular clones of visna virus.
Virology
229:370-380[Medline].
|
| 48.
|
Trkola, A.,
M. Purtscher,
T. Muster,
C. Ballaun,
A. Buchacher,
N. Sullivan,
K. Srinivasan,
J. Sodroski,
J. Moore, and H. Katinger.
1996.
Human monoclonal antibody 2G12 defines a distinctive neutralization epitope on the gp 120 glycoprotein of human immunodeficiency virus type 1.
J. Virol.
70:1100-1108[Abstract].
|
| 49.
|
Turelli, P.,
G. Pétursson,
F. Guiguen,
J.-F. Mornex,
R. Vigne, and G. Querat.
1996.
Replication properties of dUTPase-deficient mutants of caprine and ovine lentiviruses.
J. Virol.
70:1213-1217[Abstract].
|
| 50.
|
Verschoor, E. J.,
L. A. Boven,
H. Blaak,
A. I. W. Van Vliet,
M. C. Horzinek, and A. de Ronde.
1995.
A single mutation within the V3 envelope neutralization domain of feline immunodeficiency virus determines its tropism for CRFK cells.
J. Virol.
69:4752-4757[Abstract].
|
| 51.
|
Wolfs, T. F. W.,
G. Zwart,
M. Bakker,
M. Valk,
C. L. Kuiken, and J. Goudsmit.
1991.
Naturally occurring mutations within HIV-1 V3 genomic RNA lead to antigenic variation dependent on a single amino acid substitution.
Virology
185:195-205[Medline].
|
| 52.
|
Zhuge, W.,
F. Jia,
I. Adany,
O. Narayan, and E. B. Stephens.
1997.
Plasmas from lymphocyte- and macrophage-tropic SIVmac-infected macaques have antibodies with a broader spectrum of virus neutralization activity in macrophage versus lymphocyte cultures.
Virology
227:24-33[Medline].
|
Journal of Virology, October 1999, p. 8064-8072, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Haflidadottir, B. S., Matthiasdottir, S., Agnarsdottir, G., Torsteinsdottir, S., Petursson, G., Andresson, O. S., Andresdottir, V.
(2008). Mutational analysis of a principal neutralization domain of visna/maedi virus envelope glycoprotein. J. Gen. Virol.
89: 716-721
[Abstract]
[Full Text]
-
Oskarsson, T., Hreggvidsdottir, H. S., Agnarsdottir, G., Matthiasdottir, S., Ogmundsdottir, M. H., Jonsson, S. R., Georgsson, G., Ingvarsson, S., Andresson, O. S., Andresdottir, V.
(2007). Duplicated Sequence Motif in the Long Terminal Repeat of Maedi-Visna Virus Extends Cell Tropism and Is Associated with Neurovirulence. J. Virol.
81: 4052-4057
[Abstract]
[Full Text]
-
Gjerset, B., Storset, A. K., Rimstad, E.
(2006). Genetic diversity of small-ruminant lentiviruses: characterization of Norwegian isolates of Caprine arthritis encephalitis virus.. J. Gen. Virol.
87: 573-580
[Abstract]
[Full Text]
-
Gudmundsson, B., Jonsson, S. R., Olafsson, O., Agnarsdottir, G., Matthiasdottir, S., Georgsson, G., Torsteinsdottir, S., Svansson, V., Kristbjornsdottir, H. B., Franzdottir, S. R., Andresson, O. S., Andresdottir, V.
(2005). Simultaneous Mutations in CA and Vif of Maedi-Visna Virus Cause Attenuated Replication in Macrophages and Reduced Infectivity In Vivo. J. Virol.
79: 15038-15042
[Abstract]
[Full Text]
-
Trujillo, J. D., Kumpula-McWhirter, N. M., Hotzel, K. J., Gonzalez, M., Cheevers, W. P.
(2004). Glycosylation of Immunodominant Linear Epitopes in the Carboxy-Terminal Region of the Caprine Arthritis-Encephalitis Virus Surface Envelope Enhances Vaccine-Induced Type-Specific and Cross-Reactive Neutralizing Antibody Responses. J. Virol.
78: 9190-9202
[Abstract]
[Full Text]
-
Andresdottir, V., Skraban, R., Matthiasdottir, S., Lutley, R., Agnarsdottir, G., Thorsteinsdottir, H.
(2002). Selection of antigenic variants in maedi-visna virus infection. J. Gen. Virol.
83: 2543-2551
[Abstract]
[Full Text]
-
Hotzel, I., Cheevers, W. P.
(2001). Host Range of Small-Ruminant Lentivirus Cytopathic Variants Determined with a Selectable Caprine Arthritis- Encephalitis Virus Pseudotype System. J. Virol.
75: 7384-7391
[Abstract]
[Full Text]
-
Hötzel, I., Cheevers, W. P.
(2001). Conservation of Human Immunodeficiency Virus Type 1 gp120 Inner-Domain Sequences in Lentivirus and Type A and B Retrovirus Envelope Surface Glycoproteins. J. Virol.
75: 2014-2018
[Abstract]
[Full Text]
-
Bertoni, G., Hertig, C., Zahno, M.-L., Vogt, H.-R., Dufour, S., Cordano, P., Peterhans, E., Cheevers, W. P., Sonigo, P., Pancino, G.
(2000). B-cell epitopes of the envelope glycoprotein of caprine arthritis-encephalitis virus and antibody response in infected goats. J. Gen. Virol.
81: 2929-2940
[Abstract]
[Full Text]
-
Agnarsdóttir, G., Thorsteinsdóttir, H., Óskarsson, T., Matthíasdóttir, S., St. Haflidadóttir, B., Andrésson, O. S., Andrésdóttir, V.
(2000). The long terminal repeat is a determinant of cell tropism of maedi-visna virus. J. Gen. Virol.
81: 1901-1905
[Abstract]
[Full Text]
-
Valas, S., Benoit, C., Baudry, C., Perrin, G., Mamoun, R. Z.
(2000). Variability and Immunogenicity of Caprine Arthritis-Encephalitis Virus Surface Glycoprotein. J. Virol.
74: 6178-6185
[Abstract]
[Full Text]
Top
Abstract
Introduction
