Previous Article | Next Article 
Journal of Virology, October 1999, p. 7994-8002, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Discovery of a New Endogenous Type C Retrovirus
(FcEV) in Cats: Evidence for RD-114 Being an
FcEVGag-Pol/Baboon Endogenous Virus
BaEVEnv Recombinant
Antoinette C.
van der
Kuyl,1,*
John T.
Dekker,1 and
Jaap
Goudsmit2
Department of Human Retrovirology, Academic
Medical Centre, 1105 AZ Amsterdam,1 and
Amsterdam Institute of Viral Genomics, 1105 BA Amsterdam, The
Netherlands2
Received 29 March 1999/Accepted 17 June 1999
 |
ABSTRACT |
Analysis of a cat genomic DNA library showed that cats harbor a
previously unrecognized endogenous type C retrovirus, whose env gene has homology to the murine Fv-4
resistance gene. This unique retrovirus, designated FcEV (Felis
catus endogenous retrovirus), has a type C pol gene,
closely related to the primate Papio cynocephalus endogenous virus (PcEV) pol, not overlapping the
env gene, unlike in other type C retroviruses, and is
presumably present in a higher copy number than RD-114. Phylogenetic
analysis of FcEV and RD-114 fragments amplified from cat species and
comparison with baboon endogenous virus (BaEV) fragments from monkeys
suggested that RD-114 does not represent the cat strain of BaEV but is
actually a new recombinant between FcEV type C genes and the
env gene of BaEV. Although BaEV did appear to have infected
an ancestor of the domestic cat lineage, it was a de novo recombinant
that made its way into the cat germ line.
 |
INTRODUCTION |
All 38 known cat species, including
the big cats, arose during the last 10 to 15 million years
(13), with the lineage leading to the domestic cat being
formed 7 to 9 million years ago (11). Extant cats belonging
to the species Felis probably have a common ancestor much
more recently, since they are genetically closely related. An
interesting feature of the genus Felis (composed of Felis catus, F. chaus, F. nigripes,
F. margarita, F. silvestris, and F. libyca) is the presence of two endogenous retroviruses not found
in any other cat species, e.g., endogenous feline leukemia virus (FeLV)
and RD-114 (2, 20). RD-114 showed a high level of homology
to the monkey virus baboon endogenous virus (BaEV), which was
attributed to an ancient cross-species transmission. RD-114 can still
be expressed, but there is probably only a single active copy on cat
chromosome B3 (19). Analysis of RD-114 proviruses in the
domestic cat genome showed that there are approximately 20 related
integrations per cell but that most have either lost their
env genes or replaced them by a completely unrelated
env (20, 23). No complete sequence is available
for RD-114; only the env gene and the 3' end of the
pol gene have been sequenced (7), and some long
terminal repeat (LTR) sequences are available (22).
BaEV is a complete inducible endogenous retrovirus (1),
which is found in the genomic DNA of a subset of African monkeys, e.g.,
baboons, geladas, mandrills, mangabeys, and African green monkeys
(26). Phylogenetic analysis of BaEV sequences from monkeys indicated that two BaEV strains have entered independently into the
germ line of the monkey species (26). The last common
ancestor of the Cercopithicinae supposedly lived at least 9 million
years ago, indicating that exogenous BaEV was spreading in Africa after that time. BaEV is a recombinant retrovirus, containing type C gag and pol genes and a type D env
gene, which probably arose by recombination of two primate viruses
(simian endogenous retrovirus [SERV] and Papio
cynocephalus endogenous virus [PcEV]), whose genomes are also
present in monkey genomic DNA (17, 27). RD-114 has the same
mosaic genomic structure as BaEV. The env gene of RD-114 is
most probably derived from BaEV and not from the primate type D virus
SERV, one of the ancestors of BaEV. Although the three env
genes are generally very homologous, BaEV and RD-114 have extensive
homology at the extreme C-terminal part of this protein, and the 30 nucleotides nt downstream of the env stop codon are highly
homologous, in contrast to SERV. Recombination probably took place just
downstream of the env gene. The env-LTR intergenic region in type D viruses containing a constitutive transport
element, which is absent from type C retroviruses.
To expand our knowledge of the evolution of RD-114 and BaEV, we have
analyzed two env genes of presumed RD-114 proviruses isolated from a cat genomic library and have examined RD-114 sequence variation in different species of cats and compared it with BaEV variation in monkey species.
 |
MATERIALS AND METHODS |
Cat genomic library.
A cat genomic library in the lambda
FIXR II vector was obtained from Stratagene (La Jolla,
Calif.). This library was constructed from whole blood of an adult
female domestic cat of mixed breed.
Isolation of type C proviral clones.
The cat genomic library
was screened by using a 32P-labelled probe homologous to
the 3' end of the RD-114 pol sequence. Lambda DNA was
isolated from purified positive plaques by using the Wizard Lambda
Preps DNA purification system from Promega (Madison, Wis.).
Cat and primate samples.
DNA samples were obtained from
F. catus (domestic cat), F. chaus (jungle cat),
and F. silvestris (European wild cat). The F. chaus and F. silvestris DNA samples were kindly donated
by Stephen J. O'Brien (National Cancer Institute, Frederick, Md.). Primate samples (peripheral blood mononuclear cells [PBMCs] and serum
for Cercocebus aterrimus) were obtained from the following African monkeys: Papio ursinus (chacma baboon),
Cercocebus aterrimus (black mangabey), Cercopithecus
aethiops aethiops (grivet), Cercopithecus aethiops
pygerythrus (vervet), and Cercopithecus aethiops
sabaeus (green monkey). The origin of the samples was as published
previously (26).
DNA extraction and amplification.
Total DNA was extracted
from the samples by a procedure involving silica and guanidine
thiocyanate (5). A 590-nt nested fragment of BaEV or RD-114
was amplified by using an outer primer set designated RD. The RD primer
set consisted of an upstream primer, 5' GACCTTAGAGACTGGC 3'
(nt 5655 to 5670 of the BaEV sequence [14]), located
in the pol gene and a downstream primer, 5'
GCTGCAATCGCATGG 3' (nt 6343 to 6357 of BaEV), located in the
env gene. A nested set, consisting of primers upstream 5'
GGAGACGCCTCCTATCTC 3' (nt 5681 to 5698 of BaEV) and
downstream 5' GCGAGGGTCGTCAAACCC 3' (nt 6289 to 6306 of
BaEV), was used in a second amplification reaction, if necessary. A PCR
fragment could be obtained from F. chaus only by using the
nested primer set directly on the genomic DNA, probably because of
mismatches with the outer primer set. For FcEV amplification, the
upstream primers were combined with downstream primers based on the
env sequence of this virus: 5' GGGGAAGTTGTCTGGGAGGT
3' and the nested primer 5' GAGGGGAACCCACATCAGGT 3'.
This primer combination was designated FC. First-round PCR amplifications were done under the following conditions: denaturation for 5 min at 95°C; amplification consisting of 35 cycles of 1 min at
95°C, 1 min at 55°C, and 2 min at 72°C; followed by an extension
of 10 min at 72°C. The protocol for the nested reactions was
identical, except that only 25 cycles were performed. The obtained
fragments were cloned into the TA vector (Invitrogen, San Diego,
Calif.) and sequenced. At least two clones from a single individual
were analyzed.
DNA sequencing.
Sequencing of the clones with an ABI 373A or
ABI 377 automated sequencer was done in both directions directly from
lambda DNA with purified specific primers, as specified by the
manufacturer. PCR fragments obtained from genomic DNA were sequenced
directly from plasmid DNA with T7 and M13 dye primers.
Sequence analysis.
Alignment of PCR fragments and lambda
clone sequences was done with CLUSTAL-W (9) and adjusted by
hand. The phylogenetic analyses were done by the neighbor-joining (NJ)
method, as implemented in the MEGA package (16). Distances
were estimated by Kimura's two-parameter method (15). One
hundred bootstrap replicates were analyzed. The rate constancy in the
pol gene was checked by the two-cluster test as described by
Takezaki et al. (25), and linearized NJ trees were
constructed with a program made available by these authors. The RD-114
sequence used is from reference 7 (GenBank accession
no. X87829).
Nucleotide sequence accession numbers.
The sequences
reported in this paper have been deposited in the GenBank database
(accession no. AF155060, AF155061, and AF164903 to AF164923).
 |
RESULTS |
Analysis of the Fc21 and Fc41 env genes.
Proviral
clones Fc21 and Fc41 were obtained by hybridizing a cat genomic library
to a RD-114 pol probe. Sequence analysis showed that both
clones contained complete and closely related type C env
genes, in contrast to RD-114, which contains a type D env
gene. The sequences of part of pol, the pol-env
intergenic region, env, and part of the 3' LTR contained in
these clones are shown in Fig. 1A.
The env reading frame was
completely open in clone Fc21, but in Fc41 it was interrupted three
times by the deletion or insertion of single nucleotides. The Env
protein sequences encoded by these clones (Fig. 1B) were analyzed
together with Env proteins from type C and type D retroviruses (Fig.
2). Fc21 and Fc41 Env proteins were
closely related to murine type C viruses, especially to the ecotropic
murine leukemia virus (MuLV) group. The endogenous
Fv-4r env gene product of Asian mice showed the
highest level of amino acid homology to the cat clones, especially in
the P15E protein.


View larger version (94K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Alignment of the cat genomic proviral clones Fc21
and Fc41. The stop codons of the pol and env
genes and the start codon of the env gene are indicated by
arrows and underlined. (B) Alignment of amino acid sequences of Fc21
and Fc41 derived from the sequences in Fig. 1A. The Fc41 reading frame
has been modified to allow translation by the removal of 1 nt and the
insertion of 2 nt, according to the Fc21 ORF. The putative signal
peptide and the gp70 and P15E proteins are indicated. Processing sites
were obtained by comparison of Fc21 and Fc41 with the GA-FeLV-B
env protein (8). The putative immunosuppressive
peptide is shaded.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 2.
NJ tree based on a p-distance matrix generated from
amino acid sequences of retroviral type C env genes.
Bootstrap values for 100 replicated trees are indicated. GaLV, gibbon
ape leukemia virus (accession no. M26927); MDEV, is Mus
dunni endogenous virus (AF053745); PERV (Y17013) and PERV-MSL
(AF038599), pig viruses; PcEV, complete type C endogenous monkey virus
(16); FeLV (M89997), feline leukemia virus; MuLV
Fv-4r, murine leukemia virus env gene
present at the Fv-4r locus (M33884). The type D
env genes analyzed are from RD-114, BaEV, and SERV
(U85506).
|
|
At the nucleotide level, an unpublished proviral env
sequence from F. silvestris deposited in the GenBank
database (accession no. X51929) showed high homology to Fc21 and lower
homology to Fc41. Previously, after analysis of a small fragment of
X51929, the authors suggested that the clone contained an RD-114/FeLV recombinant virus (4).
Analysis of the Fc21 and Fc41 3' untranslated region.
Proviral
genomes are flanked at both ends by untranslated LTR sequences, which
are involved in regulation of gene expression and replication of the
viral genome. LTRs are the most variable part of the retroviral genome.
Between the stop codon of the env gene and the U3 region of
the 3' LTR, a region containing the polypurine tract, involved in
plus-strand synthesis, is found. Analysis of part of the 3'
untranslated regions of both Fc21 and Fc41, containing the unidentified
start of the U3 region of the LTR, showed them to be homologous but not
identical to each other (Fig. 1A). In a BLAST search of the GenBank
database, homology to supposed RD-114 LTRs was found, including the 3'
LTR of the inducible virus, but no homology to any other retrovirus
LTRs was found. Of the inducible RD-114, large stretches of homology to
BaEV LTRs has also been found, especially at the R and U5 regions of
the LTR, which were not sequenced in Fc21 and Fc41.
In the untranslated region located between the stop codon of the
env gene and the start of the 3' LTR, high homology to
Fv-4r MuLV and to FeLV was found. For Fc21, the
polypurine tract and a stretch of 18 nt downstream showed 100%
homology to a rat retroviral transcript. The inducible RD-114 is
similar to BaEV in this region and has less homology to Fc21 and Fc41.
Analysis of the Fc21 and Fc41 pol fragment and
intergenic region.
The env gene of Fc21 and Fc41 was
found not to overlap the pol open reading frame (ORF), as in
many type C viruses, but was separated from it by an untranslated
intergenic region. A separate env gene is common in type D
retroviruses. From the upstream pol gene of Fc21 and Fc41,
approximately 430 nt encoding part of the endonuclease (integrase) was
additionally sequenced (see Fig. 4). The pol sequences of
Fc21 and Fc41 were then analyzed together with the amplified fragments
from cat and monkey genomic DNA (see Fig. 5). The Fc21 and Fc41
pol genes are C type and are closely related to RD-114
pol. The intergenic region of Fc21 and Fc41 is almost
identical to that of RD-114 (see Fig. 4). However, based upon the
divergent env sequences of the Fc21 and Fc41 genomic clones,
we postulated that the proviral genomes present in these clones
represent two closely related virus strains distinct from RD-114. This
novel endogenous virus we named Felis catus endogenous virus (FcEV).
Determination of the recombination breakpoints of RD-114.
Comparison of the genomes of RD-114, FcEV, and BaEV suggested that
RD-114 is a recombinant virus with the following features: the
pol gene, pol-env intergenic region, and LTRs
were most probably derived from FcEV, while the env gene has
high homology to BaEV env, suggesting that it originated
from BaEV. Because the pol-env intergenic region of RD-114
was very similar to that of FcEV, it is most likely that recombination
occurred somewhere at the 5' end of the env gene. Alignment
of the leader or signal peptide of the gp70 protein region of the
env gene suggested that recombination could have occurred in
this sequence, since high homology at the nucleotide level was observed
(Fig. 3A). Amino acid homology is less
obvious in the C-terminal part of the signal peptide, suggesting rapid
adaptation to the new host species. The N-terminal part of the signal
peptide of all cat viruses was very homologous, suggesting that the
point of recombination was located downstream of the first 20 nt of the
env reading frame.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of the recombination breakpoints of RD-114. (A)
Putative 5' breakpoint located in the signal peptide sequence of gp70.
The start codon of env is underlined. Shading indicates
homologous sequences probably involved in recombination. Amino acids
derived from the signal peptide sequences are shown. (B) Putative 3'
breakpoint located between the stop codon of env
(underlined), and the start of the 3' LTR (arrow). The possible area of
recombination is shaded. P15E C-terminal amino acid sequences are
shown.
|
|
Homology, at both the nucleotide and amino acid levels, continues
throughout env. The amino acid changes observed most
probably represent adaptation to the new host. The C-terminal
env sequences of RD-114 and BaEV were almost identical,
indicating that recombination most probably occurred downstream of the
env ORF. However, the RD-114 LTR sequence showed higher
homology to FcEV than to BaEV, suggesting that recombination should
have occurred between the stop codon of env and the
beginning of the 3' LTR. Indeed, a homologous sequence of approximately
20 nt was found at this position in all three viruses (Fig. 3B).
Concluding, the recombination breakpoints of RD-114 are presumably
located in the N-terminal part of gp70 (around amino acids 7 to 9) and
between the stop codon of env and the boundary of the 3' LTR
sequence. Recombination thus involved almost the complete
env gene.
Amplification of BaEV, RD-114, and FcEV fragments.
The derived
amino acid sequences of the BaEV, RD-114, and FcEV fragments amplified
from monkey and cat genomic DNA are shown in Fig.
4. The fragment included the 3' end of
the pol gene, the pol-env intergenic region, and
the 5' end of the env gene. Translation of the
pol ORF showed that many substitutions are silent and do not
lead to amino acid replacement compared to BaEV. The RD-114 fragments
amplified from the three species of cats are almost identical,
suggesting that the time of divergent evolution is short and that
probably the same single locus has been amplified. Cat FcEV fragments
showed a little more variation than did the RD-114 sequences. BaEV
fragments amplified with primer set RD from monkey DNA were even more
variable, suggesting that different loci have been amplified or that
the total time of divergent evolution is longer. Defective clones,
containing premature stop codons or small deletions, were amplified
from both monkey and cat DNA.


View larger version (124K):
[in this window]
[in a new window]
|
FIG. 4.
Alignment of a pol-env fragment amplified
from monkey and cat species. The pol and env
parts of the sequence are shown translated into amino acids, while the
intergenic region is shown as nucleotides. The sequence corresponds to
nt 5738 to 6288 of the BaEV reference sequence (14). Gaps
introduced for optimal alignment are indicated by dots, and identical
nucleotides are indicated by dashes. Stop codons are indicated by an
asterisk, and incomplete codons (due to single nucleotide deletions)
are indicated by a question mark. The primer set (RD or FC) used in
generation of the fragments is identified.
|
|
With the pol-env fragment used, no distinction can be made
between the BaEVfor strain infecting mangabeys and
mandrills and the BaEVsav strain infecting baboons,
geladas, and African green monkeys, since the strains were separated
earlier by using LTR sequences and, to a lesser extent, env
sequences (26). The few nucleotide differences between the
pol-env fragment of the cultured RD-114 isolate
(7) and the sequences obtained from cat genomic DNA (Fig. 4)
could be due either to mutations acquired during culturing or to
sequence artifacts.
Phylogenetic analysis of BaEV, RD-114, and FcEV fragments.
NJ
analysis of amplified fragments showed that both endogenous cat viruses
clustered together and away from monkey BaEV (Fig. 5A).
Surprisingly, the Fc41 fragment was basal to all cat sequences and was
most closely related to monkey viruses, which suggested that Fc41
represented the most ancient integration. Analysis of only
pol sequences (Fig. 5B) showed more clearly that all cat virus pol fragments had evolved from Fc41 pol.
This observation was confirmed in a linearized NJ tree (not shown),
where the rate constancy is calculated with respect to an outgroup and
subsequently forced upon the sequences. Therefore, RD-114
pol sequences are almost certainly derived from FcEV
pol genes. The near absence of divergence in RD-114 from
different cat species again suggested that a single locus has been
amplified. An NJ analysis of pol-derived amino acid
sequences generated a tree identical to the nucleotide pol
tree (not shown).


View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
(A) NJ tree based on the pol-env nucleotide
fragments shown in Fig. 4. Bootstrap values for 100 replicated trees
are indicated. Treating gaps introduced for optimal alignment as
uninformative, or using them in pairwise comparisons, did not influence
the tree. (B) NJ tree based upon only the pol fragment shown
in Fig. 4. The corresponding pol fragment of the endogenous
primate type C virus PcEV (17) was also included in the
analysis. A NJ tree based upon the derived amino acid sequence of the
pol fragment showed an identical topology (not shown). The
primer set (RD or FC) used in generation of the fragments is
identified.
|
|
 |
DISCUSSION |
To investigate the evolution of the monkey retrovirus BaEV after
its presumed transmission to cats, as suggested by sequence comparison,
we have sequenced the env genes and adjacent genome parts of
two RD-114 proviruses integrated in the genome of the domestic cat
(F. catus). Analysis of the two clones (Fc21 and Fc41)
revealed that their env genes are of type C, in contrast to
the type D env found in RD-114. Earlier hybridization
studies had already shown that all putative RD-114 proviruses analyzed possessed env genes unrelated to inducible RD-114 (20,
23). Most of these integrations are full-length proviruses with
gag, pol, and env genes flanked by two
LTRs. All or most proviruses formerly attributed to RD-114 are more
likely to be FcEV integrations, and we assume that the number of 15 to
20 copies per haploid genome is probably the copy number of FcEV. It
would be worthwhile to determine the actual FcEV copy number, its
gag sequence, and its distribution in feline species.
Earlier experiments involving Southern hybridization showed that the
RD-114-unrelated env sequences were also unique for the
genus Felis and do not occur in primates (20). It
is possible that the single inducible RD-114 locus is the only
representative of the true RD-114 virus in the cat genome. Domestic
cats are polymorphic with respect to the presence or absence of the
inducible RD-114 provirus on chromosome B3 (19), suggesting
that this integration is recent in evolutionary terms.
The origin of the FcEV env gene is most probably a murine
type C virus. Database homology searches and phylogenetic analysis of
type C Env proteins showed that FcEV env, and the
env-LTR intergenic region, are related to the
Fv-4 resistance gene and its downstream sequence of Asian
Mus musculus (10). The
Fv-4r locus contains the env gene of
an ecotropic MuLV, whose expression protects carrier mice from new
ecotropic MuLV infections. It would be interesting to see if expression
of FcEV env genes occurs and, if so, if it protects cats
from related infections. It has been shown previously that FeLV is also
derived from rodent viruses. Elder and Mullins (8) noted
homologies between the env genes of FeLV-B and a murine mink
cell focus-forming virus, while Benveniste et al. (3)
observed a larger degree of homology to rat sequences.
The pol gene of Fc41 was found to be closely related to
monkey type C pol genes, especially to the recently
characterized PcEV pol gene, and less closely related to the
BaEV pol gene. PcEV is a full-length type C virus identified
in baboons but is present in most Old World monkey genomes
(17). PcEV is one of the putative ancestors of BaEV.
Phylogenetic analysis showed that all RD-114-like pol genes
amplified or isolated from cats, including Fc21 and inducible RD-114,
have evolved from the Fc41 pol gene. Thus, the viral
integration contained in the Fc41 clone is more ancient than inducible
RD-114 but contains a type C env gene. Fc41 thus represents
an endogenous type C retrovirus distinct from the prototype RD-114 and
should be classified separately as FcEV, together with the closely
related Fc21 provirus. Probably, the FcEV provirus present in clone
Fc21 represents a less ancient integration of FcEV, integrated much
later in the cat genome. Exogenous retroviruses have an increased
substitution rate compared to endogenous retroviruses.
RD-114 contains a pol gene distinct from BaEV
pol, while cat genomes harbor multiple copies of a type C
retrovirus closely related to RD-114 pol. Also, the
pol-env intergenic region and the LTRs of RD-114 and FcEV
are closely related. The primer binding site of RD-114 and all
RD-114-related viruses was found to be complementary to
tRNAGly (22), in contrast to the PBS of BaEV,
which utilizes tRNAPro to initiate replication
(14).
From the phylogenetic analyses, the copy number (15 to 20 per haploid
genome, as suggested in reference 20) and the non-inducibility of the
FcEV proviruses, it can be assumed that they are older than the RD-114
integration. Although newly integrated proviruses can also be
defective, proviruses generally become increasingly suppressed by their
host as a function of time. Phylogenetic analysis showed that it is
unlikely that the pol gene of RD-114 and the untranslated
parts of its genome are derived from BaEV. However, the RD-114
env gene is highly homologous to BaEV env,
suggesting that RD-114 is a recombinant virus between the cat virus
FcEV and primate BaEV. Recombination could have been facilitated by the
two homologous stretches, one located in the signal peptide sequence of
the env gene and the other just downstream of the env stop codon. The presence of a separate env
gene in FcEV, as in type D viruses, facilitated the exchange of this
gene. BaEV thus did infect a cat ancestor, but it was a newly
recombined virus that made its way into the cat germ line.
Recombination is a common strategy in retroviruses, as is presently
seen in the human immunodeficiency virus type 1 pandemic, where
approximately 10% of viruses isolated are recombinants
(21), either between different subtypes or between different
strains. In simian immunodeficiency virus, the virus harbored by
sabaeus monkeys is a recombinant between African green monkey and sooty
mangabey simian immunodeficiency viruses (12). Also, BaEV
itself is a recombinant between C-type (PcEV) and D-type (SERV) primate
retroviruses (17, 27).
Cats of the genus Felis thus harbor at least three unique
retroviruses in their genome: (i) FcEV, a type C virus, of which presumably 15 to 20 copies exist; (ii) the FcEV-BaEV recombinant virus
RD-114, probably present as a single inducible copy; and (iii) multiple
endogenous FeLV integrations, which can recombine with exogenous FeLVs
(18, 24). Since all three viruses must have infected the
common ancestor of the domestic cat lineage, this suggests that in the
ancestral cat population, two rodent retroviruses and a primate
retrovirus were simultaneously spreading. It should be noted that cats
also harbor endogenous virus sequences with homology to the macaque
type C virus MAC-1 (6).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Human Retrovirology, Academic Medical Centre, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands. Phone: 31 20 566 4522. Fax: 31 20 691 6531. E-mail:
a.c.vanderkuyl{at}amc.uva.nl.
 |
REFERENCES |
| 1.
|
Benveniste, R. E.,
M. M. Lieber,
D. M. Livingston,
C. J. Sherr, and G. J. Todaro.
1974.
Infectious C-type virus isolated from a baboon placenta.
Nature (London)
248:17-20[Medline].
|
| 2.
|
Benveniste, R. E., and G. J. Todaro.
1974.
Evolution of C-type viral genes: inheritance of exogenously acquired viral genes.
Nature (London)
252:456-459[Medline].
|
| 3.
|
Benveniste, R. E.,
C. J. Sherr, and G. J. Todaro.
1975.
Evolution of type C viral genes: origin of feline leukemia virus.
Science
190:886-888[Abstract/Free Full Text].
|
| 4.
|
Beyer, W.,
R. Möhring,
B. Drescher,
U. Nötzel, and S. Rosenthal.
1987.
Molecular cloning of an endogenous cat retroviral element (ECE1) a recombinant between RD-114 and FeLV-related sequences.
Arch. Virol.
96:297-301[Medline].
|
| 5.
|
Boom, R.,
C. J. A. Sol,
M. M. M. Salimans,
C. L. Jansen,
P. M. E. Wertheim-van Dillen, and J. van der Noordaa.
1990.
Rapid and simple method for the purification of nucleic acids.
J. Clin. Microbiol.
28:495-503[Abstract/Free Full Text].
|
| 6.
|
Bonner, T. I., and G. J. Todaro.
1979.
Carnivores have sequences in their cellular DNA distantly related to the primate endogenous virus, MAC-1.
Virology
94:224-227[Medline].
|
| 7.
|
Cosset, F. L.,
Y. Takeuchi,
J. L. Battini,
R. A. Weiss, and F. L. Collins.
1995.
High titer packaging cells producing recombinant retroviruses resistant to human serum.
J. Virol.
69:7430-7436[Abstract].
|
| 8.
|
Elder, J. H., and J. I. Mullins.
1983.
Nucleotide sequence of the envelope gene of Gardner-Arnstein feline leukemia virus B reveals unique sequence homologies with a murine mink cell focus-forming virus.
J. Virol.
46:871-880[Abstract/Free Full Text].
|
| 9.
|
Highness, D. G., and P. M. Sharp.
1988.
CLUSTAL-W: a package for performing multiple sequence alignments on a microcomputer.
Gene
73:237-244[Medline].
|
| 10.
|
Ikeda, H.,
F. Laigret,
M. A. Martin, and R. Repaske.
1985.
Characterization of a molecularly cloned retroviral sequence associated with Fv-4 resistance.
J. Virol.
55:768-777[Abstract/Free Full Text].
|
| 11.
|
Janczewski, D. N.,
W. S. Modi,
J. C. Stephens, and S. J. O'Brien.
1995.
Molecular evolution of mitochondrial 12S RNA and cytochrome b sequences in the pantherine lineage of Felidae.
Mol. Biol. Evol.
12:690-707[Abstract].
|
| 12.
|
Jin, M. J.,
H. Hui,
D. L. Robertson,
M. C. Müller,
F. Barré-Sinoussi,
V. M. Hirsch,
J. S. Allan,
G. M. Shaw,
P. M. Sharp, and B. H. Hahn.
1994.
Mosaic genome structure of simian immunodeficiency virus from West African green monkeys.
EMBO J.
13:2935-2947[Medline].
|
| 13.
|
Johnson, W. E., and S. J. O'Brien.
1997.
Phylogenetic reconstruction of the Felidae using 16S rRNA and NADH-5 mitochondrial genes.
J. Mol. Evol.
44(Suppl.1):S98-S116.
|
| 14.
|
Kato, S.,
K. Matsuo,
N. Nishimura,
N. Takahashi, and T. Takano.
1987.
The entire nucleotide sequence of baboon endogenous virus DNA: a chimeric genome structure of murine type C and simian type D retroviruses.
Jpn. J. Genet.
62:127-137.
|
| 15.
|
Kimura, M. A.
1980.
A simple method for estimating evolutionary rate of base substitution through comparative studies of nucleotide sequences.
J. Mol. Evol.
16:111-120[Medline].
|
| 16.
|
Kumar, S.,
K. Tamura, and M. Nei.
1993.
MEGA: Molecular Evolutionary Genetics Analyses, version 1.02.
The Pennsylvania State University, University Park.
|
| 17.
|
Mang, R.,
J. Goudsmit, and A. C. van der Kuyl.
1999.
Novel endogenous type C retrovirus in baboons: complete sequence, providing evidence for baboon endogenous virus gag-pol ancestry.
J. Virol.
73:7021-7026[Abstract/Free Full Text].
|
| 18.
|
Overbaugh, J.,
N. Riedel,
E. A. Hoover, and J. I. Mullins.
1988.
Transduction of endogenous envelope genes by feline leukaemia virus in vitro.
Nature (London)
332:731-734[Medline].
|
| 19.
|
Reeves, R. H.,
W. G. Nash, and S. J. O'Brien.
1985.
Genetic mapping of endogenous RD-114 retroviral sequences of domestic cats.
J. Virol.
56:303-306[Abstract/Free Full Text].
|
| 20.
|
Reeves, R. H., and S. J. O'Brien.
1984.
Molecular genetic organization of the RD-114 gene family of endogenous feline retroviral sequences.
J. Virol.
52:164-171[Abstract/Free Full Text].
|
| 21.
|
Robertson, D. L.,
P. M. Sharp,
F. E. McCutchan, and B. H. Hahn.
1995.
Recombination in HIV-1.
Nature
374:124-126[Medline].
|
| 22.
|
Spodick, D. A.,
A. K. Ghosh,
S. Parimoo, and P. Roy-Burman.
1988.
The long terminal repeat of feline endogenous RD-114 retroviral DNAs: analysis of transcription regulatory activity and nucleotide sequence.
Virus Res.
9:263-283[Medline].
|
| 23.
|
Spodick, D. A.,
L. H. Soe, and P. Roy-Burman.
1984.
Genetic analysis of the feline RD-114 retrovirus related endogenous elements.
Virus Res.
1:543-555[Medline].
|
| 24.
|
Stewart, M. A.,
M. Warnock,
A. Wheeler,
N. Wilkie,
J. I. Mullins,
D. E. Onions, and J. C. Neil.
1986.
Nucleotide sequences of a feline leukemia virus subgroup A envelope gene and long terminal repeat and evidence for the recombinational origin of subgroup B viruses.
J. Virol.
58:825-834[Abstract/Free Full Text].
|
| 25.
|
Takezaki, N.,
A. Rzhetsky, and M. Nei.
1995.
Phylogenetic test of the molecular clock and linearized trees.
Mol. Biol. Evol.
12:823-833[Abstract].
|
| 26.
|
Van der Kuyl, A. C.,
J. T. Dekker, and J. Goudsmit.
1995.
Distribution of baboon endogenous virus among species of African monkeys suggests multiple ancient cross-species transmissions in shared habitats.
J. Virol.
69:7877-7887[Abstract].
|
| 27.
|
Van der Kuyl, A. C.,
R. Mang,
J. T. Dekker, and J. Goudsmit.
1997.
Complete nucleotide sequence of simian endogenous type D retrovirus with intact genome organization: evidence for ancestry to simian retrovirus and baboon endogenous virus.
J. Virol.
71:3666-3676[Abstract].
|
Journal of Virology, October 1999, p. 7994-8002, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Baillie, G. J., van de Lagemaat, L. N., Baust, C., Mager, D. L.
(2004). Multiple Groups of Endogenous Betaretroviruses in Mice, Rats, and Other Mammals. J. Virol.
78: 5784-5798
[Abstract]
[Full Text]
-
Bartosch, B., Weiss, R. A., Takeuchi, Y.
(2002). PCR-based cloning and immunocytological titration of infectious porcine endogenous retrovirus subgroup A and B. J. Gen. Virol.
83: 2231-2240
[Abstract]
[Full Text]
-
Huder, J. B., Boni, J., Hatt, J.-M., Soldati, G., Lutz, H., Schupbach, J.
(2002). Identification and Characterization of Two Closely Related Unclassifiable Endogenous Retroviruses in Pythons (Python molurus and Python curtus). J. Virol.
76: 7607-7615
[Abstract]
[Full Text]
-
Lee, J.-H., Webb, G. C., Allen, R. D. M., Moran, C.
(2002). Characterizing and Mapping Porcine Endogenous Retroviruses in Westran Pigs. J. Virol.
76: 5548-5556
[Abstract]
[Full Text]
-
Marin, M., Tailor, C. S., Nouri, A., Kabat, D.
(2000). Sodium-Dependent Neutral Amino Acid Transporter Type 1 Is an Auxiliary Receptor for Baboon Endogenous Retrovirus. J. Virol.
74: 8085-8093
[Abstract]
[Full Text]