Previous Article | Next Article 
Journal of Virology, January 1999, p. 826-833, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Transcriptional Activation Signals Found in the Epstein-Barr
Virus (EBV) Latency C Promoter Are Conserved in the Latency C
Promoter Sequences from Baboon and Rhesus Monkey EBV-Like
Lymphocryptoviruses (Cercopithicine Herpesviruses 12 and
15)
Ezequiel M.
Fuentes-Pananá,1
Sankar
Swaminathan,2 and
Paul
D.
Ling1,*
Division of Molecular Virology, Baylor
College of Medicine, Houston, Texas 77030,1 and
Sealy Center for Oncology and Hematology and Division of
Infectious Diseases, Department of Internal Medicine, University of
Texas Medical Branch, Galveston, Texas
77555-10482
Received 10 August 1998/Accepted 7 October 1998
 |
ABSTRACT |
The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional
activator that controls viral latent gene expression and is essential
for EBV-driven B-cell immortalization. EBNA2 is expressed from the
viral C promoter (Cp) and regulates its own expression by
activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of
latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV
genome (
1079 to +144 relative to the transcription initiation site)
from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the
approximately 1,230-bp Cp regions from these primate viruses revealed
that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp
sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65%
conserved relative to each other. Approximately 50% of the residues
are conserved among all three sequences, yet all three viruses have
retained response elements for glucocorticoids, two positionally
conserved CCAAT boxes, and positionally conserved TATA boxes. The
putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well
conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was
detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to
EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays.
These results suggest that similar mechanisms for regulation of latent
gene expression are conserved among the EBV-related lymphocryptoviruses
found in nonhuman primates.
| |
TEXT |
Epstein-Barr virus (EBV) is a
human lymphocryptovirus associated with various malignancies,
including Burkitt's lymphoma (BL), Hodgkin's disease,
nasopharyngeal carcinoma, and lymphomas in immunosuppressed
individuals (34). EBV establishes a lifelong infection in
the human host, where B lymphocytes are the primary latent reservoir
from which occasional virus reactivation occurs (34).
EBV also establishes latent infection in B lymphocytes in
vitro and transforms them into continuously proliferating
lymphoblastoid cell lines (LCLs). Molecular genetic techniques
have demonstrated that several EBV nuclear antigens (EBNAs) and an
integral membrane protein (LMP1) are required for lymphocyte
transformation in vitro (19, 36). EBNA2 plays a central role
in the process of transformation, as it activates the expression of the
other EBNAs, LMP1 and LMP2 proteins, and various cellular proteins
associated with the transformed phenotype (1, 5, 7, 20, 25, 35,
41, 52-56, 60, 61).
The regulation of EBNA expression in EBV-infected cells is likely
to be important in viral persistence and the development of
EBV-associated malignancies. With the exception of EBNA1, all EBNAs possess epitopes which induce a strong cytotoxic T-cell response
(22, 34). Downregulation of EBNA expression may allow a
latently infected B cell to escape immune surveillance and also permit
proliferation of malignant EBV-infected cells. In healthy individuals,
latent EBV infection appears to be primarily confined to resting B
cells. The only EBV gene expressed in these cells is LMP2a, a
pattern of gene expression termed latency 0 (29, 30, 51). In
BL cells, only EBNA1 is expressed (latency I) (34, 51).
In Hodgkin's disease, nasopharyngeal carcinoma, and T-cell
lymphomas, EBNA1 and one or both LMPs are expressed (latency II)
(34, 51). All EBNAs and LMPs are expressed during acute
infectious mononucleosis, in lymphoproliferative syndromes in
immunocompromised individuals, and in LCLs (latency III) (34, 51). The association of these specific patterns of EBNA
expression with various physiologic and pathologic states underscores
the importance of EBNA gene regulation in EBV persistence and
EBV-associated oncogenesis.
Upon in vitro infection of B lymphocytes, the first EBV genes expressed
are EBNA-LP and EBNA2, transcribed from the W promoter (Wp) as
bicistronic mRNAs (2, 3, 40, 56). Thirty-six hours
postinfection, transcription of EBNA2 and the other EBNAs switches to
the upstream C promoter (Cp) (2, 3, 40, 57). EBNA2 protein
is first detectable at 12 h postinfection and reaches maximal
levels between 32 and 46 h (2). These findings are consistent with a role for EBNA2 in activating Cp and mediating the
switch from Wp transcription. Elucidating the mechanisms that regulate
transcription of EBNA2 and the other EBNAs is therefore important for
understanding the process of EBV-mediated B-lymphocyte transformation.
Transcription from Cp leads to concomitant expression of EBNA2 and the
other EBNAs. Thus, Cp activity is the major difference between latency
III and the other latency programs. Several mechanisms that may
regulate Cp activity have been described. First, EBNA1 binds to an
enhancer 3 kb upstream of Cp and activates Cp in transfection assays
(32, 33, 47). Second, glucocorticoid response elements (GREs) about 900 bp upstream of Cp respond to glucocorticoids and
activate Cp in vitro but are not required for transformation in vitro
(21, 45, 46, 49). Transient transfections have also
demonstrated that the Cp GREs are capable of responding to glucocorticoids (21, 45, 49). Third, the EBNA2-responsive enhancer (E2RE) in Cp is critical for Cp function in vitro and in vivo
(17, 23, 48, 59). Deletion of E2RE from the viral genome
results in loss of Cp activity in infected cells (59). Finally, methylation of CpG sequences in the promoter region
downregulates Cp (28, 38, 44). Whereas LCLs (latency III)
show no evidence of Cp methylation, B cells in latencies I and II are
hypermethylated in different regions of Cp (28, 38, 44).
Consistent with a role for methylation in the silencing of Cp, in vitro
treatment of type I BL cells with 5-azacytidine, an inhibitor of DNA
methylation, led to activation of Cp (27, 38).
In order to gain further insight into the significance of Cp and the
transcriptional elements that regulate its expression, a segment of the
genome from the BCRF1 poly(A) site to the end of the first Cp exon was
sequenced from the EBV-like lymphocryptoviruses herpesvirus papio (HVP)
and rhesus macaque EBV (RhEBV). These sequences were compared to EBV
sequences, and the abilities of these promoters to respond to EBNA2 and
to bind CBF1 and CBF2 cellular proteins were evaluated.
DNA sequences of the Cp from HVP and RhEBV and their alignment with
the EBV Cp.
Several cell lines were used for our studies. DG75 and
CA46 are EBV-negative BL cell lines. B95-8 is a type 1-EBV-transformed marmoset cell line, and P3HR1 is a type 2-EBV-transformed cell line
containing an immortalization-defective EBV strain.
26CB-1 (obtained from the American Type Culture Collection as
CRL-1495) and Ba65 are baboon cell lines transformed with HVP
(12). H254 (gift from Micheal Murphy-Corb) and LCL 8664 (CRL-1805) are rhesus macaque cell lines transformed with RhEBV.
Previous sequence analysis of a cosmid clone derived from the Ba65 cell
line revealed sequences identical to B95-8 EBV DNA in the C1 exon of
the HVP Cp (unpublished data and reference 25).
Based on this and preliminary analysis by rapid amplification of cDNA
5' ends of the BCRF2 open reading frame of HVP (unpublished
observations), PCR primers that would amplify the putative BCRF2 and Cp
sequences from HVP were designed. Briefly, 26CB-1 or BA65 cells were
lysed in PBS-1% Triton X-100, boiled, and treated with proteinase K
for 1 h. Samples were boiled again for 10 min, and the cleared
lysates were used for PCR analysis. From each of the cell lines a
2.0-kb DNA molecule was amplified and cloned directly into
pT7Blue-2 (Novagen). The resulting plasmids, pCRL-3 and pBA65
Cp, were derived from 26CB-1 and BA65 cells, respectively. Plasmid
inserts were sequenced on both strands with an automated sequencing
system (Applied Biosystems). With the sequence information from the HVP
clones, two primers were designed for common sequences also present in
EBV that amplify RhEBV Cp sequences from the end of the BCRF2 open
reading frame to the end of the putative C1 exon. LCL 8664 and H254
were lysed, and DNAs were prepared for PCR amplification as described
above. Two clones, pPDL 380A and pPDL 380B, from PCR products of
independent cell preparations from H254 were obtained. Two clones, pPDL
394A and pPDL 394B, were also obtained from LCL 8664 in a similar
manner. During all PCR amplifications, control samples containing all essential PCR components except cell lysates were consistently negative. Both strands of the RhEBV plasmid inserts were also sequenced with an Applied Biosystems automated sequencing system.
For HVP, clones pCRL-3 and pBA65 Cp were sequenced. The sequence for
CRL-3 is shown in Fig. 1A. Six nucleotide
differences were observed between these particular isolates and are
listed in Fig. 1B. Since only one clone was analyzed from each cell
line, it is unclear whether these changes are strain specific or the result of PCR error. For RhEBV, both clones derived from the H254 cell
line in independent PCRs were identical. Surprisingly, clones isolated
from RhEBV LCL 8664 were also identical in sequence to those derived
from H254. Both cell lines were established at the Delta Regional
Primate Center and may contain identical or similar viral strains.
While the passage history of H254 is somewhat unclear, it may have been
established from a virus obtained from LCL 8664 or an animal in the
same colony. A sequence alignment of the Cp sequences from the three
related viruses is shown in Fig. 1A.
View larger version (91K):
[in this window]
[in a new window]
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Nucleotide sequences of aligned EBV, HVP, and RhEBV
Cp sequences from the poly(A)+ site of BCR2 to the end of
the C1 exon. Asterisks indicate conserved nucleotides. Binding sites
for transcription factors are indicated by boxed sequences. The
boundaries of the EBNA2 enhancer are indicated with brackets inside the
sequence diagram, and the different functional regions of the Cp are
denoted with brackets outside the sequence diagram and are labeled as
R1 to R4. The horizontal arrow above the bases shown in bold indicates
the transcriptional initiation site. The CpG dinucleotides are
underlined. (B) Nucleotide differences between HVP Cp sequences
obtained from the 26CB-1 and Ba65 cell lines. Shown are the nucleotide
positions from panel A where base differences were detected and the
nucleotides present in each strain.
|
|
Sequence comparison of the Cps derived from these primate viruses
reveals that EBV and HVP Cp sequences are 64% conserved,
EBV and
RhEBV Cp sequences are 66% conserved, and HVP and RhEBV
Cp sequences
are 65% conserved relative to each other. The overall
GC content
of each sequence is 52, 52, and 54% for the EBV, HVP,
and RhEBV Cps,
respectively. Several sequence elements in the
EBV Cp that have been
proposed to be important for promoter function
have been described.
Among them are three GREs (GRE I, II, and
III), E2RE, distal and
proximal CCAAT boxes, and the TATA box.
The sequence alignment in Fig.
1 shows that there are four regions
that contain clusters of either
functional or putative transcription
factor binding sites (regions 1, 3, and 4 [R1, R3, and R4, respectively)
and a clustered region
containing a high concentration of CpG
dinucleotides
(R2).
R1 contains putative binding sites for PEA-3 as well as a TPA response
element (TRE) (
8,
13,
26). Three GREs have been
described in
the EBV Cp, which is localized about 900 bp upstream
of the
transcription initiation site (
21,
45). The in vivo
importance of these elements remains unclear. Only one of these
GREs is
conserved in both HVP and RhEBV (GRE III). However, HVP
Cp has one
other potential GRE localized just upstream of GRE
I while RhEBV
appears to have positionally retained GRE I. Neither
primate sequence
appears to have conserved GRE
II.
R2 contains an island of CpGs in all three sequences even though the
levels of sequence homology are significantly diverged
between EBV and
the primate viruses. The overall GC content of
R2 is slightly higher
than for the Cp overall and is 65, 63, and
58% for EBV, HVP, and
RhEBV, respectively. However, while the
average CpG frequencies for the
Cp sequences in Fig.
1 are 4.3,
3.3, and 4.0% for EBV, HVP, and RhEBV,
respectively, the CpG frequencies
nearly double or triple in R2 (11.0, 9.0, and 8.0% for EBV, HVP,
and RhEBV, respectively). In Cp-negative
cell lines such as Rael,
nearly all CpG within the first upstream 400 bp proximal to the
transcription initiation site are methylated
(
37,
38,
44).
Extensive analysis of CpG methylation within
R2 has not been performed
with these cells. Addition of 5-azacytidine,
which inhibits methyltransferases,
results in demethylation and
activation of Cp (
27,
38). In
addition, previous studies
have shown that methylation primarily
targets two regions, called
methylation-hypersensitive region
I (MHRI; which encompasses the
EBNA2 enhancer) and MHRII (from
220 to
25 or positions 826 to 1023 in Fig.
1) (
37). MHRI seems
to control Cp
transcriptional activation by EBNA2, while MHRII
controls the basal
activity of the promoter. The reported important
CpG elements in MHRI
are localized downstream of the CBF2 binding
site, and these sites do
not appear to be conserved. However,
some of the potential methylation
sites present in MHRII are conserved
in both HVP and
RhEBV.
R3 is part of the EBNA2 enhancer and contains the binding sites for the
cellular DNA binding proteins CBF1 and CBF2 (
11,
24). The
CBF1 recognition sequence is fully conserved in the
three promoters,
supporting the important role of this protein
in Cp activation by
EBNA2. We have recently published that the
most critical region
contributing to CBF2 binding is the GGTTCA
sequence found
downstream of the CBF1 site (
11). In addition
to this
sequence, the surrounding nucleotides also contribute
to the
affinity of binding. With the exception of a G
C change
found in the
primate viral sequences, our mutagenesis results
are consistent with
the fact that critical sequences required
for CBF2 binding are
conserved. A distal CCAAT box identified
as functionally significant is
also conserved (
32). Also within
this region is a putative
Sp1 binding
site.
R4 contains the proximal CCAAT box, TATA box, and the transcription
initiation site. Just downstream of the TATA box a conserved
NF1 site
is present (
15). The conservation of sequences surrounding
these important elements suggests that they are also important
for Cp
expression.
Analysis of Cp expression from HVP- and RhEBV-transformed B
lymphocytes.
Analysis of Cp usage and mapping of the site for
initiation of transcription in HVP and RhEBV B cell lines were
performed by S1 nuclease protection analysis. Based on the
sequence analysis in Fig. 1, oligonucleotide probes that could detect
Cp usage in the primate and EBV-transformed cell lines were
synthesized. Poly(A)+ RNA was prepared with a fastTrack kit
(version 2.0; Invitrogen). Fifty to 100 fmol of kinased oligonucleotide
was hybridized to 2 µg of poly(A)+ RNA in 50 µl of
hybridization buffer {40 mM PIPES
[piperazine-N,N'-bis(2-ethanesulfonic acid), pH
6.4], 1 mM EDTA, 0.4 M NaCl, 0.1% sodium dodecyl sulfate, 50%
(vol/vol) formamide} at 37°C for 12 h. The hybridization
reaction mixture was diluted to 400 µl with buffer with final
concentrations of 0.28 M NaCl, 50 mM NaOAc (pH 4.6), and 4.5 mM
ZnSO4 and digested with 20 U of S1 nuclease (Gibco BRL) for
30 min at 37°C. The reaction mixtures were phenol-chloroform
extracted and ethanol precipitated. The resulting precipitate was
resuspended in loading buffer and fractionated on a 10% denaturing
polyacrylamide gel.
As shown in Fig.
2A, an EBV-specific
probe detected transcripts from B95-8 (type 1 EBV) of the predicted
sizes that were not
detected in the EBV-negative B-cell line DG75 or
the other baboon
or macaque cell lines. This result is consistent with
the results
of other studies, and the start site is indicated in Fig.
1
(
4,
57). In contrast to previously published work, we
detected a
minor RNA species in both B95-8 and P3HR1 that was
approximately
3 bp larger than the major 44- and 45-bp protected
fragments.
More stringent hybridization conditions failed to abolish
these
protected species. It is unclear at this time whether these RNAs
were derived from the Cp or were some other cross-reactive RNA
derived
from another part of the viral genome. Wp-specific probes
detected
W-specific transcripts from P3HR1 but not B95-8 (data
not shown). As
shown in panels B and C of Fig.
2, similar patterns
of Cp transcripts
were detected in RhEBV- and HVP-transformed
cells with the Cp probe
specific for those viruses. Again the
minor RNA species detected in
both B95-8 and P3HR1 were also detected
with the HVP Cp probe but not
the RhEBV Cp probe. The HVP probe
also had some nonspecific
hybridization with apparent cellular
RNA that appears as a ladder of
bands in both virus-positive and
-negative cells. As a control for RNA
abundance and quality, a
cellular
-actin probe was also used to
detect
-actin RNA in
the cell lines (Fig.
2D). The transcription
start sites for HVP
and RhEBV are indicated in Fig.
1. Even though
there is some sequence
divergence around the EBV transcription
initiation site and among
the TATA boxes, it appears that HVP- and
RhEBV-transformed cells
also initiate Cp transcripts at an analogous
location.
View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
S1 nuclease protection experiments with specific
oligonucleotides. Identical amounts of poly(A)+-selected
RNAs derived from the indicated cell lines were subjected to
analysis with a C1 oligonucleotide as a hybridization probe.
Specific protection fragment sizes are indicated in bases at the
side of each panel. (A) EBV Cp probe,
5'-CTCTGGGGGTCTTCGGTGTCCTTGTCTCTATGCCATCTGATCTAAAATTTGCAGCAGAAC-3';
(B) RhEBV Cp probe,
5'-TC CTGGGGTCGTTGGTCTTTGCCTCTATGCCATCTGATCCAAGATTTGA ACCAGTGC-3';
(C) HVP Cp probe,
5'-TACTGGGGGGTCTTGGAGTCCTGGTGTCTATGCCATTTGACCTGAGCTTTGAACCAGTAG-3';
(D) -actin probe,
5'-ACATAGGAATCCTTCTGACCCATGCCCACCATCACGCCCTGGGAAGGAAAGGACAAGA-3'.
|
|
Analysis of CBF1 and CBF2 binding to the HVP and RhEBV Cp
sequences.
The sequence alignment of Fig. 1A shows that the EBNA2
enhancer lies in R3. The CBF1 binding site is fully conserved in HVP and RhEBV. The CBF2 binding site has a single change in a critical region for binding. Electrophoretic mobility shift assays (EMSA) were
performed as described previously to test the ability of these
enhancers to bind CBF1 and CBF2.
By using the full-length HVP and RhEBV EBNA2 enhancers as probes, we
found that CBF1 binds with high affinity and that EBNA2
interacts with
CBF1 as detected in gel mobility shift assays (data
not shown). The
CBF2 activity associated with the EBV Cp enhancer
was stronger than
that associated with the HVP and RhEBV enhancers,
indicating that these
promoters possess a reduced affinity for
this
protein.
To quantify the affinity of CBF2 for the response elements present in
HVP and RhEBV, competition assays were performed. The
affinities
of the HVP and RhEBV CBF2 sites were measured by quantifying
their
ability to compete for CBF2 binding on the EBV sequence.
An
example of the competitions is shown in Fig.
3A, and a summary
of
the data is presented in Fig.
3B. This analysis showed that
while only
3.2 nM EBV CBF2 oligonucleotide is required to compete
50% of the
binding, 15.7 and 12.5 nM HVP and RhEBV oligonucleotides,
respectively,
are required for the same level of competition.
This represents
4.7-fold (HVP) and 3.9-fold (RhEBV) reduced affinities
for binding
compared with that for the EBV binding site.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Affinities of HVP and RhEBV EBNA2 enhancers for
CBF2. Nuclear extracts from CA46 cells were mixed with 0-, 2.5-, 5-, 25-, and 125-fold molar excesses of the different unlabeled mutant
oligonucleotides. A fixed amount of 32P-EBV CBF2 binding
oligonucleotide was then added to the shift reaction mixtures. The
reaction mixtures were separated on 4.5% nondenaturing polyacrylamide
gels, dried, and autoradiographed. Amounts of CBF2 complex were
quantified with a PhophorImager (Molecular Dynamics). (A) The EMSA gel
shows binding of nuclear extract containing CBF2 to an EBV 36-mer
oligonucleotide probe from positions 339 to 368 alone or with
increasing (triangle) amounts of the indicated equivalent EBV or HVP
cold competitor oligonucleotide. (B) Summary of competition results.
The sequences shown represent the central 30 bp of the 36-mer
oligonucleotide. The crucial sequences for CBF2 binding are in bold,
with the mutational changes underlined. The numbers in column a are
concentrations of unlabeled oligonucleotide required for 50%
competition. The numbers in column b are percentages representing the
ability of each oligonucleotide to compete for CBF2 relative to that of
the wild-type element, which was set at 100%. (C) Direct binding of
HVP CBF2 wild-type and mutant oligonucleotides. Nuclear extracts from
CA46 cells were incubated with radiolabeled HVP wild-type and mut.1 and
mut.2 CBF2 oligonucleotides in the presence or absence of a 100 M
excess of competitor oligonucleotide and analyzed by EMSA. For lanes 1 to 5, the HVP CBF2 probe was used; for lanes 6 to 8, the HVP mut.1 CBF2
probe was used; and for lanes 9 to 11, the HVP mut.2 probe was used.
Lanes 1, 6, and 9, probe only; lanes 2, 7, and 10, CA46 extract; lane
3, CA46 extract and cold HVP CBF2 oligonucleotide; lanes 5 and 8, CA46
and cold HVP mut.1 CBF2 oligonucleotide; lanes 4 and 11, CA46 and cold
HVP mut.2 CBF2 oligonucleotide. Results are averages of values from
three independent experiments.
|
|
We have previously published that a double transversion mutation in the
EBV CBF2 binding site from TT to GG (GGTTCA to GGGGCA)
abolishes CBF2 binding (
11). When this mutation is
introduced
into the Cp, the ability to respond to EBNA2
transactivation in
transient-transfection assays is strongly
reduced. Oligonucleotides
representing the CBF2 binding site
sequences from HVP and RhEBV
were synthesized, and a TT
GG
change was introduced into both
the HVP and RhEBV CBF2 sequences
(Fig.
3B). These mutants were
called HVP mut.1 CBF2 and RhEBV mut.1
CBF2 (Fig.
3B). Interestingly,
the HVP sequence has two putative CBF2
binding sites. One site
lies in the same position as in EBV, and the
other site is 3 nucleotides
downstream of the first site (site 1, GCTTCA, and site 2, GGTTGA)
(Fig.
3B). An
oligonucleotide carrying the TT
GG change in the
putative second site
was also synthesized, and the resulting mutant
was called HVP mut.2
CBF2. This mutant was also analyzed in the
competition experiments, as
shown in Fig.
3B. Competition experiments
with HVP mut.1 and mut.2
showed that, as in EBV, changes in the
TTGGCA sequence
result in decreased affinity for CBF2. RhEBV mut.1
had a
25-fold-reduced binding affinity. In HVP, both sites were
found to
contribute to CBF2 binding, with the upstream site being
the most
important. Mutation of the first site completely abolished
the binding,
while mutation of the downstream site did not abolish
binding although
it led to a 2.7-fold-reduced activity compared
with that of the HVP
wild-type
sequence.
Figure
3C shows the direct binding of HVP CBF2 wild-type and mutant
oligonucleotides in the gel retardation assay. As expected,
HVP mut.1
CBF2 was not able to bind CBF2 (lane 7) while HVP mut.2
was still able
to bind but with reduced affinity (lane 10). These
results confirm
that, although the upstream site is the most important
for binding, the
second site contributes to the binding of the
wild-type
sequences.
Activation of HVP and RhEBV Cp by EBNA2.
The 1-kb regions from
the HVP and RhEBV sequences that correspond to the EBV Cp construction
(Cp 1021 to +3) were PCR amplified, and these fragments were cloned
upstream of the luciferase reporter gene in the pGL3-Basic vector
(Promega). DNA transfections were carried out by using the DEAE dextran
method. DG75 cells (5 × 106) were transfected with 2 µg of target plasmid and the amounts of effector plasmid
indicated in the legend to Fig. 3. The final DEAE dextran
concentration in the transfection reaction mixture was 1 mg/ml.
Transfected cells were harvested after 2 days of incubation and lysed,
and the luciferase activity was measured according to the instructions
of the manufacturer. A constitutively expressing chloramphenicol
acetyltransferase reporter vector (pCAT control; Promega) was used as
the internal control for transfections, and the values from luciferase
assays were normalized to the chloramphenicol acetyltransferase activity.
DG75 cells were transfected with the Cp constructs, and their ability
to respond to an EBNA2-expressing plasmid was evaluated.
EBNA2
activated the EBV Cp to a maximum of 11-fold, while it activated
the HVP and RhEBV promoters 6-fold and 9-fold, respectively
(Fig.
4). At the highest doses of EBNA2
these differences between the
promoters are not statistically
significant. At lower doses of
EBNA2 (0.8 and 1.6 µg of EBNA2), there
was a statistically significant
difference in the ability of EBNA2 to
transactivate the EBV Cp
about 5-fold and it was able to
transactivate the HVP and RhEBV
Cp promoters only 1.5- to 3-fold.
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of the EBNA2 responsiveness of EBV, HVP, and
RhEBV Cps. DG75 cells were transfected with 2 µg of target plasmid
and 0, 0.2, 0.4, 0.8, 1.6, and 8.0 µg of effector EBV
EBNA2-expressing plasmid (24). Results are averages of
values from five independent experiments. Standard errors of the means
are indicated with the T bars.
|
|
In summary, to gain further insight into the regulatory elements that
modulate the expression of the viral latency Cp, the
Cp regions
corresponding to nucleotides 10251 to 11479 of the
EBV genome (+144 to
1079 relative to the transcription initiation
site) from the EBV-like
lymphocryptoviruses HVP and RhEBV were
cloned and sequenced. The Cp
regions from these viruses are about
65% identical. Earlier studies
have shown that HVP and EBV have
approximately 40% overall DNA
homology and indicate that Cp is
more highly conserved than the rest of
the genomes (
9,
16).
No experiments to determine general
hybridization kinetics between
EBV and RhEBV have been carried out.
Among some of the HVP gene
sequences, the DNA identities between LMP1
(43%), Fp (also called
Qp) (86%), EBNA1 (63%), and
ori-Lyt (89%) range from 43 to 89%
compared to the
identities between similar regions in EBV (
10,
42,
43,
58). The RhEBV sequences for LMP1 (44%), Fp/Qp (80%),
EBNA2
(41%), and GP350 (57%) range from 44 to 80% compared to
the
identities between similar regions of EBV (
10,
14,
31,
43). While these genes represent only a small portion of
the
genome, it appears that Cps are somewhat less homologous than
other
regulatory elements but more homologous than latent protein
coding
regions. The significance of this is unclear, since the
evolutionary
pressures that are present for regulatory regions
may be different than
those for coding regions or genes involved
in the lytic cycle. The fact
that Cp is generally more conserved
than the rest of the genome
suggests that there are universal
regulatory elements within Cp which
are required for the virus
life
cycle.
An alignment of these sequences suggests that the function and
regulation of these promoters have been conserved. Initial
surveys of
the individual Cp sequences by computer analysis reveals
that there are
many potential transcription factor binding sites
in each promoter.
Given the relative degrees of homology between
EBV and the other
lymphocryptoviruses, we reasoned that crucial
cis-acting
elements required for Cp function are conserved between
these viral
promoters. Using these criteria, we have identified
three regions
within the Cp that contain clusters of conserved
transcription factor
binding sites and a fourth region that contains
a high frequency of CpG
residues. For ease of discussion we have
called these regions R1 to
R4.
Previous studies identified three GREs in the EBV Cp located between
nucleotides 10240 and 10440 (
1077 to
894 relative to
the
transcription start site) of the EBV genome and demonstrated
that this
region could confer responsiveness to glucocorticoids
both in the
context of Cp and when fused to a heterologous promoter
(
21,
45). In contrast, using a large plasmid construction
containing
both Cp and OriP, Woisetschlaeger et al. found that
deletions of
sequences containing the GRE had little overall effect
on basal or
activated promoter activity in transient-transfection
experiments
(
56). Finally, recombinant EBV containing a deletion
encompassing the three GREs display on average fivefold-higher
expression from Cp than wild-type recombinant viruses (
6).
In light of these data, the biological role of the GRE remains
unclear.
R1 contains two conserved glucocorticoid elements. One
of these, GRE
III, appears to be positionally conserved, while
GRE I in the HVP Cp is
not. No obvious counterpart to EBV GRE
II was identified in our
sequence comparisons. While the role
of glucocorticoids in modulating
Cp activity during the immortalization
process remains unclear, the
conservation of two GRE sites suggests
an important role for these
elements in vivo. Two other conserved
sequence elements that resemble
ETS/PEA3 and TRE were also identified
in R1 (
8,
13,
26). The
roles these factors have for Cp
function remain unknown, but previous
results obtained with mutants
with R1 deleted may also be due to
deletion of ETS or TRE. Introduction
of more subtle point mutations in
the GRE and putative ETS and
TRE sites will clarify the role of these
control elements in Cp
function.
Several studies have described a role for CpG methylation in silencing
of Cp activity (
28,
37-39,
44,
50). CpG methylation
of the
EBNA2 enhancer region as well as downstream sequences from
the enhancer
to the TATA box approaches 100% of available CpG
in Rael cells, a type
I-phenotype cell line (
38,
44). Using
a methylated cassette
assay, Robertson and Ambinder have demonstrated
that CpG
methylation of Cp sequences in the EBNA2 enhancer silence
EBNA2-mediated Cp activity (
37). In addition, CpG
methylation
from the EBNA2 enhancer downstream to the TATA box
abolished Cp
activity completely in transient-transfection assays
(
37). Site-specific
methylation has been proposed to inhibit
binding of cellular factors
required for Cp activity (
37,
38). R2 contains a high proportion
of CpG sites. However, these
previous studies have not shown a
role for this region in regulation of
Cp activity. A recent analysis
of the methylation sites in two Mutu
clones (BL cell lines) that
differ from each other in the EBV latent
gene expression pattern,
have shown that all the CpG sites present in
the region homologous
to R2 are methylated in the latency type I clone
(
50). No differential
methylation was found in any other
region of the promoter, including
the CBF1 and CBF2 binding sites.
Site-specific methylation has
been proposed to inhibit binding of
cellular factors required
for CBF2 activity (
37,
38).
However, an alternative mechanism
for how methylation may work to
silence promoter activity is through
recruitment of DNA binding
proteins with affinities for methylated
CpG sites. These proteins may
function as transcriptional repressors
by (i) altering the structure of
neighboring chromatin, (ii) excluding
positive transcription factors
from binding their cognate recognition
sites, or (iii) directly
exposing a repressor domain (
18). The
nature of chromatin
assembly on plasmid DNA during transient-transfection
analysis may not
reflect the status of EBV chromosomes in infected
cells, and
methylation effects on chromatin structure may be manifest
only in the
context of the viral genome in immortalized cells.
The contribution of
R2 to Cp silencing may be revealed only under
these
circumstances.
R3 retains elements for the binding of the cellular factors CBF1 and
CBF2, which along with EBNA2 are the primary mediators
of Cp EBNA2
enhancer function. We have recently reported that
the requirement for a
functional CBF2 binding site is more apparent
at low concentrations of
EBNA2 (
11). Quantification of CBF2
binding to HVP and RhEBV
promoters revealed 4.7- and 3.9-fold-reduced
affinities for CBF2,
respectively. However, this analysis was
done with extracts derived
from a human B-cell line and it is
possible that the affinities of the
HVP and RhEBV Cps for human
CBF2 do not accurately reflect their
affinities for the CBF2 homologue
present in their natural host cells.
When testing these promoters
in transient-transfection assays with
increasing amounts of EBNA2,
we observed a reduction of the ability of
the HVP and RhEBV promoters
to respond to low concentrations (0.8 µg
of effector) (Fig.
4)
of EBNA2 compared with the responsiveness of the
EBV Cp. At higher
concentrations of EBNA2, the three promoters had
similar levels
of induction. A similar phenomenon was also observed
when the
wild-type EBV Cp was compared to the EBV Cp containing
mutations
in the CBF2 binding site (
11). The physiological
significance
of the reduced ability of the EBV-related viruses to
respond to
low concentrations of EBNA2 is uncertain. The conservation
of
the CBF2 binding site in the Cp EBNA2 enhancer of HVP- and
RhEBV-related
viruses argues in favor of CBF2 serving an important role
in promoter
function.
R4 contains a second conserved CCAAT box, also important for Cp
function, as well as the TATA box (
32). S1 nuclease
protection
assays revealed that all of the nonhuman primate cell lines
immortalized
by their species-specific lymphocryptovirus use Cp and
that the
transcription start sites are located in analogous positions
relative
to the TATA box, even though there is some heterogeneity in
the
nucleotides surrounding the +1 initiation
site.
The presence of transcriptional control elements conserved in both HVP
and RhEBV Cp sequences that were previously identified
as important
mediators of Cp activity, combined with data that
Cp is used in cells
immortalized by these viruses and that HVP
and RhEBV Cp reporter
constructions are transactivated by EBNA2,
suggests that these nonhuman
lymphocryptoviruses have retained
similar mechanisms for regulation of
latency gene expression.
The presence of conserved transcriptional
control elements that
have not been examined in the context of Cp will
provide opportunities
to identify additional cellular factors that
regulate Cp activity.
The Cp sequence comparison also reveals several
additional conserved
stretches of nucleotides that will aid in
identifying new or novel
transcription factors that regulate Cp
activity.
| |
ACKNOWLEDGMENTS |
This work was supported by NIH grants R29 CA69437 (P.D.L.) and R29
CA60067 (S.S.) and an award from the William Stamps Farish Foundation
(P.D.L.).
We thank Elliott Kieff for the Ba65 cell line and Fred Wang for RhEBV
LCL 8664.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Molecular Virology, Baylor College of Medicine, One Baylor Plaza,
Houston, TX 77030. Phone: (713) 798-8474. Fax: (713)
798-3586. E-mail: pling{at}bcm.tmc.edu.
| |
REFERENCES |
| 1.
|
Abbot, S. D.,
M. Rowe,
K. Cadwallader,
A. Ricksten,
J. Gordon,
F. Wang,
L. Rymo, and A. B. Rickinson.
1990.
Epstein-Barr virus nuclear antigen 2 induces expression of the virus-encoded latent membrane protein.
J. Virol.
64:2126-2134[Abstract/Free Full Text].
|
| 2.
|
Alfieri, C.,
M. Birkenbach, and E. Kieff.
1991.
Early events in Epstein-Barr virus infection of human B lymphocytes.
Virology
181:595-608[Medline].
|
| 3.
|
Allday, M. J.,
D. H. Crawford, and B. E. Griffin.
1989.
Epstein-Barr virus latent gene expression during the initiation of B cell immortalization.
J. Gen. Virol.
70:1755-1764[Abstract/Free Full Text].
|
| 4.
|
Bodescot, M.,
M. Perricaudet, and P. J. Farrell.
1987.
A promoter for the highly spliced EBNA family of RNAs of Epstein-Barr virus.
J. Virol.
61:3424-3430[Abstract/Free Full Text].
|
| 5.
|
Cordier, M., et al.
1990.
Stable transfection of Epstein-Barr virus (EBV) nuclear antigen 2 in lymphoma cells containing the EBV P3HR1 genome induces expression of B-cell activation molecules CD21 and CD23.
J. Virol.
64:1002-1013[Abstract/Free Full Text].
|
| 6.
|
Evans, T. J.,
P. J. Farrell, and S. Swaminathan.
1996.
Molecular genetic analysis of Epstein-Barr virus Cp promoter function.
J. Virol.
70:1695-1705[Abstract].
|
| 7.
|
Fahraeus, R.,
A. Jansson,
A. Ricksten,
A. Sjoblom, and L. Rymo.
1990.
Epstein-Barr virus-encoded nuclear antigen 2 activates the viral latent membrane protein promoter by modulating the activity of a negative regulatory element.
Proc. Natl. Acad. Sci. USA
87:7390-7394[Abstract/Free Full Text].
|
| 8.
|
Faisst, S., and S. Meyer.
1992.
Compilation of vertebrate-encoded transcription factors.
Nucleic Acids Res.
20:3-26[Free Full Text].
|
| 9.
|
Falk, L.,
F. Deinhardt,
M. Nonoyama,
L. G. Wolfe, and C. Bergholz.
1976.
Properties of a baboon lymphotropic herpesvirus related to Epstein-Barr virus.
Int. J. Cancer
18:798-807[Medline].
|
| 10.
|
Franken, M.,
O. Devergne,
M. Rosenzweig,
B. Annis,
E. Kieff, and F. Wang.
1996.
Comparative analysis identifies conserved tumor necrosis factor receptor-associated factor 3 binding sites in the human and simian Epstein-Barr virus oncogene LMP1.
J. Virol.
70:7819-7826[Abstract].
|
| 11.
|
Fuentes-Panana, E. M., and P. D. Ling.
1998.
Characterization of the CBF2 binding site within the Epstein-Barr virus latency C promoter and its role in modulating EBNA2-mediated transactivation.
J. Virol.
72:693-700[Abstract/Free Full Text].
|
| 12.
|
Gerber, P.,
S. S. Kslter,
G. Schidllovsky,
W. D. Peterson, and M. D. Daniel.
1977.
Biologic and antigenic characteristics of Epstein-Barr virus-related herpesviruses of chimpanzees and baboons.
Int. J. Cancer
20:448-459[Medline].
|
| 13.
|
Goding, C. R.,
S. M. Temperley, and F. Fischer.
1987.
Multiple transcription factors interact with the adenovirus-2 EII-late promoter: evidence for a novel CCAAT recognition factor.
Nucleic Acids Res.
15:7761-7780[Abstract/Free Full Text].
|
| 14.
| Gordadze, A., and P. D. Ling. Unpublished
data.
|
| 15.
|
Gounari, F.,
R. De Francesco,
J. Schmitt,
P. C. van der Vliet,
R. Cortese, and H. Stunnenberg.
1990.
Amino-terminal domain of NF1 binds to DNA as a dimer and activates adenovirus DNA replication.
EMBO J.
9:559-566[Medline].
|
| 16.
|
Heller, M., and E. Kieff.
1981.
Colinearity between the DNAs of Epstein-Barr virus and herpesvirus papio.
J. Virol.
37:821-826[Abstract/Free Full Text].
|
| 17.
|
Jin, X. W., and S. H. Speck.
1992.
Identification of critical cis elements involved in mediating Epstein-Barr virus nuclear antigen 2-dependent activity of an enhancer located upstream of the viral BamHI C promoter.
J. Virol.
66:2846-2852[Abstract/Free Full Text].
|
| 18.
|
Kass, S. U.,
D. Pruss, and A. P. Wolffe.
1997.
How does DNA methylation repress transcription?
Trends Genet.
13:444-449[Medline].
|
| 19.
|
Kieff, E.
1996.
Epstein-Barr virus and its replication, p. 107-172.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields Virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 20.
|
Knutson, J. C.
1990.
The level of c-fgr RNA is increased by EBNA-2, an Epstein-Barr virus gene required for B-cell immortalization.
J. Virol.
64:2530-2536[Abstract/Free Full Text].
|
| 21.
|
Kupfer, S. R., and W. C. Summers.
1990.
Identification of a glucocorticoid-responsive element in Epstein-Barr virus.
J. Virol.
64:1984-1990[Abstract/Free Full Text].
|
| 22.
|
Levitskaya, J.,
M. Coram,
V. Levitsky,
S. Imreh,
P. M. Steigerwald-Mullen,
G. Klein,
M. G. Kurilla, and M. G. Masucci.
1995.
Inhibition of antigen processing by the internal repeat region of the Epstein-Barr virus nuclear antigen-1.
Nature
375:685-688[Medline].
|
| 23.
|
Ling, P. D.,
J. J. Hsieh,
I. K. Ruf,
D. R. Rawlins, and S. D. Hayward.
1994.
EBNA-2 upregulation of Epstein-Barr virus latency promoters and the cellular CD23 promoter utilizes a common targeting intermediate, CBF1.
J. Virol.
68:5375-5383[Abstract/Free Full Text].
|
| 24.
|
Ling, P. D.,
D. R. Rawlins, and S. D. Hayward.
1993.
The Epstein-Barr virus immortalizing protein EBNA-2 is targeted to DNA by a cellular enhancer-binding protein.
Proc. Natl. Acad. Sci. USA
90:9237-9241[Abstract/Free Full Text].
|
| 25.
|
Ling, P. D.,
J. J. Ryon, and S. D. Hayward.
1993.
EBNA-2 of herpesvirus papio diverges significantly from the type A and type B EBNA-2 proteins of Epstein-Barr virus but retains an efficient transactivation domain with a conserved hydrophobic motif.
J. Virol.
67:2990-3003[Abstract/Free Full Text].
|
| 26.
|
Martin, M. E.,
J. Piette,
M. Yaniv,
W. J. Tang, and W. R. Folk.
1988.
Activation of the polyomavirus enhancer by a murine activator protein 1 (AP1) homolog and two contiguous proteins.
Proc. Natl. Acad. Sci. USA
85:5839-5843[Abstract/Free Full Text].
|
| 27.
|
Masucci, M. G.,
B. Contreras-Salazar,
E. Ragnar,
K. Falk,
J. Minarovits,
I. Ernberg, and G. Klein.
1989.
5-Azacytidine up regulates the expression of Epstein-Barr virus nuclear antigen 2 (EBNA-2) through EBNA-6 and latent membrane protein in the Burkitt's lymphoma line Rael.
J. Virol.
63:3135-3141[Abstract/Free Full Text].
|
| 28.
|
Minarovits, J.,
L. F. Hu,
K. S. Minarovits,
G. Klein, and I. Ernberg.
1994.
Sequence-specific methylation inhibits the activity of the Epstein-Barr virus LMP1 and BCR2 enhancer-promoter regions.
Virology
200:661-667[Medline].
|
| 29.
|
Miyashita, E. M.,
B. Yang,
G. J. Babcock, and D. A. Thorley-Lawson.
1997.
Identification of the site of Epstein-Barr virus persistence in vivo as a resting B cell.
J. Virol.
71:4882-4891[Abstract].
|
| 30.
|
Miyashita, E. M.,
B. Yang,
K. M. Lam,
D. H. Crawford, and D. A. Thorley-Lawson.
1995.
A novel form of Epstein-Barr virus latency in normal B cells in vivo.
Cell
80:593-601[Medline].
|
| 31.
|
Moghaddam, A.,
J. Koch,
B. Annis, and F. Wang.
1998.
Infection of human B lymphocytes with lymphocryptoviruses related to Epstein-Barr virus.
J. Virol.
72:3205-3212[Abstract/Free Full Text].
|
| 32.
|
Puglielli, M. T.,
M. Woisetschlaeger, and S. H. Speck.
1996.
oriP is essential for EBNA gene promoter activity in Epstein-Barr virus-immortalized lymphoblastoid cell lines.
J. Virol.
70:5758-5768[Abstract].
|
| 33.
|
Reisman, D., and B. Sugden.
1986.
trans activation of an Epstein-Barr viral transcriptional enhancer by the Epstein-Barr viral nuclear antigen 1.
J. Virol.
6:3838-3846.
|
| 34.
|
Rickinson, A. B., and E. Kieff.
1996.
Epstein-Barr virus, p. 2397-2446.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields Virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 35.
|
Rickinson, A. B.,
L. S. Young, and M. Rowe.
1987.
Influence of the Epstein-Barr virus nuclear antigen EBNA 2 on the growth phenotype of virus-transformed B cells.
J. Virol.
61:1310-1317[Abstract/Free Full Text].
|
| 36.
|
Robertson, E. S., and E. D. Kieff.
1995.
Genetic analysis of Epstein-Barr virus in B lymphocytes.
Epstein-Barr Virus Rep.
2:73-80.
|
| 37.
|
Robertson, K. D., and R. F. Ambinder.
1997.
Mapping promoter regions that are hypersensitive to methylation-mediated inhibition of transcription: application of the methylation cassette assay to the Epstein-Barr virus major latency promoter.
J. Virol.
71:6445-6454[Abstract].
|
| 38.
|
Robertson, K. D.,
S. D. Hayward,
P. D. Ling,
D. Samid, and R. F. Ambinder.
1995.
Transcriptional activation of the Epstein-Barr virus latency C promoter after 5-azacytidine treatment: evidence that demethylation at a single CpG site is crucial.
Mol. Cell. Biol.
15:6150-6159[Abstract].
|
| 39.
|
Robertson, K. D.,
L. J. Swinnen,
J. C. Zong,
M. L. Gulley, and R. F. Ambinder.
1996.
CpG methylation of the major Epstein-Barr virus latency promoter in Burkitt's lymphoma and Hodgkin's disease.
Blood
88:3129-3136[Abstract/Free Full Text].
|
| 40.
|
Rooney, C.,
J. G. Howe,
S. H. Speck, and G. Miller.
1989.
Influence of Burkitt's lymphoma and primary B cells on latent gene expression by the nonimmortalizing P3J-HR-1 strain of Epstein-Barr virus.
J. Virol.
63:1531-1539[Abstract/Free Full Text].
|
| 41.
|
Rooney, C. M.,
M. Brimmell,
M. Buschle,
G. Allan,
P. J. Farrell, and J. L. Kolman.
1992.
Host cell and EBNA-2 regulation of Epstein-Barr virus latent-cycle promoter activity in B lymphocytes.
J. Virol.
66:496-504[Abstract/Free Full Text].
|
| 42.
|
Ryon, J. J.,
E. D. Fizman,
C. Houchens,
J. Zong,
P. M. Lieberman,
Y.-N. Chang,
G. S. Hayward, and S. D. Hayward.
1993.
The lytic origin of herpesvirus papio is highly homologous to Epstein-Barr virus ori-Lyt: evolutionary conservation of transcriptional activation and replication signals.
J. Virol.
67:4006-4016[Abstract/Free Full Text].
|
| 43.
| Sample, J. Personal communication.
|
| 44.
|
Schaefer, B. C.,
J. L. Strominger, and S. H. Speck.
1997.
Host-cell-determined methylation of specific Epstein-Barr virus promoters regulates the choice between distinct viral latency programs.
J. Virol.
17:364-377.
|
| 45.
|
Schuster, C.,
S. Chasserot-Golaz,
G. Urier,
G. Beck, and A. Sergeant.
1991.
Evidence for a functional glucocorticoid responsive element in the Epstein-Barr virus genome.
Mol. Endocrinol.
5:267-272[Abstract/Free Full Text].
|
| 46.
|
Sinclair, A. J.,
M. Brimmell, and P. J. Farrell.
1992.
Reciprocal antagonism of steroid hormones and BZLF1 in switch between Epstein-Barr virus latent and productive cycle gene expression.
J. Virol.
66:70-77[Abstract/Free Full Text].
|
| 47.
|
Sugden, B., and N. Warren.
1989.
A promoter of Epstein-Barr virus that can function during latent infection can be transactivated by EBNA-1, a viral protein required for viral DNA replication during latent infection.
J. Virol.
63:2644-2649[Abstract/Free Full Text].
|
| 48.
|
Sung, N. S.,
S. Kenney,
D. Gutsch, and J. S. Pagano.
1991.
EBNA-2 transactivates a lymphoid-specific enhancer in the BamHI C promoter of Epstein-Barr virus.
J. Virol.
65:2164-2169[Abstract/Free Full Text].
|
| 49.
|
Swaminathan, S.
1996.
Characterization of Epstein-Barr virus recombinants with deletions of the BamHI C promoter.
Virology
217:532-541[Medline].
|
| 50.
|
Takacs, M.,
S. Myohanen,
E. Altoik, and J. Minarovits.
1998.
Analysis of methylation patterns in the regulatory region of the latent Epstein-Barr virus promoter BCR2 by automated fluorescent sequencing.
Biol. Chem.
379:417-422[Medline].
|
| 51.
|
Thorley-Lawson, D. A.,
E. M. Miyashita, and G. Khan.
1996.
Epstein-Barr virus and the B cell: that's all it takes.
Trends Microbiol.
4:204-208[Medline].
|
| 52.
|
Tsang, S. F.,
F. Wang,
K. M. Izumi, and E. Kieff.
1991.
Delineation of the cis-acting element mediating EBNA-2 transactivation of latent infection membrane protein expression.
J. Virol.
65:6765-6771[Abstract/Free Full Text].
|
| 53.
|
Wang, F.,
C. Gregory,
C. Sample,
M. Rowe,
D. Liebowitz,
R. Murray,
A. Rickinson, and E. Kieff.
1990.
Epstein-Barr virus latent membrane protein (LMP1) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMP1 cooperatively induce CD23.
J. Virol.
64:2309-2318[Abstract/Free Full Text].
|
| 54.
|
Wang, F.,
C. D. Gregory,
M. Rowe,
A. B. Rickinson,
D. Wang,
M. Birkenbach,
H. Kikutani,
T. Kishimoto, and E. Kieff.
1987.
Epstein-Barr virus nuclear antigen 2 specifically induces expression of the B-cell activation antigen CD23.
Proc. Natl. Acad. Sci. USA
84:3452-3456[Abstract/Free Full Text].
|
| 55.
|
Wang, F.,
H. Kikutani,
S. F. Tsang,
T. Kishimoto, and E. Kieff.
1991.
Epstein-Barr virus nuclear protein 2 transactivates a cis-acting CD23 DNA element.
J. Virol.
65:4101-4106[Abstract/Free Full Text].
|
| 56.
|
Woisetschlaeger, M.,
X. W. Jin,
C. N. Yandava,
L. A. Furmanski,
J. L. Strominger, and S. H. Speck.
1991.
Role for the Epstein-Barr virus nuclear antigen 2 in viral promoter switching during initial stages of infection.
Proc. Natl. Acad. Sci. USA
88:3942-3946[Abstract/Free Full Text].
|
| 57.
|
Woisetschlaeger, M.,
C. N. Yandava,
L. A. Furmanski,
J. L. Strominger, and S. H. Speck.
1990.
Promoter switching in Epstein-Barr virus during the initial stages of infection of B lymphocytes.
Proc. Natl. Acad. Sci. USA
87:1725-1729[Abstract/Free Full Text].
|
| 58.
|
Yates, J. L.,
S. M. Camiolo,
S. Ali, and A. Ying.
1996.
Comparison of EBNA1 proteins of Epstein-Barr virus and herpesvirus papio in sequence and function.
Virology
222:1-13[Medline].
|
| 59.
|
Yoo, L. I.,
M. Mooney,
M. T. Puglielli, and S. H. Speck.
1997.
B-cell lines immortalized with an Epstein-Barr virus mutant lacking the Cp EBNA2 enhancer are biased toward utilization of the oriP-proximal EBNA gene promoter Wp1.
J. Virol.
71:9134-9142[Abstract].
|
| 60.
|
Zimber-Strobl, U.,
E. Kremmer,
F. Grasser,
G. Marschall,
G. Laux, and G. W. Bornkamm.
1993.
The Epstein-Barr virus nuclear antigen 2 interacts with an EBNA2 responsive cis-element of the terminal protein 1 gene promoter.
EMBO J.
12:167-175[Medline].
|
| 61.
|
Zimber-Strobl, U.,
K. O. Suentzenich,
G. Laux,
D. Eick,
M. Cordier,
A. Calender,
M. Billaud,
G. M. Lenoir, and G. W. Bornkamm.
1991.
Epstein-Barr virus nuclear antigen 2 activates transcription of the terminal protein gene.
J. Virol.
65:415-423[Abstract/Free Full Text].
|
Journal of Virology, January 1999, p. 826-833, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jimenez-Ramirez, C., Brooks, A. J., Forshell, L. P., Yakimchuk, K., Zhao, B., Fulgham, T. Z., Sample, C. E.
(2006). Epstein-Barr Virus EBNA-3C Is Targeted to and Regulates Expression from the Bidirectional LMP-1/2B Promoter. J. Virol.
80: 11200-11208
[Abstract]
[Full Text]
-
Fogg, M. H., Kaur, A., Cho, Y.-G., Wang, F.
(2005). The CD8+ T-Cell Response to an Epstein-Barr Virus-Related Gammaherpesvirus Infecting Rhesus Macaques Provides Evidence for Immune Evasion by the EBNA-1 Homologue. J. Virol.
79: 12681-12691
[Abstract]
[Full Text]
-
Gordadze, A. V., Onunwor, C. W., Peng, R., Poston, D., Kremmer, E., Ling, P. D.
(2004). EBNA2 Amino Acids 3 to 30 Are Required for Induction of LMP-1 and Immortalization Maintenance. J. Virol.
78: 3919-3929
[Abstract]
[Full Text]
-
Zhao, B., Dalbies-Tran, R., Jiang, H., Ruf, I. K., Sample, J. T., Wang, F., Sample, C. E.
(2003). Transcriptional Regulatory Properties of Epstein-Barr Virus Nuclear Antigen 3C Are Conserved in Simian Lymphocryptoviruses. J. Virol.
77: 5639-5648
[Abstract]
[Full Text]
-
Hayashi, K., Jin, Z., Onoda, S., Joko, H., Teramoto, N., Ohara, N., Oda, W., Tanaka, T., Liu, Y.-X., Koirala, T. R., Oka, T., Kondo, E., Yoshino, T., Takahashi, K., Akagi, T.
(2003). Rabbit Model for Human EBV-Associated Hemophagocytic Syndrome (HPS): Sequential Autopsy Analysis and Characterization of IL-2-Dependent Cell Lines Established from Herpesvirus Papio-Induced Fatal Rabbit Lymphoproliferative Diseases with HPS. Am. J. Pathol.
162: 1721-1736
[Abstract]
[Full Text]
-
Rivailler, P., Cho, Y.-g., Wang, F.
(2002). Complete Genomic Sequence of an Epstein-Barr Virus-Related Herpesvirus Naturally Infecting a New World Primate: a Defining Point in the Evolution of Oncogenic Lymphocryptoviruses. J. Virol.
76: 12055-12068
[Abstract]
[Full Text]
-
Nilsson, T., Zetterberg, H., Wang, Y. C., Rymo, L.
(2001). Promoter-Proximal Regulatory Elements Involved in oriP-EBNA1-Independent and -Dependent Activation of the Epstein-Barr Virus C Promoter in B-Lymphoid Cell Lines. J. Virol.
75: 5796-5811
[Abstract]
[Full Text]
-
Hayashi, K., Ohara, N., Teramoto, N., Onoda, S., Chen, H.-L., Oka, T., Kondo, E., Yoshino, T., Takahashi, K., Yates, J., Akagi, T.
(2001). An Animal Model for Human EBV-Associated Hemophagocytic Syndrome : Herpesvirus Papio Frequently Induces Fatal Lymphoproliferative Disorders with Hemophagocytic Syndrome in Rabbits. Am. J. Pathol.
158: 1533-1542
[Abstract]
[Full Text]
-
Salamon, D., Takacs, M., Ujvari, D., Uhlig, J., Wolf, H., Minarovits, J., Niller, H. H.
(2001). Protein-DNA Binding and CpG Methylation at Nucleotide Resolution of Latency-Associated Promoters Qp, Cp, and LMP1p of Epstein-Barr Virus. J. Virol.
75: 2584-2596
[Abstract]
[Full Text]
-
Dalbiès-Tran, R., Stigger-Rosser, E., Dotson, T., Sample, C. E.
(2001). Amino Acids of Epstein-Barr Virus Nuclear Antigen 3A Essential for Repression of J{kappa}-Mediated Transcription and Their Evolutionary Conservation. J. Virol.
75: 90-99
[Abstract]
[Full Text]
-
Yoo, L., Speck, S. H.
(2000). Determining the Role of the Epstein-Barr Virus Cp EBNA2-Dependent Enhancer during the Establishment of Latency by Using Mutant and Wild-Type Viruses Recovered from Cottontop Marmoset Lymphoblastoid Cell Lines. J. Virol.
74: 11115-11120
[Abstract]
[Full Text]
-
Peng, R., Tan, J., Ling, P. D.
(2000). Conserved Regions in the Epstein-Barr Virus Leader Protein Define Distinct Domains Required for Nuclear Localization and Transcriptional Cooperation with EBNA2. J. Virol.
74: 9953-9963
[Abstract]
[Full Text]
-
Fuentes-Pananá, E. M., Peng, R., Brewer, G., Tan, J., Ling, P. D.
(2000). Regulation of the Epstein-Barr Virus C Promoter by AUF1 and the Cyclic AMP/Protein Kinase A Signaling Pathway. J. Virol.
74: 8166-8175
[Abstract]
[Full Text]
-
Meseda, C. A., Arrand, J. R., Mackett, M.
(2000). Herpesvirus papio encodes a functional homologue of the Epstein-Barr virus apoptosis suppressor, BHRF1. J. Gen. Virol.
81: 1801-1805
[Abstract]
[Full Text]
-
Zhou, S., Fujimuro, M., Hsieh, J. J.-D., Chen, L., Hayward, S. D.
(2000). A Role for SKIP in EBNA2 Activation of CBF1-Repressed Promoters. J. Virol.
74: 1939-1947
[Abstract]
[Full Text]
-
Peng, R., Gordadze, A. V., Fuentes Pananá, E. M., Wang, F., Zong, J., Hayward, G. S., Tan, J., Ling, P. D.
(2000). Sequence and Functional Analysis of EBNA-LP and EBNA2 Proteins from Nonhuman Primate Lymphocryptoviruses. J. Virol.
74: 379-389
[Abstract]
[Full Text]
-
Rivailler, P., Quink, C., Wang, F.
(1999). Strong Selective Pressure for Evolution of an Epstein-Barr Virus LMP2B Homologue in the Rhesus Lymphocryptovirus. J. Virol.
73: 8867-8872
[Abstract]
[Full Text]
-
Ruf, I. K., Moghaddam, A., Wang, F., Sample, J.
(1999). Mechanisms That Regulate Epstein-Barr Virus EBNA-1 Gene Transcription during Restricted Latency Are Conserved among Lymphocryptoviruses of Old World Primates. J. Virol.
73: 1980-1989
[Abstract]
[Full Text]
Top
Abstract
Text
