Previous Article | Next Article 
Journal of Virology, October 1999, p. 7988-7993, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Regulation of Closterovirus Gene Expression Examined by Insertion
of a Self-Processing Reporter and by Northern Hybridization
Yuka
Hagiwara,1
Valery V.
Peremyslov,1 and
Valerian V.
Dolja1,2,*
Department of Botany and Plant
Pathology1 and Center for Gene Research
and Biotechnology,2 Oregon State University,
Corvallis, Oregon 97331
Received 6 April 1999/Accepted 2 July 1999
 |
ABSTRACT |
A reporter open reading frame (ORF) coding for a fusion of
bacterial 
-glucuronidase (GUS) with a proteinase domain (Pro) derived from tobacco etch potyvirus was utilized for tagging individual genes of beet yellows closterovirus (BYV). Insertion of this reporter ORF between the first and second codons of the BYV ORFs encoding the
HSP70 homolog (HSP70h), a major capsid protein (CP), and a 20-kDa
protein (p20) resulted in the expression of the processed GUS-Pro
reporter from corresponding subgenomic RNAs. The high sensitivity of
GUS assays permitted temporal analysis of reporter accumulation,
revealing early expression from the HSP70h promoter, followed by the CP
promoter and later the p20 promoter. The kinetics of transcription of
the remaining BYV genes encoding a 64-kDa protein (p64), a minor capsid
protein (CPm), and a 21-kDa protein (p21) were examined via Northern
blot analysis. Taken together, the data indicated that the temporal
regulation of BYV gene expression includes early (HSP70h, CPm, CP, and
p21 promoters) and late (p64 and p20 promoters) phases. It was also
demonstrated that the deletion of six viral genes that are nonessential
for RNA amplification resulted in a dramatic increase in the level of
transcription from one of the two remaining subgenomic promoters.
Comparison with other positive-strand RNA viruses producing multiple
subgenomic RNAs showed the uniqueness of the pattern of closterovirus
transcriptional regulation.
| |
INTRODUCTION |
A variety of evolutionary dissimilar
positive-strand RNA viruses employ the formation of subgenomic RNAs
(sgRNAs) as a major strategy for gene expression (23). The
sgRNAs are normally formed via partial transcription of the genomic
minus strand (5, 26, 29). In the viruses producing multiple
species of sgRNA, the kinetics and/or levels of sgRNA accumulation are
transcriptionally regulated (e.g., see references 5, 9, 20,
25, 30, 35, and 36).
The family Closteroviridae belongs to the Sindbis virus-like
supergroup of positive-strand RNA viruses (13). Large
closterovirus genomes possess from 9 to 12 open reading frames (ORFs)
(37); two of these ORFs (1a and 1b; Fig.
1A) are translated from the genomic RNA,
whereas the remaining ORFs are expressed via the formation of a nested
set of sgRNAs (10, 16-18, 21). A recent study of the
kinetics of accumulation of four citrus tristeza closterovirus (CTV)
sgRNAs revealed temporal control of CTV transcription (30).
In addition to sgRNAs, closteroviruses possess defective RNAs, some of
which were proposed to originate via recombination between genomic RNA
and sgRNAs (6).
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Tagging of BYV by insertion of the self-processing
reporter. (A) Diagram of the BYV genome with ORFs 1a to 8 encoding
leader proteinase (L-Pro), replication-associated proteins harboring
putative methyltransferase (MET), RNA helicase (HEL), and RNA
polymerase (POL) domains; p6; HSP70h; p64; CPm; CP; p20; and p21. The
bottom part of panel A depicts a reporter GUS-Pro ORF encoding a fusion
of GUS with Pro derived from TEV. Large vertical arrows indicate the
sites of reporter insertion into BYV cDNA clone and the names of the
resulting plasmids. Smaller rounded arrows designate the
self-processing sites for the BYV L-Pro and reporter GUS-Pro. (B)
Diagram of the deletion variant pBYV-GUS-p21. The designations are the
same as those for panel A, except for the arrows marked CP and p21,
which show the approximate positions of the 5' termini of the sgRNAs
driven by the CP and p21 promoters.
|
|
In this study, we utilized a prototype closterovirus, beet yellows
virus (BYV), that possesses a 15.5-kb genomic RNA and at least six
3'-coterminal sgRNAs expressing ORFs 3 to 8 (Fig. 1A) (10, 16,
31). It is not fully established whether the expression of ORF 2 coding for a small hydrophobic 6-kDa protein (p6) involves the
formation of an additional, seventh sgRNA species. BYV ORFs 3 through 8 encode an HSP70 homolog (HSP70h), a 64-kDa protein (p64), minor and
major capsid proteins (CPm and CP, respectively), a 20-kDa protein
(p20), and a 21-kDa protein (p21) (Fig. 1A) (1). Filamentous
particles of BYV are composed of a body and a short tail made of the CP
and CPm (3). It has been demonstrated that p21 is required
for efficient amplification of BYV RNA (31), whereas
indirect experiments suggested involvement of the HSP70h in viral
cell-to-cell movement (2, 19, 28). The functions of p6, p64,
and p20 are obscure.
To further investigate transcriptional regulation in closteroviruses,
we used tobacco protoplasts transfected with RNA derived from a cDNA
clone of BYV (31). The kinetics of accumulation of genomic
RNA and three sgRNAs were examined by using Northern blot analysis. In
addition, gene expression involving the most active CP promoter and the
least active promoters controlling production of HSP70h and p20 was
analyzed by using a self-cleaving reporter protein. Since the reporter
possessed -glucuronidase (GUS) activity, very sensitive GUS assays
allowed detection of gene expression at the early phases of viral
reproduction. The combination of these two approaches allowed us to
reveal the closterovirus gene expression profile and to compare this
profile to that of coronaviruses, another family of RNA viruses
producing multiple sgRNAs (25).
| |
MATERIALS AND METHODS |
Engineering of BYV cDNA clones tagged by insertion of the
reporter ORF.
Previously described full-length cDNA clone pBYV-NA
and its partial derivatives p65M and p3'-BYV were used throughout this study (31). Recognition sites for restriction endonucleases ApaI and BstEII were introduced between the first
and second codons of ORFs 3, 6, and 7 by using site-directed
mutagenesis (24). Oligonucleotide 65-ABst
(5'-CGGTCGTGTGATGGGGCCCACTGGTAACCAAGTTGTTTTCGGATTAG; the underlined nucleotides here and thereafter represent
restriction endonuclease sites) and plasmid p65M were used to mutate
ORF 3, whereas oligonucleotides CP-ABst
(5'-TTGAGTTTCGTTATGGGGCCCACTGGTAACCTCGAACCTATAAGTGC) and 20-ABst
(5'-CACCGGAAAATGACTGGGCCCACTGGTAACCACTCTGTCGAACTAGC) were used to modify ORFs 6 and 7 present in p3'-BYV. The
mutations were verified by nucleotide sequencing.
The GUS ORF was PCR amplified with primers 5GUS-Apa
(5'-GAT
GGGCCCATGGTCCGTCCT) and 3GUS-Avr
(5'-CT
CCTAGGATTTGTTTGCCTCCC),
possessing
ApaI and
AvrII sites, respectively, and
pTEV7D-GUS.HC
as a template (
11). The proteinase domain
(Pro) of tobacco etch
potyvirus (TEV) HC-Pro (
7) specified
by TEV nucleotides (nt)
1966 to 2436 (
4) was amplified with
the same template; the
primers were 5PPAvr
(5'-CG
CCTAGGTAAGGCTCAATATTC) and Pro-Bst
(5'-GC
GGTTACCTCCAACATTGTAAGT).
Restriction
endonuclease sites
AvrII and
BstEII were
incorporated
into these
primers.
To insert DNA fragments encoding two parts of the fusion reporter
GUS-Pro into each of ORFs 3, 6, and 7, the three mutant
plasmids were
digested with
ApaI and
BstEII, whereas
PCR-amplified
DNA harboring GUS and Pro ORFs were digested with
ApaI plus
AvrII
and
AvrII plus
BstEII, respectively. Ligation of the DNA fragments
into the
corresponding vectors resulted in generation of p65M-GUS-Pro-HSP70h,
p3'-BYV-GUS-Pro-CP, and p3'-BYV-GUS-Pro-p20. Each mutant fragment
harboring the GUS-Pro ORF fused in frame with ORF 3, 6, or 7 was
cloned
into the full-length clone as described previously (
31).
The
resulting pBYV-NA derivatives were designated as pBYV-HSP70hGUS,
pBYV-CPGUS, and pBYV-p20GUS to indicate that the GUS-Pro reporter
is
positioned under the control of the BYV promoters directing
expression
of HSP70h, CP, and p20, respectively (Fig.
1A).
The recombinant variant pBYV-GUS-p21 was engineered by modification of
the pBYV-CPGUS. The DNA fragments from the ORF 2 start
codon to the
BamHI site at nt 13392 and from the
AvrII site at
the 3' end of GUS ORF 6 to the
HpaI site at nt 14407 were
deleted
(Fig.
1A and B). As a result, BYV ORFs 2 to 7 were deleted,
whereas
GUS was expressed under the control of the ORF 6 (CP) promoter
(Fig.
1B).
Analyses of RNA accumulation and gene expression.
The in
vitro RNA transcription was conducted in 50-µl reaction mixtures with
SmaI-linearized plasmids and SP6 RNA polymerase as described
previously (31). The reaction mixtures containing ~50 µg
of the RNA transcripts were used to transfect, via electroporation, the
protoplasts (~4 × 106 cells per transfection)
obtained from a suspension culture of Nicotiana tabacum cv.
Xanthi nc cell line DF (14). Protoplast samples were
harvested after 86 h of incubation at room temperature or at the
times specified for time course experiments. The RNA samples were
isolated by using TRIZOL reagent (Gibco-BRL), and Northern
hybridization analysis was performed as previously described (31). The 32P-labeled single-stranded RNA probe
of negative polarity was prepared by in vitro transcription by using T7
RNA polymerase and p3'-BYV linearized at the BamHI site
(31). The radiolabeled products were detected and quantified
using a PhosphorImager (Molecular Dynamics) and ImageQuant, version 5, software package. Four independent protoplast transfections were
conducted with each BYV variant in each experiment; means and standard
deviations were used to compare the accumulations of the genomic RNA
and sgRNAs.
GUS activity in protoplasts was assayed as described before
(
8). Since the levels of GUS-Pro reporter expression driven
by the ORF 3, 6, or 7 promoter were very different (see Results),
these
levels were expressed as percentages of the maximal expression
levels
for each variant. This approach allowed us to compare temporal
activity
patterns of the three promoters with the same scale.
Four independent
transfections per variant were included in each
experiment.
Accumulation of the BYV CP in transfected protoplasts
was examined by
immunoblot analysis with a 1:1,000 dilution of
the anti-BYV serum (a
gift from Bryce W. Falk, University of California
Davis)
as described
before (
12).
| |
RESULTS |
Generation and characterization of the tagged BYV variants.
Although the complex regulation of closterovirus transcription has been
revealed via Northern hybridization (16, 17, 30, 31), the
low abundance of some RNA species impeded comprehensive analysis of
this process. For instance, the time course analysis of the CTV sgRNA
encoding HSP70h proved impractical (30), while the BYV sgRNA
expressing p20 escaped detection (16). To circumvent these
obstacles, we tagged selected subgenomic promoters by insertion of a
reporter ORF whose expression permitted sensitive and specific detection of the promoters' activities.
Reporter protein was engineered by fusing GUS with a potyviral Pro. The
chimeric GUS-Pro ORF was inserted between the first
and second codons
of the ORFs encoding HSP70h, CP, and p20, resulting
in plasmids
pBYV-HSP70hGUS, pBYV-CPGUS, and pBYV-p20GUS, respectively
(Fig.
1A). This design permitted expression of the reporter and
original
viral product from a single expression unit. Autoproteolytic
activity
of Pro resulted in cleavage between GUS-Pro and the corresponding
viral
protein. This cleavage was efficient, since only the free
form of
GUS-Pro was detected in transfected protoplasts by using
anti-GUS serum
(data not
shown).
In vitro GUS assays conducted at 4 days posttransfection (d.p.t.)
demonstrated that tagged BYV variants expressed an enzymatically
active
reporter. As expected, the highest level of GUS activity
was produced
by CPGUS, the variant in which reporter expression
was driven by the
strongest subgenomic promoter. The levels of
GUS activity produced by
the p20GUS and HSP70hGUS variants were
only 5.1% ± 1.3% and 2.3% ± 0.6% of that produced by the CPGUS
variant, respectively,
demonstrating very low relative activities
of the p20 and HSP70h
promoters. The background level of GUS activity
in protoplasts
transfected by the wild-type BYV-NA variant lacking
a GUS ORF was less
than 5% of that found for the HSP70hGUS variant
(data not
shown).
Kinetics of gene expression driven by the tagged promoters.
The high sensitivity and specificity of the GUS assays permitted
a comparative study of the kinetics of reporter expression in tagged
BYV variants. Figure 2 illustrates the
results of a typical experiment. The GUS activity induced by the
HSP70hGUS and CPGUS variants was first detected at 1.5 d.p.t. In
contrast, the p20GUS variant started to produce GUS only at 2 to
2.5 d.p.t. A comparative analysis over the 5-day period revealed
that the earliest relative increase in GUS activity was produced by the HSP70h promoter, followed by the CP promoter and the p20 promoter (Fig.
2). These observations allowed us to roughly classify HSP70h and CP
promoters as early and the p20 promoter as late.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Kinetics of GUS activity accumulation in protoplasts
transfected by the three tagged BYV variants. The activity is expressed
as a percentage of the absolute maximum for each variant. The means and
standard deviations from four independent transfections were used to
generate the graph.
|
|
Accumulation of the genomic RNA and sgRNAs in wild-type BYV.
The kinetics of accumulation of the genomic RNA and sgRNAs transcribed
from the p64, CPm, and p21 promoters were compared by using the
wild-type pBYV-NA variant and Northern hybridization analysis.
Quantitation of the sgRNAs encoding HSP70h, CP, and p20 was hampered by
the high background in corresponding regions of the membrane (see Fig.
6).
The input RNA transcripts detectable in protoplasts at time zero
declined on day 1; then a gradual increase in genomic RNA
levels due to
replication continued until day 5 (Fig.
3). The
accumulation pattern of the p64
sgRNA followed that of the genomic
RNA, although with a significant
delay (Fig.
3). Dramatically
different temporal patterns were seen for
the p21 and CPm sgRNAs.
The relative level of the p21 sgRNA species
approached its maximum
at day 2, then declined, and roughly leveled at
~50% of the maximum
(Fig.
3). Similar kinetics were observed for the
CPm sgRNA until
day 3; at the later times, this RNA species continued
to accumulate,
approaching its maximum at day 5. The significance of a
decline
in the levels of p21 and CPm sgRNAs that was reproducibly
observed
at ~2.5 d.p.t. awaits further experimentation. Taken
together,
these data permit us to define p21 and CPm promoters as early
and the p64 promoter as late.
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
Kinetics of accumulation of the genomic RNA and three
sgRNAs encoding p64, CPm, and p21 in protoplasts transfected by
wild-type BYV transcripts. The RNA levels are expressed as percentages
of the absolute maximum for each variant. Northern hybridization and a
32P-labeled RNA probe of negative polarity were used to
detect and quantify RNA species. The means and standard deviations from
four independent transfections were used to generate the graph.
|
|
To correlate the data obtained with the tagged and nontagged BYV
variants, we analyzed the accumulation of CP directed by
wild-type BYV.
As illustrated in Fig.
4, CP was detected
at 1.5
d.p.t., increased until day 3, and reached a plateau at
later
times. This pattern parallels that of GUS accumulation driven
by
the CP promoter in the CPGUS variant for at least 3 d.p.t.
Hence,
comparison of Fig.
2,
3, and
4 permits a conditional delineation
of the
two classes of BYV promoters according to the temporal
control of their
expression. The early promoters include HSP70h,
CPm, CP, and p21, while
the late promoters are p64 and p20. The
maximal relative levels reached
by the genomic RNA and sgRNA species
are shown in Fig.
5. Its comparison with the genome map
(Fig.
1A) indicates no simple correlation between these levels and
genome
positions of corresponding sgRNA promoters.
View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Immunoblot analysis of the CP accumulation in
protoplasts transfected by the wild-type BYV transcripts. M, sample
obtained from mock-inoculated protoplasts at 5 d.p.t.; V, capsid
protein standard derived from purified and dissociated BYV virions.
|
|
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
Relative levels of the genomic RNA and sgRNA species at
their respective maxima. The protoplasts were transfected by the
wild-type RNA transcripts. The sgRNAs are designated in accord with
their coding specificity and presented in order from 5' to 3' (see Fig.
1A). The levels of genomic RNA and sgRNAs encoding HSP70h, p64, CPm,
and CP were determined at 5 d.p.t., whereas that of p21 sgRNA was
measured at 2 d.p.t. Black bars show standard deviations. ND, not
determined. Although sgRNA encoding p20 is visible on Northern blots,
its quantitation is impractical due to a high background.
|
|
Comparative analysis of the four BYV variants.
In order to
reveal effects on viral replication and transcription imposed by
insertion of the 2.3-kb reporter ORF, we compared the wild-type and
tagged BYV variants at ~4 d.p.t. by using Northern hybridization
analysis. The levels of genomic RNAs and of the two sgRNAs derived from
the CP and p21 promoters were quantified. Only these three RNA species
can be confidently traced among the tagged variants (Fig.
6). It was found that insertion of the
reporter ORF resulted in decreased accumulation of the genomic RNAs in the HSP70hGUS, CPGUS, and p20GUS variants (Fig. 6 and Table
1). Surprisingly, accumulation of the
sgRNAs was affected differentially. In the HSP70hGUS variant, the
levels of the CP and p21 sgRNAs were close to those of the wild type
(Table 1). In the CPGUS and p20GUS variants, the levels of the CP sgRNA
decreased roughly proportionally to those of the genomic RNAs, whereas
accumulation of the p21 sgRNA was affected to a lesser extent (Fig. 6
and Table 1).
View larger version (53K):
[in this window]
[in a new window]
|
FIG. 6.
Northern hybridization analysis of the RNAs derived from
protoplasts at 86 h posttransfection. The types of the RNA
transcripts used are shown on the top. Four lanes for each variant
correspond to independent transfections. The RNA probe was the same as
that described in the legend for Fig. 3. Positions of the genomic (g)
RNAs and sgRNAs encoding HSP70h (hsp), p64, CPm (cpm), CP (cp), p20,
and p21 corresponding to the wild-type transfection are shown at the
left. WT, wild-type transcripts derived from pBYV-NA clone; int,
intermediate-sized, probably defective RNA (6, 31).
Asterisks designate the background bands corresponding to plant rRNAs
(31). Note that the bands of the CP sgRNAs for the wild-type
and HSP70hGUS variants overlap the band of smaller rRNA. The
designation  cp shows the position of the sgRNA derived from the
CP promoter for the CPGUS and p20GUS variants. The designations on the
right indicate positions of the genomic RNA and sgRNAs for the GUS-p21
variant; `cp' corresponds to the GUS-encoding sgRNA derived from the
CP promoter. The genomic RNAs and sgRNAs derived from the CP and p21
promoters are quantified in Table 1. The sizes of the genomic RNAs are
15.5 kb for the wild type, 17.8 kb for HSP70hGUS, CPGUS, and p20GUS
variants, and 12.6 kb for the GUS-p21 variant. The estimated sizes of
the sgRNAs in the wild-type BYV (16) are as follows: 6.1 kb
(hsp), 4.4 kb (p64), 2.6 kb (cpm), 1.8 kb (cp), 1.2 kb (p20), and 0.8 kb (p21). The size of the CP sgRNA in CPGUS and p20GUS variants is 4.1 kb, whereas the size of the sgRNA expressing GUS under the control of
the CP promoter (`cp') is 2.8 kb.
|
|
To assess the impact of genome truncation on RNA amplification and
transcription, we used a deletion variant pBYV-GUS-p21
derived from
pBYV-CPGUS. This variant possessed only two of six
BYV promoters: GUS
was expressed by using the CP subgenomic promoter,
while p21 ORF
remained under the control of its natural promoter
(Fig.
1B). ORFs 2 to
7 but not 8 were deleted, since the expression
of p6, HSP70h, p64, CPm,
CP, and p20 is not essential for replication,
whereas p21 is required
for efficient accumulation of the RNA
(
31).
Northern hybridization analysis demonstrated that the level of genomic
RNA in protoplasts transfected by using pBYV-GUS-p21
transcripts was
five times higher than that for the parental CPGUS
variant (Fig.
6 and
Table
1). This profound increase in replication
can be attributed to
the ~30% decrease in the genome size (17.8
kb in CPGUS versus 12.6 kb in GUS-p21) and/or to the deletion
of four sgRNA promoters that
could compete for the replicase with
the origins for genomic RNA
synthesis. Comparison of the GUS-p21
variant to the wild-type virus
showed similar accumulation of
the genomic RNA and p21 sgRNA,
whereas the level of the sgRNA
produced by the CP promoter had risen
almost fourfold (Table
1).
The GUS activity in GUS-p21-transfected
protoplasts can be reliably
detected at 1 d.p.t. (data not shown),
indicating that truncation
of the genome resulted in an earlier
expression from the CP
promoter.
| |
DISCUSSION |
Tagging of the BYV ORFs by insertion of the self-processing
reporter combined with traditional hybridization analysis allowed us to
reveal a complex pattern of transcriptional regulation in a prototype
closterovirus. Comparison of the GUS expression under the control of
three subgenomic promoters demonstrated earliest activation of the
HSP70h and CP promoters and a delayed activation of the p20 promoter.
Since the direct quantitation of sgRNAs expressing HSP70h, CP, and p20
was problematic, the utilization of reporter activity offered a more
reliable approach for the analysis of these promoters' regulation. The
potential drawback of this system, however, is the high stability of
GUS that may result in masking the fine details of regulation.
Hybridization analysis of the remaining three sgRNAs revealed an early
and relatively fast accumulation of the p21 and CPm sgRNAs in contrast
to a much slower accumulation of the p64 sgRNA. Indeed, the latter RNA
species reached 50% of its maximal level after 3 d.p.t., whereas
p21 and CPm sgRNAs reached that level before 1.5 d.p.t. A decline
in the levels of these two sgRNAs seen at 2.5 d.p.t. adds further
complexity to corresponding patterns of temporal regulation. Although
direct superposition of the results obtained with tagged and nontagged
viruses would be incorrect, the same timing of product appearance
driven by the CP promoter in the wild-type virus and in the CPGUS
variant allows one to relate these two experimental systems. Hence, we
can classify the HSP70h, CPm, CP, and p21 promoters as early and the
p64 and p20 promoters as late. It is obvious that the order of promoter activation does not correspond to the order of the ORFs in the BYV
genome (Fig. 1A).
The pattern of temporal regulation of multiple transcriptional units
demonstrated here for a closterovirus is unique among RNA viruses.
Animal coronaviruses that also possess large RNA genomes and produce
multiple sgRNAs exhibit no temporal regulation of the transcription
(5, 25, 35). It should be remembered, however, that the time
scale of coronavirus reproduction is within hours, compared to days for
closteroviruses. Among plant viruses producing more than one sgRNA, no
temporal regulation was found for two sgRNAs of turnip crinkle
carmovirus (36). Strikingly, the plant tobamovirus that also
expresses two sgRNAs does regulate the timing of their accumulation
(9).
What is common among diverse groups of positive-strand RNA viruses is
tight quantitative regulation of subgenomic promoter activities.
Several elegant studies have previously demonstrated the roles of the
core promoter and additional elements located in adjacent regions of
the template (e.g., see references 15, 20, 22, 27, 29,
33, and 36) or even on a distinct RNA
molecule (34) in regulating transcription levels. Promoter strength was also shown to depend on the location of the promoter and
the presence of additional subgenomic promoters (9, 35). It
seems that all these factors modulate closterovirus transcription as
well. First, the CP promoter remains the strongest among BYV promoters
even though its position varies among four analyzed variants.
Specifically, the distance of this promoter from the 3' end of genomic
RNA is 1.8 kb in the wild-type and HSP70hGUS variants, 4.1 kb in the
CPGUS and p20GUS variants, and 2.8 kb in the GUS-p21 variant. Second,
the activity of the CP promoter decreases in CPGUS and p20GUS but not
in HSP70hGUS, likely due to the increased distance from the 3' end in
the first two variants but not in the last variant. Third, the deletion
of the adjacent promoters in the truncated GUS-p21 variant results in a
dramatic activation of the CP promoter even though it is located
farther from the 3' end than in the wild-type virus.
The ability of BYV to accommodate a 2.3-kb reporter ORF at different
positions of the genome demonstrates its utility as a high-capacity
gene expression vector. A potential advantage provided by a
self-processing reporter is the production of a reporter and a viral
product from the same expression unit that minimizes modification of a
virus genetic makeup. Preservation of all genes and control regions in
a tagged virus appears to be advantageous for studies of viral
replication, assembly, and translocation (11, 32).
| |
ACKNOWLEDGMENTS |
We thank William Dawson, Theo Dreher, and Bryce Falk for critical
reading of the manuscript. The participation of Amit Gal-On in the
generation of GUS-tagged BYV variants is greatly appreciated.
This work was supported by grants from the National Institutes of
Health (R1GM53190B) and the U.S. Department of Agriculture (NRICGP
97-35303-4515) to V.V.D.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Botany and Plant Pathology, Oregon State University, Cordley Hall 2082, Corvallis, OR 97331. Phone: (541) 737-5472. Fax: (541) 737-3573. E-mail: doljav{at}bcc.orst.edu.
| |
REFERENCES |
| 1.
|
Agranovsky, A. A.,
V. P. Boyko,
A. V. Karasev,
N. A. Lunina,
E. V. Koonin, and V. V. Dolja.
1991.
Nucleotide sequence of the 3'-terminal half of beet yellows closterovirus RNA genome: unique arrangement of eight virus genes.
J. Gen. Virol.
72:15-23[Abstract/Free Full Text].
|
| 2.
|
Agranovsky, A. A.,
A. S. Folimonov,
S. Y. Folimonova,
S. Y. Morozov,
J. Schieman,
D. Lesemann, and J. G. Atabekov.
1998.
Beet yellows closterovirus HSP70-like protein mediates the cell-to-cell movement of a potexvirus transport-deficient mutant and a hordeivirus-based chimeric virus.
J. Gen. Virol.
79:889-895[Abstract].
|
| 3.
|
Agranovsky, A. A.,
D. E. Lesemann,
E. Maiss,
R. Hull, and J. G. Atabekov.
1995.
"Rattlesnake" structure of a filamentous plant RNA virus built of two capsid proteins.
Proc. Natl. Acad. Sci. USA
92:2470-2473[Abstract/Free Full Text].
|
| 4.
|
Allison, R.,
R. E. Johnston, and W. G. Dougherty.
1986.
The nucleotide sequence of the coding region of tobacco etch virus genomic RNA: evidence for a synthesis of a single polyprotein.
Virology
154:9-20[Medline].
|
| 5.
|
An, S.,
A. Maeda, and S. Makino.
1998.
Coronavirus transcription early in infection.
J. Virol.
72:8517-8524[Abstract/Free Full Text].
|
| 6.
|
Bar-Joseph, M.,
G. Yang,
R. Gafni, and M. Mavassi.
1997.
Subgenomic RNAs: the possible building blocks for modular recombination of Closteroviridae genomes.
Semin. Virol.
8:113-119.
|
| 7.
|
Carrington, J. C.,
S. M. Cary,
T. D. Parks, and W. G. Dougherty.
1989.
A second proteinase encoded by a plant potyvirus genome.
EMBO J.
8:365-370[Medline].
|
| 8.
|
Carrington, J. C., and D. D. Freed.
1990.
Cap-independent enhancement of translation by a plant potyvirus 5' nontranslated region.
J. Virol.
64:1590-1597[Abstract/Free Full Text].
|
| 9.
|
Dawson, W. O., and K. M. Lehto.
1990.
Regulation of tobamovirus gene expression.
Adv. Virus Res.
38:307-342[Medline].
|
| 10.
|
Dolja, V. V.,
A. V. Karasev, and A. A. Agranovsky.
1990.
Organization of beet yellows closterovirus genome, p. 31-35.
In
F. X. Heinz, and M. A. Brinton (ed.), New aspects of positive-strand RNA viruses. American Society for Microbiology, Washington, D.C.
|
| 11.
|
Dolja, V. V.,
H. J. McBride, and J. C. Carrington.
1992.
Tagging of plant potyvirus replication and movement by insertion of -glucuronidase (GUS) into the viral polyprotein.
Proc. Natl. Acad. Sci. USA
89:10208-10212[Abstract/Free Full Text].
|
| 12.
|
Dolja, V. V.,
K. L. Herndon,
T. P. Pirone, and J. C. Carrington.
1993.
Spontaneous mutagenesis of a plant potyvirus genome after insertion of a foreign gene.
J. Virol.
67:5968-5975[Abstract/Free Full Text].
|
| 13.
|
Dolja, V. V.,
A. V. Karasev, and E. V. Koonin.
1994.
Molecular biology and evolution of closteroviruses: sophisticated build-up of large RNA genomes.
Annu. Rev. Phytopathol.
32:261-285.
|
| 14.
|
Dolja, V. V.,
J. Hong,
K. E. Keller,
R. R. Martin, and V. V. Peremyslov.
1997.
Suppression of potyvirus infection by coexpressed closterovirus protein.
Virology
234:243-252[Medline].
|
| 15.
|
French, R., and P. Ahlquist.
1988.
Characterization and engineering of sequences controlling in vivo synthesis of brome mosaic virus subgenomic RNA.
J. Virol.
62:2411-2420[Abstract/Free Full Text].
|
| 16.
|
He, X.-H.,
A. L. N. Rao, and R. Creamer.
1997.
Characterization of beet yellows closterovirus-specific RNAs in infected plants and protoplasts.
Phytopathology
87:347-352[Medline].
|
| 17.
|
Hilf, M. E.,
A. V. Karasev,
H. R. Pappu,
D. J. Gumpf,
C. L. Niblett, and S. M. Garnsey.
1995.
Characterization of citrus tristeza virus subgenomic RNAs in infected tissue.
Virology
208:576-582[Medline].
|
| 18.
|
Karasev, A. V.,
M. E. Hilf,
S. M. Garnsey, and W. O. Dawson.
1997.
Transcriptional strategy of closteroviruses: mapping the 5' termini of the citrus tristeza virus subgenomic RNAs.
J. Virol.
71:6233-6236[Abstract].
|
| 19.
|
Karasev, A. V.,
A. S. Kashina,
V. I. Gelfand, and V. V. Dolja.
1992.
HSP70-related 65 kDa protein of beet yellows closterovirus is a microtubule-binding protein.
FEBS Lett.
304:12-14[Medline].
|
| 20.
|
Kim, K.-H., and C. Hemenway.
1997.
Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.
Virology
232:187-197[Medline].
|
| 21.
|
Klaassen, V. A.,
M. Boeshore,
E. V. Koonin,
T. Tian, and B. W. Falk.
1995.
Genome structure and phylogenetic analysis of lettuce infectious yellows virus, a whitefly transmitted, bipartite closterovirus.
Virology
208:99-110[Medline].
|
| 22.
|
Koev, G.,
B. R. Mohan, and W. A. Miller.
1999.
Primary and secondary structural elements required for synthesis of barley yellow dwarf virus subgenomic RNA1.
J. Virol.
73:2876-2885[Abstract/Free Full Text].
|
| 23.
|
Koonin, E. V., and V. V. Dolja.
1993.
Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences.
Crit. Rev. Biochem. Mol. Biol.
28:375-430[Medline].
|
| 24.
|
Kunkel, T. A.,
J. D. Roberts, and R. Zakour.
1987.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Methods Enzymol.
154:367-382[Medline].
|
| 25.
|
Lai, M. M. C., and D. Cavanagh.
1997.
The molecular biology of coronaviruses.
Adv. Virus Res.
48:1-100.
|
| 26.
|
Levis, R.,
S. Schlesinger, and H. V. Huang.
1990.
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
J. Virol.
64:1726-1733[Abstract/Free Full Text].
|
| 27.
|
Marsh, L. E.,
T. W. Dreher, and T. C. Hall.
1988.
Mutational analysis of the core and modulator sequences of the BMV RNA 3 subgenomic promoter.
Nucleic Acids Res.
16:981-985[Abstract/Free Full Text].
|
| 28.
|
Medina, V.,
V. V. Peremyslov,
Y. Hagiwara, and V. V. Dolja.
1999.
Subcellular localization of the HSP70-homolog encoded by beet yellows closterovirus.
Virology
260:173-181[Medline].
|
| 29.
|
Miller, W. A.,
T. W. Dreher, and T. C. Hall.
1985.
Synthesis of brome mosaic virus subgenomic RNA in vitro by internal initiation on ( )-sense genomic RNA.
Nature (London)
313:68-70[Medline].
|
| 30.
|
Navas-Castillo, J.,
M. R. Albiach-Marti,
S. Gowda,
M. Hilf,
S. M. Garnsey, and W. O. Dawson.
1997.
Kinetics of accumulation of citrus tristeza virus RNAs in host and non-host protoplasts.
Virology
228:92-97[Medline].
|
| 31.
|
Peremyslov, V. V.,
Y. Hagiwara, and V. V. Dolja.
1998.
Genes required for replication of the 15.5-kilobase RNA genome of a plant closterovirus.
J. Virol.
72:5870-5876[Abstract/Free Full Text].
|
| 32.
|
Santa Cruz, S.,
S. Chapman,
A. G. Roberts,
I. M. Roberts,
D. A. M. Prior, and K. J. Oparka.
1996.
Assembly and movement of a plant virus carrying a green fluorescent protein overcoat.
Proc. Natl. Acad. Sci. USA
93:6286-6290[Abstract/Free Full Text].
|
| 33.
|
Siegel, R. W.,
S. Adkins, and C. C. Kao.
1997.
Sequence-specific recognition of a subgenomic RNA promoter by a viral RNA polymerase.
Proc. Natl. Acad. Sci. USA
94:11238-11243[Abstract/Free Full Text].
|
| 34.
|
Sit, T. L.,
A. A. Vaewhongs, and S. A. Lommel.
1998.
RNA-mediated transactivation of transcription from a viral RNA.
Science
281:829-832[Abstract/Free Full Text].
|
| 35.
|
van Marle, G.,
W. Luytjes,
R. van der Most,
T. van der Straaten, and W. J. Spaan.
1995.
Regulation of coronavirus mRNA transcription.
J. Virol.
69:7851-7856[Abstract].
|
| 36.
|
Wang, J., and A. E. Simon.
1997.
Analysis of the two subgenomic RNA promoters for turnip crinkle virus in vivo and in vitro.
Virology
232:174-186[Medline].
|
| 37.
|
Zhu, H.-Y.,
K.-S. Ling,
D. E. Goszczynski,
J. R. McFerson, and D. Gonsalves.
1998.
Nucleotide sequence and genome organization of grapevine leafroll-associated virus-2 are similar to beet yellows virus, the closterovirus type member.
J. Gen. Virol.
79:1289-1298[Abstract].
|
Journal of Virology, October 1999, p. 7988-7993, Vol. 73, No. 10
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Peng, C.-W., Napuli, A. J., Dolja, V. V.
(2003). Leader Proteinase of Beet Yellows Virus Functions in Long-Distance Transport. J. Virol.
77: 2843-2849
[Abstract]
[Full Text]
-
Kreuze, J. F., Savenkov, E. I., Valkonen, J. P. T.
(2002). Complete Genome Sequence and Analyses of the Subgenomic RNAs of Sweet Potato Chlorotic Stunt Virus Reveal Several New Features for the Genus Crinivirus. J. Virol.
76: 9260-9270
[Abstract]
[Full Text]
-
Peng, C.-W., Peremyslov, V. V., Mushegian, A. R., Dawson, W. O., Dolja, V. V.
(2001). Functional Specialization and Evolution of Leader Proteinases in the Family Closteroviridae. J. Virol.
75: 12153-12160
[Abstract]
[Full Text]
-
Peng, C.-W., Dolja, V. V.
(2000). Leader Proteinase of the Beet Yellows Closterovirus: Mutation Analysis of the Function in Genome Amplification. J. Virol.
74: 9766-9770
[Abstract]
[Full Text]
-
Peremyslov, V. V., Hagiwara, Y., Dolja, V. V.
(1999). HSP70 homolog functions in cell-to-cell movement of a plant virus. Proc. Natl. Acad. Sci. USA
96: 14771-14776
[Abstract]
[Full Text]
Top
Abstract
Introduction
