Previous Article | Next Article 
Journal of Virology, January 1999, p. 718-727, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Cleavage of Poly(A)-Binding Protein by Enterovirus
Proteases Concurrent with Inhibition of Translation In Vitro
Michelle
Joachims,
Pieter C.
Van Breugel,
and
Richard E.
Lloyd*
Department of Microbiology and Immunology,
University of Oklahoma Health Sciences Center, Oklahoma City,
Oklahoma 73104
Received 11 June 1998/Accepted 11 October 1998
 |
ABSTRACT |
Many enteroviruses, members of the family
Picornaviridae, cause a rapid and drastic inhibition of
host cell protein synthesis during infection, a process referred to as
host cell shutoff. Poliovirus, one of the best-studied enteroviruses,
causes marked inhibition of host cell translation while preferentially
allowing translation of its own genomic mRNA. An abundance of
experimental evidence has accumulated to indicate that cleavage of an
essential translation initiation factor, eIF4G, during infection is
responsible at least in part for this shutoff. However, evidence from
inhibitors of viral replication suggests that an additional event is
necessary for the complete translational shutoff observed during
productive infection. This report examines the effect of poliovirus
infection on a recently characterized 3' end translational stimulatory
protein, poly(A)-binding protein (PABP). PABP is involved in
stimulating translation initiation in lower eukaryotes by its
interaction with the poly(A) tail on mRNAs and has been proposed to
facilitate 5'-end-3'-end interactions in the context of the
closed-loop translational model. Here, we show that PABP is
specifically degraded during poliovirus infection and that it is
cleaved in vitro by both poliovirus 2A and 3C proteases and
coxsackievirus B3 2A protease. Further, PABP cleavage by 2A protease is
accompanied by concurrent loss of translational activity in an in
vitro-translation assay. Similar loss of translational activity also
occurs simultaneously with partial 3C protease-mediated cleavage of
PABP in translation assays. Further, PABP is not degraded during
infections in the presence of guanidine-HCl, which blocks the complete
development of host translation shutoff. These results provide
preliminary evidence that cleavage of PABP may contribute to inhibition
of host translation in infected HeLa cells, and they are consistent
with the hypothesis that PABP plays a role in facilitating translation
initiation in higher eukaryotes.
 |
INTRODUCTION |
Enteroviruses are members of the
family Picornaviridae and are the etiologic agents
responsible for many pathological syndromes. Since nearly all
enteroviruses cause drastic inhibition of host cell translation
(17, 25, 43), referred to as host cell shutoff, these
viruses have been intensely studied in the last two decades as ideal
systems to dissect the functionality and mechanisms of eukaryotic
translation. One of the first insights into the mechanism of inhibition
of capped cellular mRNA translation was gained when it was found that
the eIF4G subunit (formerly called p220 or eIF-4
) of eukaryotic
initiation factor 4F (eIF4F; the cap-binding protein complex) was
cleaved early in poliovirus infection, correlating well with the
inhibition of host cell-derived, cap-dependent translation (19,
34). eIF4F is a complex of proteins containing eIF4G; eIF4A, an
RNA helicase; and eIF4E, the cap-binding protein (42). The
eIF4F complex plays a critical role in translation initiation by
recruiting ribosomes to the mRNA-initiation factor precomplex via an
interaction with 40S ribosome-associated eIF3 (for reviews on
translation, see references 42, 43, and
55). Growing evidence suggests that eIF4G functions as a molecular bridge which serves to bring mRNA to the ribosome. The
kinetics of eIF4G cleavage closely parallel the shutoff of host cell
translation, though eIF4G cleavage has been noted to slightly precede
the complete shutoff of host translation (19, 56). Though
this cleavage separates the eIF4E and eIF3 binding domains on eIF4G and
thus is thought to be essential for host cell shutoff to occur, several
lines of evidence suggest that eIF4G cleavage is not in itself
sufficient to cause the complete shutoff of host cell translation.
First, studies of infected cells done with an inhibitor of poliovirus
replication, guanidine, demonstrated that in the absence of detectable
viral replication and viral proteins, translation of cellular protein
was only inhibited by 40 to 60% in the presence of completely degraded
eIF4G (6, 49). Further studies with other inhibitors of
viral replication, such as monensin and nigericin, showed essentially
the same result (30). In some instances, cellular
translation continued at nearly normal levels while eIF4G had been
completely degraded. Furthermore, a poliovirus mutant was described
which did not cause cleavage of eIF4G but did cause global host
translation inhibition (4), which indicated that other
events were playing a role in the translation inhibition. Despite
numerous efforts, cleavage or alteration of other translation
initiation factors has not been found (16, 18, 64). eIF2
,
which plays a role in forming the initiator Met-tRNA complex
(61), has been shown to undergo phosphorylation during the
latter part of infection (5, 47). However, this phosphorylation is thought to occur too late to be involved in host
cell shutoff, and it is probably involved in the global inhibition of
translation at the end of the infectious cycle. These studies have
suggested that although eIF4G cleavage may be an integral part of host
cell translation shutoff, another alteration(s) or event(s) must be
occurring during infection to allow the complete switch from cellular
cap-dependent mRNA translation to viral cap-independent translation.
Many recent studies have begun to uncover how translation initiation
can occur by mechanisms dependent on the 3' end of mRNA. There have
been a variety of studies examining the effect of 3' untranslated
regions (UTRs) on translation regulation during development (14) and numerous studies showing that the polyadenylate
tails present on the ends of most eukaryotic mRNAs act as translational initiation regulators (20, 28, 44). However, these data have
been difficult to reconcile with current initiation models, which
propose that the required steps in translation initiation took place on
structures present at the 5' ends of mRNAs via the 5' mRNA cap
structure. Recent studies of yeast and plant systems have shown that 5'
and 3' regions of mRNAs are capable of associating via protein factors
binding specifically to these regions. In particular, the
poly(A)-binding protein (PABP) Pab1p, which interacts with the
poly(A) tail present on most eukaryotic mRNAs, has been shown to
interact with the eIF4G homologues in yeast, Tif4631p and
Tif4632p (59). In plants, PABP interacts with eIF-iso4G and
eIF4B (36) and increases PABP's RNA-binding affinity.
Studies of the translation efficiencies of mRNAs containing either a
cap structure alone or a poly(A) tail alone show that both mRNAs are capable of undergoing translation but that the presence of both structures provides a synergistic stimulation of translation efficiency (20, 28). It has also been shown in yeast that the poly(A) tail is itself a translational promoter and that this structure together with the cap structure is able to promote efficient ribosome recruitment to the 5' end of mRNA as well as to facilitate correct initiation codon choice (50). Thus, it has been proposed
that in yeast, functional interactions occur between the 5' and 3' ends
of mRNAs via Pab1p binding to eIF4G and possibly other initiation factors localized at the 5' ends of RNAs (59). This has been termed the closed-loop model of initiation. In fact, it has recently been shown that yeast eIF4E, eIF4G, and Pab1p are sufficient to link 5'
and 3' ends of mRNA in ring-like structures which can be visualized by
atomic force microscopy (62). In the mammalian system, a
newly identified protein called PAIP-1 (for PABP interacting protein
1), which shares homology with eIF4G and interacts with PABP and eIF4A,
has been described (13). This protein is proposed to provide
the physical link between the 5' and 3' ends of RNAs in mammalian
cells, thus closing the loop, since evidence for other factor
interactions is currently lacking. Further, recent findings suggest
that PABP may also directly bind eIF4G via a segment near the amino
terminus of eIF4G (29). The juxtaposing of the two
ends of cellular mRNAs would then facilitate mechanisms encompassing
regulation from both the 5' and 3' structures of RNAs and
facilitate reinitiation of transiting ribosomes by a mechanism
that is independent of intact eIF4G.
PABP has been cloned and sequenced from several divergent organisms and
has been found to be a highly conserved protein containing four
RNA-binding motifs and a less conserved proline-rich carboxyl-terminal domain (21, 24, 46). PABP is the founding member of the family of 68- to 72-kDa RNA-binding proteins containing conserved RNA
recognition motifs (RRMs) (1, 52). The RRMs are composed of
approximately 90 amino acids, with highly conserved hydrophobic cores
(45). PABP from yeast (Pab1p) is essential for viability and
is involved in translational regulation through interaction with eIF4G
(33, 59). PABPs from both Xenopus laevis and
humans have been characterized with regard to their RNA-binding
affinities and their structures and functions (21, 46),
though the domains responsible for high-affinity RNA binding in the two
proteins differ. PABP is an important regulator of translation in
development (63) and may be involved in RNA transport and
stability by its binding to poly(A) tails (45, 51). These
results imply an important role for PABP function in the regulation of
translation, though evidence for this role has not yet been directly
presented in a mammalian system.
Translation initiation can occur independently of the 5' cap group by
means of mRNA 3' poly(A) tail-dependent mechanisms (36, 50,
60), which could thereby circumvent the loss of intact 4G in
poliovirus infections in the presence of guanidine, allowing for
continuing translation. Accordingly, we hypothesized that poliovirus
infection may cause an alteration in a protein which interacts with the
3' ends of cellular mRNAs. In this report, we examine the fate of PABP
in human cells and show that PABP is specifically degraded during
poliovirus infection, that is cleaved in vitro by poliovirus proteases
2A and 3C (2Apro and 3Cpro), as well as
coxsackievirus B3 2Apro, and that its degradation is
observed concurrently with a loss of in vitro-translation activity in
extracts from uninfected HeLa cells and HeLa cells infected with
poliovirus in the presence of guanidine.
 |
MATERIALS AND METHODS |
Cells and virus infection.
HeLa S10 cells were grown in
spinner culture in Joklik's minimal essential medium supplemented with
9% bovine calf serum-1% fetal calf serum and penicillin-streptomycin
(Sigma). Poliovirus type 1 (Mahoney) was grown and purified as
previously described (9). All virus infections were done at
a multiplicity of infection of 100, including 2 mM guanidine-HCl in the
media where poliovirus infections in the presence of guanidine were
utilized. Serum was added to 5% at 30 min postinfection (p.i.), and
the cells were harvested at the indicated time. For pulse labeling, an
aliquot of cells was taken at the indicated time and pelleted. The
cells were resuspended in 0.5 ml of methionine-free medium containing 30 µCi of 35S-TransLabel (ICN)/ml and labeled for 15 min
at 37°C. The cells were then lysed in Nonidet P-40 (NP-40)-ribosome
standard buffer (RSB) (1% NP-40, 10 mM NaCl, 10 mM Tris-HCl [pH
7.4] 1.5 mM MgCl2), and the cytoplasmic fraction was
mixed with sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) sample buffer for gel analysis. Unlabeled infections were
harvested, cells were lysed, and gel samples were made in an manner
identical to that described above. For immunoprecipitations, the cells
were pulse labeled in methionine-free medium containing 100 µCi of
35S-TransLabel/ml for 2 h, washed once with
phosphate-buffered saline (PBS), resuspended in complete medium with or
without additions, and then incubated as described in the figure legends.
PABP and protease purification.
Human PABP cloned into
pET-11a vector (pET-PABP [21]) was transformed into
Escherichia coli BLR(DE3) cells (Invitrogen) and induced
with 0.4 mM IPTG (isopropyl-
-D-thiogalactopyranoside) for 3 h. Recombinant PABP was purified by standard purification techniques as follows. Cells were resuspended in 20 mM Tris (pH 7.0)-1
mM EDTA-50 mM KCl-50 mM NaCl-5% glycerol and sonicated to lyse
them. The cell lysate was clarified by centrifugation at 10,000 × g for 15 min, and then the supernatant was loaded on a
Sephacryl S300 (Pharmacia) gel filtration high-performance liquid
chromatography column. The high-molecular-weight fractions were pooled
and loaded on a Fast S Sepharose (Pharmacia) cation-exchange column at
pH 6.0. Proteins were eluted on a 0.1 to 1.0 M NaCl gradient, and the
fractions containing PABP were pooled. This pool was dialyzed against
buffer containing 10 mM HEPES, pH 7.5, 100 mM KCl, 10 mM NaCl, 1 mM
MgCl2, 0.1 mM EDTA, 10% glycerol and concentrated in a
Centricon spin concentrator (Amicon) (10-kDa cutoff).
To make histidine-tagged PABP, the pET-PABP vector was used as a
template for PCR amplification of the PABP insert. Primers were
designed to facilitate cloning into the pTrcHisB vector (Invitrogen), using BamHI and KpnI sites to insert PABP. The
primers were synthesized (Integrated DNA Technologies) as follows:
forward primer, 5' GGCGGATCCGATGAACCCCAGTGC 3'; reverse
primer, 5' GGCCACAAGGTTGACAAATTCCATGGCGC 3'. The
1.9-kb PCR product was ligated by TA cloning into pGEM-T
(Promega), and then the insert was cut out with BamHI and
KpnI and ligated into pTrcHisB. The construct was
transformed into DH5
cells, grown, and induced in accordance with
the manufacturer's instructions. The growth of cells and induction of
recombinant protein were done at 30°C. The His-PABP was purified on
Talon resin (Clontech) under denaturing conditions, dialyzed into
dialysis buffer (described above), and used for in vitro-cleavage assays.
For reactions with
35S-labeled PABP, the protein was
synthesized in reticulocyte lysate (Promega) under standard translation
conditions with the pET-PABP plasmid linearized with
BamHI
to
express full-length
PABP.
Poliovirus 2A
pro was expressed in
E. coli from
pATH2A and used as a crude extract as previously described (
7,
65). Poliovirus
3C
pro was expressed from pET3Chc
plasmid (Thomas Pfister) as a C-terminal
histidine-tagged protein in
BLR(DE3) cells and purified to homogeneity
on Talon resin under
nondenaturing
conditions.
Coxsackievirus B3 (CVB3) 2A
pro was cloned by using the
vector pCVB3-20 (
11) as a template for PCR amplification of
the 2A
pro gene region. Primers were designed to facilitate
cloning into
the pET22b(+) vector (Novagen) by using
NdeI
and
EcoRI sites and
to introduce start and stop codons into
the cDNA. The primers
were synthesized (Integrated DNA Technologies) as
follows: forward
primer, 5'
GAGGATCCCATATGGGCGCATTTGGACAACAATC 3'; reverse primer,
5'
GGAATTCACTGTTCCATTGCATCATCTTCCAG 3'. The 0.46-kb PCR product
was digested with
NdeI and
EcoRI and ligated into
pET22b(+) previously
digested with the same restriction endonucleases.
The resulting
construct, pET-Cx2A, was transformed into BLR(DE3)
pLys S cells,
and CVB3 2A
pro was expressed at 34°C and
purified to homogeneity by the procedure
previously described for CVB4
2A
pro (
37).
PABP cleavage assays, immunoprecipitations, sequencing, and
blotting.
In vitro-cleavage assays of PABP were performed with
essentially the same conditions regardless of the source of the
substrate. Ribosomal salt wash (RSW) was prepared as described
previously (9) and used as a substrate in cleavage reactions
with proteases in vitro. Reaction mixtures containing 2 to 4 µl of
RSW, various amounts of protease, and 50 mM NaCl-5 mM
MgCl2 were incubated at 37°C for 2 to 4 h (as
indicated in the figure legends). Cleavage reactions with in
vitro-translated PABP utilized 3 µl of reticulocyte translation
reaction mixture mixed directly with protease. Reactions with purified
recombinant PABP proteins contained purified protein to which protease
was added and incubated at 37°C for the indicated time. All reactions
were stopped by the addition of SDS-PAGE sample buffer and were
analyzed on SDS-polyacrylamide gels by immunoblotting or staining with
Coomassie blue. Data from the gels was scanned with an Artec
Viewstation A6000C Plus scanner and imaged with Adobe Photoshop version
3.0. For sequencing of the PABP 2Apro cleavage product, a
glutathione S-transferase-PABP fusion protein was
generated and purified as previously described (3), and then
cleavage assays with an equimolar ratio of substrate to protease were
allowed to proceed overnight. The proteins were electrophoresed on a
SDS-13% polyacrylamide gel and then transferred to polyvinylidene difluoride membranes. The Coomassie blue-stained protein band was
subjected to microsequencing by the University of Oklahoma Health
Sciences Center Molecular Biology Resource Facility.
For immunoblotting PABP, monoclonal antibody to PABP (10E10
[
21]) was used at a 1:10,000 dilution in a solution of
5% dry
milk containing 150 mM NaCl with overnight incubation at 4°C.
Secondary antibody (goat anti-mouse horseradish peroxidase; Pierce)
was
used at 1:10,000 dilution in the same dry milk solution and
incubated
for 2 h at room temperature. The blots were washed thoroughly
with
PBS-T (PBS-0.05% Tween-20) and then developed with the SuperSignal
enhanced chemiluminescence system (Pierce). Immunoblotting for
eIF4G
was done as previously described (
38). Immunoprecipitations
of PABP were done with monoclonal antibody 10E10 essentially as
previously described (
21), with the following exceptions:
the
cells were lysed in NP-40-RSB, the nuclei were removed, and then
the clarified cell extract was brought to a volume of 0.5 ml with
RSB
containing 1% Empigen BB followed by incubation with 2 µl
of
ascites/reaction and 25 µl of protein A-agarose beads. The
resulting
autoradiographs were scanned with an Artec Viewstation
A6000C plus
scanner and imaged with Adobe Photoshop version 3.0.
Endogenous mRNA in vitro-translation assays.
Translation of
endogenous mRNA in vitro was done essentially as described previously
(39). Briefly, HeLa cells (either infected or mock-infected)
were harvested by centrifugation and washed three times with ice-cold
Earle's balanced salt solution. The cells were resuspended in 1.5 cell
volumes of lysis buffer [10 mM KCl, 2.5 mM dithiothreitol, 1.2 mM
Mg(OAc)2, 20 mM HEPES-KOH, pH 7.4] and then incubated on
ice for 10 min. The cells were lysed by a minimal number of Dounce
homogenizer strokes (6 to 8), and then the lysate was clarified by
centrifugation at 10,000 × g. The supernatant was
removed, aliquoted, and stored at
80°C for translation reactions.
The reaction mixtures contained 10 µl of cell extract, added
exogenous protease where indicated, 20 µCi of
35S-TranSLabel, 5 µl of 5× translation cocktail [which
delivered final concentrations of 1 mM Mg(OAc)2, 90 mM
KOAc, 10 mM HEPES (pH 7.5), 0.1 mM amino acids (methionine minus), 1 mM
dithiothreitol, 25 mM creatine phosphate, 5 µg of creatine kinase/ml,
0.5 mM GTP, and 1.0 mM ATP], and diethyl pyrocarbonate-treated
H2O to a final volume of 25 µl. For preincubated
reactions, all components but 5× translation cocktail and label were
added and incubated for 60 min at 30°C. After the preincubation, the
cocktail and label were added and the reaction was continued for 60 additional minutes at 37°C. At the end of the reaction, SDS-PAGE
sample buffer was added, the samples were heated at 100°C for 3 to 4 min, and the reaction products were analyzed on 10% polyacrylamide
gels. Half of the sample was used for autoradiography, and the other
half was used for immunoblotting for PABP; the data was scanned with an
Artec Viewstation A6000C Plus scanner and imaged with Adobe Photoshop
version 3.0.
 |
RESULTS |
We first asked whether there was a detectable change in PABP
during poliovirus infection, either in abundance or form. Figure 1A shows an immunoblot of cytoplasmic
lysates from poliovirus-infected HeLa cells harvested at various times
p.i. by using a monoclonal antibody to human PABP (21),
while Fig. 1B shows the quantitation of this data. Figure 1A shows that
during a typical infection, PABP is decreasing in abundance during the
course of infection. Though we have only transiently observed cleavage
products detectable by immunoblotting with this antibody (see Fig. 5),
this decrease was most likely due to a proteolytic degradation. The
extent of cleavage of PABP varies slightly from infection to infection
and correlates with the multiplicity of infection and levels of viral protein expression (data not shown), but it has never been complete by
6 h p.i. Figure 1A also shows the corresponding cleavage of eIF4G
in the same infection, demonstrating the typical complete cleavage
which is manifest by approximately 3 h p.i. Most translation shutoff begins by 2 h p.i. and is complete by 4 h p.i.
(reference 19 and data not shown). Therefore, over
50% of PABP is still intact in infected cells at times (3 to 4 h
p.i.) when host translation inhibition is complete (Fig. 1B). In HeLa
cells, PABP is normally a very stable and abundant protein, having a
half-life greater than 8 h (21). To confirm this in our
cells, we performed pulse-chase analysis of PABP stability in HeLa
cells. Figure 1C shows that in both mock-treated and
cycloheximide-treated cells, there is very little turnover of PABP.
Therefore, PABP remains stable even during conditions of global
translational inhibition. However, pulse-chase analysis confirmed a
reduction in PABP of about 50% in infected cells, which agrees well
with immunoblotting results. Taken together, these results suggest that
PABP degradation is not likely due to increased turnover or lack of
synthesis stemming from virus-induced translational inhibition but is
consistent with degradation by a viral protease.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
PABP is degraded during poliovirus infection. (A) HeLa
spinner cells were mock infected (Mock) or infected with poliovirus,
and samples were harvested at the indicated times p.i. (hpi). Aliquots
of these samples were subjected to SDS-PAGE and immunoblotted with a
monoclonal antibody to PABP (10E10) (upper left gel) or a polyclonal
antibody to eIF4G (lower left gel). cp, cleavage product. (B)
Densitometric images of three immunoblots prepared as for panel A were
quantitated with an Alpha Innotech imager; the average of the data is
shown. The data are represented as percentages of intact PABP levels
relative to the amount in mock-infected cells. (C) Immunoprecipitations
of PABP were done as described in Materials and Methods on extracts
prepared from cells that were pulse labeled for 2 h and then
harvested (Control) or subsequently chased for the indicated length of
time with either complete medium (mock) or complete medium containing
10 µg of cycloheximide/ml (CHI) or infected with poliovirus for the
indicated length of time. The number below each lane corresponds to the
densitometric quantitation of the PABP band relative to the control
lane (% Ctrl.).
|
|
From these initial experiments, it became clear that PABP was degraded
or cleaved during infection. Next, we were interested to know whether
this cleavage still occurred during infection in the presence of
guanidine-HCl, which inhibits viral replication but also blocks the
development of complete host translation shutoff (6, 8). If
PABP cleavage was required for complete host cell shutoff to occur,
then PABP cleavage should be inhibited during infections in the
presence of guanidine-HCl. The level of PABP was analyzed by
immunoblotting at various time points during poliovirus infection in
the presence of guanidine (Fig. 2A). It
is readily apparent that the abundance of PABP does not change
significantly during infection in the presence of guanidine, indicating
that the cleavage observed during poliovirus infection requires
efficient viral protein synthesis and is likely directly mediated by a
viral protein. Quantitation of immunoblots showed that the PABP content
of the cells varied less than 12% (data not shown) during this
infection. Figure 2B shows the extent of translational inhibition under
these conditions; as previously documented (6, 8, 49), the
translation levels in poliovirus-guanidine-infected cells were only
inhibited by approximately 50%, while eIF4G was completely cleaved
(data not shown). Thus, the absence of PABP cleavage during poliovirus
infections in the presence of guanidine is consistent with this
alteration playing a role in the total translational shutoff induced by
poliovirus infection.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
PABP is not degraded during poliovirus infection in the
presence of guanidine. (A) HeLa cells were mock-infected (Mock) or
infected with poliovirus in the presence of 2 mM guanidine-HCl, and
samples were harvested at the indicated times p.i. for immunoblot
analysis with PABP antibody. (B) HeLa cells infected with poliovirus in
the presence (Polio/GN) or absence (Polio) of guanidine were pulse
labeled with [35S]Met at the indicated times p.i., and
aliquots were analyzed by SDS-PAGE for radiolabeled proteins. The
positions of the poliovirus proteins are indicated.
|
|
We were then interested in determining whether the poliovirus
2Apro was capable of cleaving PABP in vitro.
2Apro is involved in the cleavage of eIF4G (7, 34,
40) and appears to be the key viral component responsible for
inducing host cell shutoff (15, 58) as well as enhancement
of viral translation (26, 41, 48). In vitro-cleavage assays
were performed with a crude translation initiation factor preparation
(RSW) from uninfected HeLa cells as a PABP substrate. RSW was incubated
with either no protease (Fig. 3, lanes 1)
or increasing amounts of recombinant poliovirus 2Apro
extract (Fig. 3, lanes 2 to 4). On the left of Fig. 3 is an immunoblot with PABP antibody, and on the right is a blot from the same samples with eIF4G antiserum. Clearly, at the highest level of added poliovirus 2Apro, nearly complete cleavage of PABP in the RSW sample
was observed. By contrast, all concentrations of 2Apro
caused complete cleavage of eIF4G substrate (Fig. 3, right blot, lanes
2 to 4). These cleavages in vitro reflect the highly efficient cleavage
in vivo of eIF4G, which is completely degraded by 3 h p.i.
(19). The incomplete cleavage of PABP in vitro and in vivo may reflect a less efficient cleavage reaction or the existence of
variable substrate conformations or compartmentalized pools which
inhibit cleavage, or it may simply be due to the abundance of PABP
substrate in the cell.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
Poliovirus 2Apro degrades PABP in vitro. In
vitro-cleavage reaction mixtures were assembled as described in
Materials and Methods, using 4 µl of RSW with 0 (lanes 1), 2 (lanes
2), 4 (lanes 3), or 10 µl (lanes 4) of recombinant poliovirus
2Apro bacterial extract. Reaction mixtures were incubated
at 37°C for 3 h and then analyzed by gel electrophoresis and
immunoblotting. The blots shown are from the same gel analyzed with two
different antibodies, PABP (left) and eIF4G (right). The positions of
eIF4G cleavage products (cp) are indicated.
|
|
Next, we were interested in examining the cleavage of PABP by using
purified proteases. To help exclude the possibility of cleavage
artifacts, purified proteases were used for in vitro-cleavage assays.
Poliovirus 2Apro is prone to aggregation, and stringent
purification of active enzyme is very difficult (7).
Therefore, we chose to utilize CVB3 2Apro since its
substrate specificity and cleavage efficiency is nearly identical to
those of poliovirus 2Apro but its biochemical
properties enable it to be purified much more readily (7,
37). CVB3 and poliovirus 2Apros produced
identical cleavage products of PABP in vitro (see Fig. 5); thus,
purified CVB3 2Apro was substituted for poliovirus
2Apro in subsequent experiments. We examined poliovirus
3Cpro in vitro as well, since one other cellular protein,
microtubule-associated protein 4 (MAP-4), is cleaved by
3Cpro during infection but not in the presence of guanidine
(32), as is the case for PABP. For these assays, purified
recombinant CVB3 2Apro or affinity-purified recombinant
poliovirus 3Cpro with a C-terminal histidine tag was
incubated with RSW substrate containing PABP. PABP was then analyzed by
immunoblotting. Figure 4 (left
blot) shows the same type of cleavage of PABP by CVB3 2Apro
seen earlier, showing that at the highest concentration nearly complete
cleavage or degradation of PABP occurred. As noted before, cleavage
products which react with the monoclonal antibody were not
detected. Other experiments have shown complete cleavage of PABP at
this concentration, while all concentrations of purified 2Apro tested resulted in complete cleavage of eIF4G in the
same samples (data not shown). Figure 4 (right blot) shows the result
of incubating PABP with purified poliovirus 3Cpro. Though
the protease concentrations necessary for comparable cleavage of
PABP were much higher for 3Cpro than for 2Apro,
it was readily apparent that both proteases were capable of cleaving PABP in vitro.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
Purified 2Apro and 3Cpro cleave
PABP in vitro. Cleavage reactions with RSW and purified recombinant
2Apro from CVB3 (left) or purified recombinant poliovirus
3Cpro (right) with the indicated quantities of protease
were incubated for 3 h at 37°C and analyzed by gel
electrophoresis and immunoblotting with PABP antibody.
|
|
Since we could demonstrate cleavage of PABP in vitro by both
2Apro and 3Cpro but could not detect cleavage
products with the PABP monoclonal antibody, we next examined the
cleavage pattern induced by incubating purified viral proteases with
radiolabeled PABP translated in vitro in a reticulocyte lysate.
Labeled PABP was incubated with purified proteases and analyzed by
SDS-PAGE. The autoradiograph clearly shows the generation of major
cleavage products for both proteases which are distinct from one
another (Fig. 5A). Incubation of PABP
with 2Apro results in the generation of cleavage
products of approximately 57 and 14 kDa, the total of which correlates
well with the apparent molecular mass for PABP (approximately 72 kDa).
Cleavage by poliovirus 3Cpro results in the generation of
cleavage products of approximately 61 and 8 kDa, again approximately
the correct total molecular mass for PABP, suggesting that these are
all primary cleavage products generated by the enzymatic activity of
these proteases. It is possible that other, minor cleavage products are
produced, but analysis is obscured by aberrant translation products in
the sample (Fig. 5A, lane 1) previously noted to occur from translation of PABP in vitro (21, 24). Figure 5B shows a very faint
immunoblot cleavage product band from a poliovirus-infected cell lysate
of approximately the same size as the larger primary cleavage product generated by 2Apro in vitro. This band has only been
observed sporadically by immunoblot analysis, and in very low
abundance, but it is identical in size to those detected by cleavages
in vitro with purified 2Apro, indicating that this cleavage
is occurring during infection with poliovirus. It was also observed
that the cleavage efficiency of 2Apro for PABP was greater
than that of 3Cpro, since when the two proteases were
incubated together (Fig. 5A), the observed cleavage products
corresponding to 2Apro cleavage were much more abundant
than those corresponding to 3Cpro cleavage. Interestingly,
incubation of PABP with both proteases also demonstrated a lack of
further processing when both proteases were present. The reason for
this is unknown, but it could reflect differences in PABP conformation
or complexes with other proteins which inhibit cleavage. Alternatively,
mRNA binding may influence the susceptibility of PABP to cleavage.
Figure 5C compares an in vitro cleavage assay of radiolabeled PABP
incubated with CVB3 and poliovirus 2Apros. The 57-kDa
cleavage product was again apparent and was identical in appearance for
the two viral proteases, which indicated that the cleavage of PABP by
poliovirus and CVB3 2Apros likely occurs at the same site.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 5.
PABP cleavage products from in vitro cleavages
correspond to the cleavage detected during poliovirus infection in
vivo. (A) Reticulocyte lysate-translated PABP was used as a substrate
for PABP cleavage reactions, as detailed in Materials and Methods. The
cleavage reaction mixtures contained 1.0 µg of CVB3
2Apro, 1.5 µg of poliovirus 3Cpro, or a
combination of both proteases and were incubated for 3 h at
37°C. The positions of the PABP cleavage products (cp) generated by
each protease are indicated, as well as molecular mass marker
positions. (B) In vivo cleavage product (PABP cp) detected by
immunoblot analysis by PABP antibody in lysate derived from a
poliovirus infection and harvested at 4 h. (C) Poliovirus
2Apro and CVB3 2Apro generate similar PABP
cleavage products. Reticulocyte lysate-translated PABP was incubated
alone or with 1.0 µg of CVB3 2Apro or 10 µl of
poliovirus 2Apro extract and analyzed by gel
electrophoresis and autoradiography. The position of the 57-kDa
cleavage product (2A cp) is indicated.
|
|
To help rule out the possibility of an indirect cleavage mechanism
being involved in PABP cleavage, purified proteases were incubated with
nearly purified PABP substrates (Fig. 6).
As shown in Fig. 6B, affinity-purified His-PABP bearing an
amino-terminal histidine tag was used for in vitro-cleavage assays. The
same cleavage products (both slightly larger due to the histidine tag: approximately 62 and 66 kDa for 2A and 3C cleavage products,
respectively) previously demonstrated for reticulocyte lysate-derived
PABP were observed, indicating that both 2Apro and
3Cpro utilize PABP as a substrate. The smaller cleavage
products at 14 and 8 kDa were difficult to observe in these experiments
due to background E. coli proteins. Since there were still
some bacterial contaminants present in the preparation, recombinant
PABP was purified by means of conventional column chromatography and
incubated in vitro with purified proteases (Fig. 6B). The same large
(57- and 61-kDa) cleavage products were observed, suggesting that the cleavage of PABP by 2Apro and 3Cpro were the
result of specific proteolytic cleavage by the proteases and not by
contaminating proteins in the preparations.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 6.
Cleavage of purified PABP by purified 2Apro
and 3Cpro. Purified recombinant histidine-tagged PABP
(His-PABP) (left) or unmodified PABP (right) was incubated with
purified CVB3 2Apro or poliovirus 3Cpro or
both. (A) Lane 1, unincubated His-PABP; lane 2, His-PABP incubated
alone; lane 3, His-PABP plus 1.0 µg of 2Apro; lane 4, His-PABP plus 1.5 µg of 3Cpro; lane 5, His-PABP plus 1.0 µg of 2Apro-1.5 µg of 3Cpro. (B) Lane 1, PABP incubated alone; lane 2, PABP plus 1.0 µg of 2Apro
(37°C incubation); lane 3, PABP plus 1.0 µg of 2Apro
(30°C incubation); lane 4, PABP plus 1.0 µg of 3Cpro
(37°C incubation). The reactions shown in panel A were incubated for
16 h at 30°C, and those shown in panel B were incubated at the
indicated temperature for 16 h and then analyzed by SDS-PAGE and
Coomassie blue staining. **, 2Apro; *,
3Cpro.
|
|
We next wanted to determine the approximate locations of the
cleavage sites relative to the structural and functional domains of PABP. To do this, we used a commercially available monoclonal antibody to hexahistidine protein motifs and probed an immunoblot of cleavage reactions with amino-terminal-tagged His-PABP as a substrate (Fig. 7A). Lanes 1 and 5 contained purified His-PABP incubated without protease, while lanes 2 to 4 included increasing amounts of 2Apro and lanes 6 to 8 included increasing amounts of 3Cpro. The
lower-molecular-mass proteins observed in the absence of protease may
reflect minor degradation of the protein during purification. However,
the bold cleavage products at approximately 62 kDa for 2Apro and 66 kDa for 3Cpro reflect the presence
of the amino-terminal histidine tag on these cleavage products. This
indicates that the cleavage sites for both proteases reside in the
carboxyl-terminal domain of PABP. 2Apro may also generate a
minor cleavage product (25 kDa) from a second cleavage site.
These results also show that the primary cleavage sites for the
two proteases are close to each other, since the masses of the
cleavage products differ by only 4 to 5 kDa. The location of the
primary cleavage sites of both poliovirus 2Apro and
3Cpro on PABP are indicated in the schematic diagram in
Fig. 7B, which depicts the relative locations of the 4 RRMs for PABP
responsible for poly(A) binding and indicates that both primary
cleavage sites are located within the proline-rich region in the
carboxyl terminus. Identification of the primary cleavage site for CVB3
2Apro was accomplished by microsequencing the small
cleavage product (Fig. 7C). CVB3 2Apro cleaves the scissile
bond between Met487 and Gly488 (numbering according to reference
24). While it is unusual for an enterovirus 2Apro to utilize a Met in the P1 position, the presence of
Thr in the P2 and P4 positions, as well as the invariant Gly in the P1'
position, is a very favorable determinant of cleavage by
2Apro (27, 57).

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 7.
PABP is cleaved in its carboxyl-terminal region by both
2Apro and 3Cpro. (A) Affinity-purified His-PABP
was incubated with the indicated quantities of either CVB3
2Apro or poliovirus 3Cpro for 3 h at
37°C and then analyzed by immunoblotting with antibody to
hexahistidine tag. The positions of the large PABP cleavage products
(cp) generated by each protease are indicated. (B) Schematic diagram of
PABP structure showing known functional domains and localization of the
protease cleavage sites on PABP. (C) Sequence of the primary cleavage
site (*) for CVB3 2Apro on PABP.
|
|
As a preliminary step to address the possibility that cleavage of PABP
during poliovirus infection plays a role in host cell shutoff, we
decided to examine the effect of the addition of purified proteases to
an in vitro-translation assay of endogenous mRNA translation (Fig.
8). As mentioned previously, translation
in poliovirus-guanidine-infected cells occurs at levels of 40 to 60%
of normal rates, even though the eIF4G is completely cleaved (8). We reasoned that if cleavage of PABP were to cause a
decrease in translation, this would be most evident in the extracts
from infections in the presence of guanidine, due to the partial
translation inhibition already present from prior in vivo cleavage of
eIF4G. The translation assays utilized extracts prepared from
mock-infected HeLa cells and cells infected in the presence or absence
of guanidine-HCl, as indicated in Fig. 8. Lysates were preincubated
without protease (Fig. 8A, lanes 1, 4, and 7), with purified
2Apro (Fig. 8A, lanes 2 and 5), or with 3Cpro
(Fig. 8A, lanes 3 and 6) for 60 min to allow for protease enzymatic activity. After preincubation, radiolabel and translation cocktail were
added and translation of endogenous mRNA was allowed to proceed for 60 min, after which the samples were processed for gel electrophoresis. Compared to the level of translation when the extracts were incubated in the absence of protease (Fig. 8A, lanes 1 and 4), the addition of
2Apro inhibited translation from both extracts, though the
overall inhibition observed in the poliovirus-guanidine-infected
extract was greater than that for the mock-infected lysates. These data indicated that 2Apro treatment of mock-infected extract
inhibited translation approximately 50% while treatment of
poliovirus-guanidine-infected extracts inhibited translation nearly
completely (15 and 7% [Fig. 8A, lanes 5 and 6]). As shown in Fig.
8A, preincubation with 2Apro resulted in complete PABP
cleavage concurrent with inhibition of translation of endogenous mRNA
(lanes 2 and 5). Preincubation with 3Cpro resulted in a
modest decrease in PABP, but surprisingly, it was also able to decrease
translation rates in vitro. This inhibition of translation by
3Cpro alone was readily reproducible (data not shown),
though typically not as extensive as that produced by
2Apro. An effect of 3Cpro on translation has
not been reported previously, but it may require coexpression of
2Apro to be evident in vivo. Inhibition of
translation upon addition of either protease was more nearly complete
when eIF4G was previously cleaved in vivo (Fig. 8A, lane 6).

View larger version (147K):
[in this window]
[in a new window]
|
FIG. 8.
Inhibition of translation in vitro correlates with
degradation of PABP by 2Apro and 3Cpro. (A)
Extracts generated from mock-infected HeLa cells (Mock) or HeLa cells
infected with poliovirus with (PV/Gn) or without (Polio) guanidine were
incubated in translation reactions as described in Materials and
Methods. The reactions were assembled with or without protease (1.0 µg/reaction) and preincubated for 60 min at 30°C. Radiolabel and
cocktail were then added, and incubation was continued for 60 additional minutes at 37°C. Half of the sample was used for SDS-PAGE
and autoradiography (top), while the other half is shown analyzed by
immunoblotting with antibody to PABP (bottom). Lane 7 shows translation
derived from poliovirus extracts without added protease, while the lane
labeled Mock, NE, designates translation in a mock-infected extract
reaction without an added energy source (creatine phosphate-creatine
kinase). (B) Extracts from mock-infected HeLa cells (Mock) or
poliovirus-guanidine-infected cells (PV/Gn) were assembled into
reactions as described in Materials and Methods. All components except
radiolabel were added initially and incubated at 30°C to allow
endogenous translation. At the indicated time, radiolabel (20 µCi)
was added to each reaction, and translation was allowed to continue for
60 min more at 37°C. The samples were processed as described for
panel A. The Mock, NE, lane was prepared the same way as the Mock, 0 min, lane without creatine phosphate-creatine kinase. Below each lane,
the percent translation rate compared to that of mock-infected lysate
is shown as an average of two separate experiments (quantitated with
National Institutes of Health image software).
|
|
In contrast to Fig. 8A, where extracts were preincubated with proteases
before translation was initiated, Fig. 8B shows extracts in which
protease incubation and translation were initiated concurrently. Translation lysates were pulse labeled at various times during the
incubation to measure the effects on translation rates and PABP
cleavage. As expected, preincubation of lysates alone for 60 min
resulted in a 50% loss of translation efficiency (Fig. 8B, compare
lanes 2 and 3) and reduced control translation to levels comparable to
those observed for the lysates shown in Fig. 8A, which were also
preincubated. Addition of 2Apro for only 15 min, however,
resulted in the nearly complete abolishment of translation, which
coincided with a 90% reduction in PABP levels. Thus, the rate of PABP
cleavage appeared to increase as well, requiring just over 20 min for
complete cleavage instead of the normal 45 to 60 min (data not shown).
Similar results were observed in extracts from
poliovirus-guanidine-infected cells, except that PABP degradation,
though substantial, lagged slightly in comparison. If the extent of
PABP cleavage is in some way linked to translation rates, less
degradation of PABP may reflect the lower overall translation rate
present in the poliovirus-guanidine-infected cells, which are partially
shut off. In addition, similarly decreased translation rates were
observed upon addition of 3Cpro, although the kinetics were
significantly delayed compared to those in experiments with
2Apro addition (data not shown). Overall, these data point
to a possible correlation between a loss of PABP in the translation
lysates due to proteolytic cleavage and the degree of translation
inhibition observed in vitro, though the exact role of PABP degradation
in this inhibition has not been defined.
 |
DISCUSSION |
This report describes the identification of another cellular
protein substrate, PABP, for poliovirus 2Apro and
3Cpro. Only one other cellular protein has been identified
which is a target for both viral proteases during infection, the
TATA-binding protein, TBP (66). TBP plays an integral role
in promoting transcription from RNA polymerase II and III promoters,
and its proteolysis plays a role in the transcriptional inhibition
observed during poliovirus infection (12, 66). Similarly,
PABP appears to play an integral role in another aspect of gene
expression, poly(A) tail-mediated translational stimulation. Since PABP
is cleaved in vitro by both poliovirus proteases and CVB3
2Apro (Fig. 4 to 7), it is likely that cleavage of PABP is
important for some aspect of translation shutoff, viral translation, or viral replication. Though it is unknown whether both cleavage sites are
utilized in infected cells, the fact that PABP can be targeted by both
proteases and cleaved in the same region of the molecule by both
implies a role for this cleavage during infection.
The data presented in Fig. 7 indicate that the cleavage of PABP by both
2Apro and 3Cpro occurs in the carboxyl-terminal
domain of the protein. Several investigators have analyzed various
structural domains of PABP from several species (10, 46,
54). These studies indicated that some RRM RNA-binding domains
probably have a unique RNA-binding activity, which may be modulated
when RRMs are analyzed singly versus in combinations. Human PABP
appears to have RNA-binding activity in all its RRM domains, but the
highest affinity for poly(A) resides in the first two domains together
(10). Further, in yeast, the RRM2 region is involved in
direct-binding interactions with eIF4G (33). Recent
preliminary evidence suggests that this region is also involved in
eIF4G binding in human cells (29). Thus, cleavage of PABP in
the C-terminal domain indicates that interactions of PABP with eIF4G
may not be grossly disrupted by 2Apro, since the large
cleavage products still maintain the intact eIF4G binding site. The
effect of cleavage on these protein interactions is currently being investigated.
Little information has been forthcoming about any specific function of
the carboxyl region of PABP. Early results with yeast suggested a role
in direct-binding interactions with the 60S ribosomal subunit
(53), and others have suggested a role in dimerization or
oligomerization of PABP (2, 35). Interestingly, the
RNA-binding analyses of X. laevis PABP indicated an
ancillary role for the carboxyl-terminal region in conferring
specificity of binding to poly(A) (46). A large segment of
the C-terminal domain 265 amino acids is proline rich,
suggesting a loose or extended conformation. This
265-amino-acid domain contains a highly conserved segment at each end,
separated by a poorly conserved region. In particular, the
C-terminal 100 amino acids of PABP are highly conserved in eukaryotes. In the center of the nonconserved region, however, is a
conserved polyalanine motif found in all eukaryotic PABPs. Interestingly, 2Apro cleaves adjacent to this motif (Fig.
7C), separating the polyalanine segment and the C-terminal conserved
domain from the rest of the protein. It is possible that this region is
involved in contacts with specific proteins, and these interactions are
disrupted by cleavage during poliovirus infection. One candidate for
this interaction is the recently described PAIP-1 (13). This
protein has been shown to interact with PABP and with eIF4A in vitro
and to enhance translation in vivo. The region responsible for this
interaction with PABP was mapped to the C-terminal region of PAIP-1,
but the corresponding domain on PABP which interacts with PAIP has not yet been reported. A recent study of chloroplasts derived from green
algae also demonstrated that processing of a chloroplast-derived PABP
modulated the function of the protein to allow it to stimulate translation of a specific subset of mRNAs (67). This
modified PABP binds with high specificity to the 5' UTRs of these mRNAs and activates translation of mRNAs containing this 5' UTR. Cleavage of
PABP during poliovirus infection could alter its RNA-binding specificity, thereby changing its function. Alternatively, cleavage of PABP may be important for another aspect of the viral life cycle,
such as RNA replication or packaging. Definitive evidence of a function
for PABP cleavage and/or cleavage products awaits further experimentation.
In this study, we have shown partial or complete cleavage of PABP
concurrent with further inhibition of translation in vitro after eIF4G
is cleaved (Fig. 8). Though the data presented in Fig. 8 do not show a
complete abolishment of endogenous translation in the mock-infected
extracts (Fig. 8A, lanes 1 to 3), there was an appreciable decrease in
the level of translation. Previous studies with in vitro translation
extracts and capped reporter constructs in the presence of purified
2Apros did not show a total inhibition of translation of
these mRNAs as well, though the cleavage of 4G was complete under these
conditions (37, 68). This lack of complete shutoff with
these assays may reflect a "loosening" of the stringency of
regulation concerning fidelity of translation in vitro. Such may be the
case with the data from mock-infected extracts, though assays with
poliovirus-guanidine-infected extracts did show essentially
complete shutoff (Fig. 8A, lanes 5 and 6). Recently, Gradi et al.
reported that the recently discovered eIF4GII (22) is
incompletely cleaved in poliovirus-guanidine-infected cells and that
the addition of 2Apro was able to hasten complete cleavage
(23). This provides yet another protein factor whose
cleavage by 2Apro may contribute to host translation
shutoff. Interestingly, in our system 3Cpro was also able
to affect translation, but it is not known if eIF4GII is cleaved by
3Cpro.
If PABP cleavage is indeed a player in the translational shutoff
mechanism, it may be that cleavage of only a certain subset or pool of
PABP may be necessary for this function, which would be reflected in
vivo by incomplete cleavage of total cellular PABP during infection
(Fig. 1). Certainly, PABP bound to messages in polyribosomes, or PABP
complexed with certain cellular proteins (i.e., eIF4G, PAIP-1, or
ribosomal proteins), could be envisioned to be a preferential target
for cleavage by poliovirus proteases. Preliminary experiments indicate
that cleavage of PABP by 2Apro may be less efficient when
PABP is bound to poly(A); in contrast, cleavage by 3Cpro
may be more efficient (data not shown), suggesting that mRNA binding
and/or protein interactions may have a significant impact on PABP
cleavage efficiency. Alternatively, incomplete cleavage of PABP may
simply be a reflection of its abundance in the cell, since it is
present at a high concentration of 4 µM, which gives a threefold
excess of PABP over poly(A)-binding sites in the cytoplasm (21).
How does cleavage of PABP relate to the shutoff of translation
during infection? Clearly, disruption of 5' cap-dependent interactions by cleavage of eIF4G is insufficient to account for the complete inhibition of cellular translation observed in active infections, since
infections in the presence of guanidine do not abolish translation of
endogenous mRNA (6, 8, 49). However, cleavage of PABP may
disrupt 3' poly(A) tail-dependent translational activity, thereby
allowing the complete translation shutoff to occur when the viral
infection is productive. This hypothesis fits well with the
closed-loop model (31), which proposes that
interactions between the 5' and 3' ends of mRNAs made through
protein-protein contacts can allow efficient initiation and also
reinitiation of ribosomes, circumventing the need for 5' cap-dependent
initiation for each round of translation. During poliovirus
infection, de novo 5' cap-dependent interactions are abolished
first through cleavage of eIF4G. It is not clear that eIF4G
cleavage will open loops, since the N-terminal fragment of eIF4G
released could still simultaneously bind PABP and eIF4E, thus linking
both ends of mRNA. Furthermore, 5'-3' interactions mediated by PAIP may
not be disrupted by eIF4G cleavage. Thus, continued translation after eIF4G cleavage may represent reinitiation events on closed loops which
still maintain 5'-end-3'-end contacts. Cleavage of PABP may disrupt
(i) these 5'-3' contacts, (ii) PABP cycling between various ligands or
complexes, or (iii) interactions of PABP with 60S ribosomal subunits in
a fashion which impairs ribosome rejoining during reinitiation.
Proteolysis of other proteins, such as eIF4GII, may also be involved in
mediating this inhibition, though the relative contributions of these
events may be difficult to separate from one another. In conclusion, we
have shown that PABP is proteolytically cleaved during poliovirus
infection, that it is a substrate for both poliovirus and CVB3
2Apros and poliovirus 3Cpro in vitro, and that
its degradation in translation assays was observed concurrently with an
inhibition of endogenous cellular mRNA translation. These results
indicate that PABP cleavage during poliovirus infection may contribute
to the observed shutoff of host cell translation.
 |
ACKNOWLEDGMENTS |
We thank Thomas Pfister and Eckard Wimmer (State University of
New York at Stony Brook) for the gift of the poliovirus His-tagged 3Cpro plasmid pET3Chc, Gideon Dreyfuss (Howard Hughes
Medical Institute) for the generous donation of monoclonal antibody
10E10 to PABP and the pET-PABP expression plasmid, and J. Bag
(University of Guelph, Ontario, Canada) for the glutathione
S-transferase-PABP expression plasmid.
This work was supported by NIH grant AI27914 to R.E.L.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, University of Oklahoma Health Sciences
Center, Oklahoma City, OK 73104. Phone: (405) 271-2889. Fax: (405)
271-5440. E-mail: richard-lloyd{at}ouhsc.edu.
Present address: Department of Molecular Cell Biology, University
of Utrecht, 3584 CH Utrecht, The Netherlands.
 |
REFERENCES |
| 1.
|
Adam, S. A.,
T. Nakagawa,
M. S. Swanson,
T. K. Woodruff, and G. Dreyfuss.
1986.
mRNA polyadenylate-binding protein: gene isolation and sequencing and identification of a ribonucleoprotein consensus sequence.
Mol. Cell. Biol.
6:2932-2943[Abstract/Free Full Text].
|
| 2.
|
Baer, B. W., and R. D. Kornberg.
1983.
The protein responsible for the repeating structure of cytoplasmic poly(A)-ribonucleoprotein.
J. Cell Biol.
96:717-721[Abstract/Free Full Text].
|
| 3.
|
Bag, J., and J. Wu.
1996.
Translational control of poly(A)-binding protein expression.
Eur. J. Biochem.
237:143-152[Medline].
|
| 4.
|
Bernstein, H. D.,
N. Sonenberg, and D. Baltimore.
1985.
Poliovirus mutant that does not selectively inhibit host cell protein synthesis.
Mol. Cell. Biol.
5:2913-2923[Abstract/Free Full Text].
|
| 5.
|
Black, T. L.,
G. N. Barber, and M. G. Katze.
1993.
Degradation of the interferon-induced 68,000-Mr protein kinase by poliovirus requires RNA.
J. Virol.
67:791-800[Abstract/Free Full Text].
|
| 6.
|
Bonneau, A.-M., and N. Sonenberg.
1987.
Proteolysis of the p220 component of the cap-binding protein complex is not sufficient for complete inhibition of host cell protein synthesis after poliovirus infection.
J. Virol.
61:986-991[Abstract/Free Full Text].
|
| 7.
|
Bovee, M. L.,
B. Lamphear,
R. E. Rhoads, and R. E. Lloyd.
1998.
Direct cleavage of eIF4G by poliovirus 2A protease is inefficient in vitro.
Virology
245:241-249[Medline].
|
| 8.
|
Bovee, M. L.,
W. E. Marissen,
M. Zamora, and R. E. Lloyd.
1998.
The predominant eIF4G-specific cleavage activity in poliovirus-infected HeLa cells is distinct from 2A protease.
Virology
245:229-240[Medline].
|
| 9.
|
Brown, B. A., and E. Ehrenfeld.
1979.
Translation of poliovirus RNA in vitro: changes in cleavage pattern and initiation sites by ribosomal salt wash.
Virology
97:396-405[Medline].
|
| 10.
|
Burd, C. G.,
E. L. Matunis, and G. Dreyfuss.
1991.
The multiple RNA-binding domains of the mRNA poly(A)-binding protein have different RNA-binding activities.
Mol. Cell. Biol.
11:3419-3424[Abstract/Free Full Text].
|
| 11.
|
Chapman, N. M.,
Z. Tu,
S. Tracy, and C. J. Gauntt.
1994.
An infectious cDNA copy of the genome of a non-cardiovirulent coxsackievirus B3 strain its complete sequence analysis and comparison to the genomes of cardiovirulent coxsackieviruses.
Arch. Virol.
135:115-130[Medline].
|
| 12.
|
Clark, M. E.,
P. M. Lieberman,
A. J. Berk, and A. Dasgupta.
1993.
Direct cleavage of human TATA-binding protein by poliovirus protease 3C in vivo and in vitro.
Mol. Cell. Biol.
13:1232-1237[Abstract/Free Full Text].
|
| 13.
|
Craig, A. W. B.,
A. Haghighat,
A. T. K. Yu, and N. Sonenberg.
1998.
Interaction of polyadenylate-binding protein with the eIF4G homologue PAIP enhances translation.
Nature
392:520-523[Medline].
|
| 14.
|
Curtis, D.,
R. Lehmann, and P. Zamore.
1995.
Translational regulation in development.
Cell
81:171-178[Medline].
|
| 15.
|
Davies, M. V.,
J. Pelletier,
K. Meerovitch,
N. Sonenberg, and R. J. Kaufman.
1991.
The effect of poliovirus proteinase 2Apro expression on cellular metabolism.
J. Biol. Chem.
266:14714-14720[Abstract/Free Full Text].
|
| 16.
|
Duncan, R.,
D. Etchison, and J. W. B. Hershey.
1983.
Protein synthesis eukaryotic initiation factors 4A and 4B are not altered by poliovirus infection of HeLa cells.
J. Biol. Chem.
258:7236-7239[Abstract/Free Full Text].
|
| 17.
|
Ehrenfeld, E.
1996.
Initiation of translation by picornavirus RNAs, p. 549-573.
In
J. W. B. Hershey, M. B. Matthews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 18.
|
Etchison, D.,
J. Hansen,
E. Ehrenfeld,
I. Edery,
N. Sonenberg,
S. Milburn, and J. W. B. Hershey.
1984.
Demonstration in vitro that eucaryotic initiation factor 3 is active but a cap-binding protein complex is inactive in poliovirus-infected HeLa cells.
J. Virol.
51:832-837[Abstract/Free Full Text].
|
| 19.
|
Etchison, D.,
S. C. Milburn,
I. Edery,
N. Sonenberg, and J. W. B. Hershey.
1982.
Inhibition of HeLa cell protein synthesis following poliovirus infection correlates with the proteolysis of a 220,000-dalton polypeptide associated with eukaryotic initiation factor 3 and a cap binding protein complex.
J. Biol. Chem.
257:14806-14810[Abstract/Free Full Text].
|
| 20.
|
Gallie, D. R.
1991.
The cap and poly(A) tail function synergistically to regulate messenger RNA translational efficiency.
Genes Dev.
5:2108-2116[Abstract/Free Full Text].
|
| 21.
|
Gorlach, M.,
C. G. Burd, and G. Dreyfuss.
1994.
The mRNA poly(A)-binding protein: localization, abundance, and RNA-binding specificity.
Exp. Cell Res.
211:400-407[Medline].
|
| 22.
|
Gradi, A.,
H. Imataka,
Y. V. Svitkin,
E. Rom,
B. Raught,
S. Morino, and N. Sonenberg.
1998.
A novel functional human eukaryotic translation initiation factor 4G.
Mol. Cell. Biol.
18:334-342[Abstract/Free Full Text].
|
| 23.
|
Gradi, A.,
Y. V. Svitkin,
H. Imataka, and N. Sonenberg.
1998.
Proteolysis of human eIF4GII, but not eIF4GI, coincides with the shutoff of host protein synthesis after poliovirus infection.
Proc. Natl. Acad. Sci. USA
95:11089-11094[Abstract/Free Full Text].
|
| 24.
|
Grange, T.,
C. Martins de Sa,
J. J. Oddos, and R. Pictet.
1987.
Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.
Nucleic Acids Res.
15:4771-4787[Abstract/Free Full Text].
|
| 25.
|
Haller, A. A., and B. L. Semler.
1995.
Translation and host cell shutoff, p. 113-134.
In
H. Rotbart (ed.), Human enterovirus infections. American Society for Microbiology, Washington, D.C.
|
| 26.
|
Hambidge, S. J., and P. Sarnow.
1992.
Translational enhancement of the poliovirus 5' noncoding region mediated by virus-encoded polypeptide-2A.
Proc. Natl. Acad. Sci. USA
89:10272-10276[Abstract/Free Full Text].
|
| 27.
|
Hellen, C. U. T.,
C.-K. Lee, and E. Wimmer.
1992.
Determinants of substrate recognition by poliovirus 2A proteinase.
J. Virol.
66:3330-3338[Abstract/Free Full Text].
|
| 28.
|
Iizuka, N.,
L. Najita,
A. Franzusoff, and P. Sarnow.
1994.
Cap-dependent and cap-independent translation by internal initiation of mRNAs in cell extracts prepared from Saccharomyces cerevisiae.
Mol. Cell. Biol.
14:7322-7330[Abstract/Free Full Text].
|
| 29.
|
Imataka, H.,
A. Gradi, and N. Sonenberg.
1998.
A newly identified N-terminal amino acid stretch of human eIF4G binds poly(A) binding protein and functions in poly(A) dependent translation, p. 147.
In
Abstracts from the 1998 Conference on Translational Control. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 30.
|
Irurzun, A.,
S. Sánchez-Palomino,
I. Novoa, and L. Carrasco.
1995.
Monensin and nigericin prevent the inhibition of host translation by poliovirus, without affecting p220 cleavage.
J. Virol.
69:7453-7460[Abstract].
|
| 31.
|
Jacobson, A.
1996.
Poly(A) metabolism and translation: the closed-loop model, p. 451-479.
In
J. W. B. Hershey, M. B. Matthews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 32.
|
Joachims, M.,
K. S. Harris, and D. Etchison.
1995.
Poliovirus protease 3C mediates cleavage of microtubule-associated protein 4.
Virology
211:451-461[Medline].
|
| 33.
|
Kessler, S. H., and A. B. Sachs.
1998.
RNA recognition motif 2 of yeast Pab1p is required for its functional interaction with eukaryotic translation initiation factor 4G.
Mol. Cell. Biol.
18:51-57[Abstract/Free Full Text].
|
| 34.
|
Kräusslich, H. G.,
M. J. H. Nicklin,
H. Toyoda,
D. Etchison, and E. Wimmer.
1987.
Poliovirus proteinase 2A induces cleavage of eukaryotic initiation factor 4F polypeptide p220.
J. Virol.
61:2711-2718[Abstract/Free Full Text].
|
| 35.
|
Kuhn, U., and T. Pieler.
1996.
Xenopus poly(A)-binding protein: functional domains in RNA binding and protein-protein interaction.
J. Mol. Biol.
256:20-30[Medline].
|
| 36.
|
Le, H.,
R. L. Tanguay,
M. L. Balasta,
C.-C. Wei,
K. S. Browning,
A. M. Metz,
D. J. Goss, and D. R. Gallie.
1997.
Translation initiation factors eIF-iso4G and eIF-4B interact with the poly(A)-binding protein and increase its RNA binding activity.
J. Biol. Chem.
272:16247-16255[Abstract/Free Full Text].
|
| 37.
|
Liebig, H. D.,
E. Ziegler,
R. Yan,
K. Hartmuth,
H. Klump,
H. Kowalski,
D. Blaas,
W. Sommergruber,
L. Frasel,
B. Lamphear,
R. Rhoads,
E. Kuechler, and T. Skern.
1993.
Purification of two picornaviral 2A proteinases interaction with eIF-4 and influence on in vitro translation.
Biochemistry
32:7581-7588[Medline].
|
| 38.
|
Lloyd, R. E., and M. Bovee.
1993.
Persistent infection of human erythroblastoid cells by poliovirus.
Virology
194:200-209[Medline].
|
| 39.
|
Lloyd, R. E.,
D. Etchison, and E. Ehrenfeld.
1985.
Poliovirus protease does not mediate cleavage of the 220,000-Da component of the cap binding protein complex.
Proc. Natl. Acad. Sci. USA
82:2723-2727[Abstract/Free Full Text].
|
| 40.
|
Lloyd, R. E.,
M. J. Grubman, and E. Ehrenfeld.
1988.
Relationship of p220 cleavage during picornavirus infection to 2A proteinase sequences.
J. Virol.
62:4216-4223[Abstract/Free Full Text].
|
| 41.
|
Macadam, A. J.,
G. Ferguson,
T. Fleming,
D. M. Stone,
J. W. Almond, and P. D. Minor.
1994.
Role for poliovirus protease 2A in cap independent translation.
EMBO J.
13:924-927[Medline].
|
| 42.
|
Merrick, W. C., and J. W. B. Hershey.
1996.
The pathway and mechanism of eukaryotic protein synthesis, p. 31-69.
In
J. W. B. Hershey, M. B. Matthews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 43.
|
Morley, S. J.,
P. S. Curtis, and V. M. Pain.
1997.
eIF4G translation's mystery factor begins to yield its secrets.
RNA
3:1085-1104[Medline]. (Review.)
|
| 44.
|
Munroe, D., and A. Jacobson.
1990.
Messenger RNA poly(A) tail, a 3' enhancer of translational initiation.
Mol. Cell. Biol.
10:3441-3455[Abstract/Free Full Text].
|
| 45.
|
Nagai, K.,
C. Oubridge,
N. Ito, and P. Evans.
1995.
The RNP domain: a sequence-specific RNA-binding domain involved in processing and transport of RNA.
Trends Biochem. Sci.
20:235-240[Medline].
|
| 46.
|
Nietfeld, W.,
H. Mentzel, and T. Pieler.
1990.
The Xenopus laevis poly(A) binding protein is composed of multiple functionally independent RNA binding domains.
EMBO J.
9:3699-3705[Medline].
|
| 47.
|
O'Neill, R. E., and V. R. Racaniello.
1989.
Inhibition of translation in cells infected with a poliovirus 2Apro mutant correlates with phosphorylation of the alpha subunit of eucaryotic initiation factor 2.
J. Virol.
63:5069-5075[Abstract/Free Full Text].
|
| 48.
|
Percy, N.,
G. J. Belsham,
J. K. Brangwyn,
M. Sullivan,
D. M. Stone, and J. W. Almond.
1992.
Intracellular modifications induced by poliovirus reduce the requirement for structural motifs in the 5' noncoding region of the genome involved in internal initiation of protein synthesis.
J. Virol.
66:1695-1701[Abstract/Free Full Text].
|
| 49.
|
Pérez, L., and L. Carrasco.
1992.
Lack of direct correlation between p220 cleavage and the shut-off of host translation after poliovirus infection.
Virology
189:178-186[Medline].
|
| 50.
|
Preiss, T., and M. W. Hentze.
1998.
Dual function of the messenger RNA cap structure in poly(a)-tail-promoted translation in yeast.
Nature
392:516-520[Medline].
|
| 51.
|
Richter, J. D.
1996.
Dynamics of poly(A) addition and removal during development, p. 481-503.
In
J. W. B. Hershey, M. B. Matthews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 52.
|
Sachs, A.,
M. W. Bond, and R. D. Kornberg.
1986.
A single gene from yeast for both nuclear and cytoplasmic polyadenylate-binding proteins: domain structure and expression.
Cell
45:827-835[Medline].
|
| 53.
|
Sachs, A. B., and R. W. Davis.
1989.
The poly(A)-binding protein is required for poly(A) shortening and 60S ribosomal subunit dependent translation initiation.
Cell
58:857-867[Medline].
|
| 54.
|
Sachs, A. B.,
R. W. Davis, and R. D. Kornberg.
1987.
A single domain of yeast poly(A)-binding protein is necessary and sufficient for RNA binding and cell viability.
Mol. Cell. Biol.
7:3268-3276[Abstract/Free Full Text].
|
| 55.
|
Sachs, A. B.,
P. Sarnow, and A. W. Hentze.
1997.
Starting at the beginning, middle, and end: translation initiation in eukaryotes.
Cell
89:831-838[Medline].
|
| 56.
|
Shatkin, A. J.
1985.
mRNA cap binding proteins: essential factors for initiating translation.
Cell
40:223-224[Medline].
|
| 57.
|
Sommergruber, W.,
H. Ahorn,
A. Zophel,
I. Maurerfogy,
F. Fessl,
G. Schnorrenberg,
H. D. Liebig,
D. Blaas,
E. Kuechler, and T. Skern.
1992.
Cleavage specificity on synthetic peptide substrates of human rhinovirus-2 proteinase-2A.
J. Biol. Chem.
267:22639-22644[Abstract/Free Full Text].
|
| 58.
|
Sun, X.-H., and D. Baltimore.
1989.
Human immunodeficiency virus tat-activated expression of poliovirus protein 2A inhibits mRNA translation.
Proc. Natl. Acad. Sci. USA
86:2143-2146[Abstract/Free Full Text].
|
| 59.
|
Tarun, S. Z., and A. B. Sachs.
1996.
Association of the yeast poly(A) tail binding protein with translation initiation factor eIF-4G.
EMBO J.
15:7168-7177[Medline].
|
| 60.
|
Tarun, S. Z., Jr.,
S. E. Wells,
J. A. Deardorff, and A. B. Sachs.
1997.
Translation initiation factor eIF4G mediates in vitro poly(A) tail-dependent translation.
Proc. Natl. Acad. Sci. USA
94:9046-9051[Abstract/Free Full Text].
|
| 61.
|
Trachsel, H.
1996.
Binding of initiator methionyl-tRNA to ribosomes, p. 113-137.
In
J. W. B. Hershey, M. B. Matthews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 62.
|
Wells, S. E.,
P. E. Hillner,
R. D. Vale, and A. B. Sachs.
1998.
Circularization of mRNA by eukaryotic translation initiation factors.
Mol. Cell
2:135-140[Medline].
|
| 63.
|
Wickens, M.,
P. Anderson, and R. J. Jackson.
1997.
Life and death in the cytoplasm: messages from the 3' end.
Curr. Opin. Genet. Dev.
7:220-232[Medline].
|
| 64.
|
Wyckoff, E. E.,
R. E. Lloyd, and E. Ehrenfeld.
1992.
Relationship of eukaryotic initiation factor 3 to poliovirus-induced p220 cleavage activity.
J. Virol.
66:2943-2951[Abstract/Free Full Text].
|
| 65.
|
Wyckoff, E. E.,
J. W. B. Hershey, and E. Ehrenfeld.
1990.
Eukaryotic initiation factor-3 is required for poliovirus-2A protease-induced cleavage of the p220 component of eukaryotic initiation factor-4F.
Proc. Natl. Acad. Sci. USA
87:9529-9533[Abstract/Free Full Text].
|
| 66.
|
Yalamanchili, P.,
U. Datta, and A. Dasgupta.
1997.
Inhibition of host cell transcription by poliovirus: cleavage of transcription factor CREB by poliovirus-encoded protease 3C(Pro).
J. Virol.
71:1220-1226[Abstract].
|
| 67.
|
Yohn, C. B.,
A. Cohen,
A. Danon, and S. P. Mayfield.
1998.
A poly(A)-binding protein functions in the chloroplast as a message-specific translation factor.
Proc. Natl. Acad. Sci. USA
95:2238-2243[Abstract/Free Full Text].
|
| 68.
|
Ziegler, E.,
A. M. Borman,
F. G. Deliat,
H. D. Liebig,
D. Jugovic,
K. M. Kean,
T. Skern, and E. Kuechler.
1995.
Picornavirus 2A proteinase-mediated stimulation of internal initiation of translation is dependent on enzymatic activity and the cleavage products of cellular proteins.
Virology
213:549-557[Medline].
|
Journal of Virology, January 1999, p. 718-727, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Johnson, R. M., Evans, J. D., Robinson, G. E., Berenbaum, M. R.
(2009). Changes in transcript abundance relating to colony collapse disorder in honey bees (Apis mellifera). Proc. Natl. Acad. Sci. USA
106: 14790-14795
[Abstract]
[Full Text]
-
Kim, K. M., Cho, H., Choi, K., Kim, J., Kim, B.-W., Ko, Y.-G., Jang, S. K., Kim, Y. K.
(2009). A new MIF4G domain-containing protein, CTIF, directs nuclear cap-binding protein CBP80/20-dependent translation. Genes Dev.
23: 2033-2045
[Abstract]
[Full Text]
-
Gouw, J. W., Pinkse, M. W. H., Vos, H. R., Moshkin, Y., Verrijzer, C. P., Heck, A. J. R., Krijgsveld, J.
(2009). In Vivo Stable Isotope Labeling of Fruit Flies Reveals Post-transcriptional Regulation in the Maternal-to-zygotic Transition. Mol. Cell. Proteomics
8: 1566-1578
[Abstract]
[Full Text]
-
Morrison, J. M., Racaniello, V. R.
(2009). Proteinase 2Apro Is Essential for Enterovirus Replication in Type I Interferon-Treated Cells. J. Virol.
83: 4412-4422
[Abstract]
[Full Text]
-
Lin, J.-Y., Li, M.-L., Shih, S.-R.
(2009). Far upstream element binding protein 2 interacts with enterovirus 71 internal ribosomal entry site and negatively regulates viral translation. Nucleic Acids Res
37: 47-59
[Abstract]
[Full Text]
-
Bonderoff, J. M., LaRey, J. L., Lloyd, R. E.
(2008). Cleavage of Poly(A)-Binding Protein by Poliovirus 3C Proteinase Inhibits Viral Internal Ribosome Entry Site-Mediated Translation. J. Virol.
82: 9389-9399
[Abstract]
[Full Text]
-
Dufresne, P. J., Ubalijoro, E., Fortin, M. G., Laliberte, J.-F.
(2008). Arabidopsis thaliana class II poly(A)-binding proteins are required for efficient multiplication of turnip mosaic virus. J. Gen. Virol.
89: 2339-2348
[Abstract]
[Full Text]
-
Kempf, B. J., Barton, D. J.
(2008). Poliovirus 2APro Increases Viral mRNA and Polysome Stability Coordinately in Time with Cleavage of eIF4G. J. Virol.
82: 5847-5859
[Abstract]
[Full Text]
-
Ilkow, C. S., Mancinelli, V., Beatch, M. D., Hobman, T. C.
(2008). Rubella Virus Capsid Protein Interacts with Poly(A)-Binding Protein and Inhibits Translation. J. Virol.
82: 4284-4294
[Abstract]
[Full Text]
-
Randall, R. E., Goodbourn, S.
(2008). Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J. Gen. Virol.
89: 1-47
[Abstract]
[Full Text]
-
Sato, H., Masuda, M., Kanai, M., Tsukiyama-Kohara, K., Yoneda, M., Kai, C.
(2007). Measles Virus N Protein Inhibits Host Translation by Binding to eIF3-p40. J. Virol.
81: 11569-11576
[Abstract]
[Full Text]
-
Zhang, B., Morace, G., Gauss-Muller, V., Kusov, Y.
(2007). Poly(A) binding protein, C-terminally truncated by the hepatitis A virus proteinase 3C, inhibits viral translation. Nucleic Acids Res
35: 5975-5984
[Abstract]
[Full Text]
-
Perera, R., Daijogo, S., Walter, B. L., Nguyen, J. H. C., Semler, B. L.
(2007). Cellular Protein Modification by Poliovirus: the Two Faces of Poly(rC)-Binding Protein. J. Virol.
81: 8919-8932
[Abstract]
[Full Text]
-
Barral, P. M., Morrison, J. M., Drahos, J., Gupta, P., Sarkar, D., Fisher, P. B., Racaniello, V. R.
(2007). MDA-5 Is Cleaved in Poliovirus-Infected Cells. J. Virol.
81: 3677-3684
[Abstract]
[Full Text]
-
Campbell, S. A., Mulvey, M., Mohr, I., Gromeier, M.
(2007). Attenuation of Herpes Simplex Virus Neurovirulence with Picornavirus cis-Acting Genetic Elements. J. Virol.
81: 791-799
[Abstract]
[Full Text]
-
Castello, A., Alvarez, E., Carrasco, L.
(2006). Differential Cleavage of eIF4GI and eIF4GII in Mammalian Cells: EFFECTS ON TRANSLATION. J. Biol. Chem.
281: 33206-33216
[Abstract]
[Full Text]
-
Deszcz, L., Cencic, R., Sousa, C., Kuechler, E., Skern, T.
(2006). An Antiviral Peptide Inhibitor That Is Active against Picornavirus 2A Proteinases but Not Cellular Caspases. J. Virol.
80: 9619-9627
[Abstract]
[Full Text]
-
Lerner, R. S., Nicchitta, C. V.
(2006). mRNA translation is compartmentalized to the endoplasmic reticulum following physiological inhibition of cap-dependent translation. RNA
12: 775-789
[Abstract]
[Full Text]
-
Merrill, M. K., Dobrikova, E. Y., Gromeier, M.
(2006). Cell-Type-Specific Repression of Internal Ribosome Entry Site Activity by Double-Stranded RNA-Binding Protein 76.. J. Virol.
80: 3147-3156
[Abstract]
[Full Text]
-
Dobrikova, E. Y., Grisham, R. N., Kaiser, C., Lin, J., Gromeier, M.
(2006). Competitive Translation Efficiency at the Picornavirus Type 1 Internal Ribosome Entry Site Facilitated by Viral cis and trans Factors.. J. Virol.
80: 3310-3321
[Abstract]
[Full Text]
-
Byrd, M. P., Zamora, M., Lloyd, R. E.
(2005). Translation of Eukaryotic Translation Initiation Factor 4GI (eIF4GI) Proceeds from Multiple mRNAs Containing a Novel Cap-dependent Internal Ribosome Entry Site (IRES) That Is Active during Poliovirus Infection. J. Biol. Chem.
280: 18610-18622
[Abstract]
[Full Text]
-
Samuilova, O., Krogerus, C., Poyry, T., Hyypia, T.
(2004). Specific Interaction between Human Parechovirus Nonstructural 2A Protein and Viral RNA. J. Biol. Chem.
279: 37822-37831
[Abstract]
[Full Text]
-
Kuyumcu-Martinez, M., Belliot, G., Sosnovtsev, S. V., Chang, K.-O., Green, K. Y., Lloyd, R. E.
(2004). Calicivirus 3C-Like Proteinase Inhibits Cellular Translation by Cleavage of Poly(A)-Binding Protein. J. Virol.
78: 8172-8182
[Abstract]
[Full Text]
-
Graham, K. L., Gustin, K. E., Rivera, C., Kuyumcu-Martinez, N. M., Choe, S. S., Lloyd, R. E., Sarnow, P., Utz, P. J.
(2004). Proteolytic Cleavage of the Catalytic Subunit of DNA-Dependent Protein Kinase during Poliovirus Infection. J. Virol.
78: 6313-6321
[Abstract]
[Full Text]
-
Chong, J.-L., Chuang, R.-Y., Tung, L., Chang, T.-H.
(2004). Ded1p, a conserved DExD/H-box translation factor, can promote yeast L-A virus negative-strand RNA synthesis in vitro. Nucleic Acids Res
32: 2031-2038
[Abstract]
[Full Text]
-
Kuyumcu-Martinez, N. M., Van Eden, M. E., Younan, P., Lloyd, R. E.
(2004). Cleavage of Poly(A)-Binding Protein by Poliovirus 3C Protease Inhibits Host Cell Translation: a Novel Mechanism for Host Translation Shutoff. Mol. Cell. Biol.
24: 1779-1790
[Abstract]
[Full Text]
-
Dobrikova, E., Florez, P., Bradrick, S., Gromeier, M.
(2003). Activity of a type 1 picornavirus internal ribosomal entry site is determined by sequences within the 3' nontranslated region. Proc. Natl. Acad. Sci. USA
100: 15125-15130
[Abstract]
[Full Text]
-
Burgui, I., Aragon, T., Ortin, J., Nieto, A.
(2003). PABP1 and eIF4GI associate with influenza virus NS1 protein in viral mRNA translation initiation complexes. J. Gen. Virol.
84: 3263-3274
[Abstract]
[Full Text]
-
Zhao, X., Lamphear, B. J., Xiong, D., Knowlton, K., Rhoads, R. E.
(2003). Protection of Cap-dependent Protein Synthesis in Vivo and in Vitro with an eIF4G-1 Variant Highly Resistant to Cleavage by Coxsackievirus 2A Protease. J. Biol. Chem.
278: 4449-4457
[Abstract]
[Full Text]
-
Bushell, M., Sarnow, P.
(2002). Hijacking the translation apparatus by RNA viruses. JCB
158: 395-399
[Abstract]
[Full Text]
-
Byrd, M. P., Zamora, M., Lloyd, R. E.
(2002). Generation of Multiple Isoforms of Eukaryotic Translation Initiation Factor 4GI by Use of Alternate Translation Initiation Codons. Mol. Cell. Biol.
22: 4499-4511
[Abstract]
[Full Text]
-
Zhang, H. M., Yanagawa, B., Cheung, P., Luo, H., Yuan, J., Chau, D., Wang, A., Bohunek, L., Wilson, J. E., McManus, B. M., Yang, D.
(2002). Nip21 Gene Expression Reduces Coxsackievirus B3 Replication by Promoting Apoptotic Cell Death via a Mitochondria-Dependent Pathway. Circ. Res.
90: 1251-1258
[Abstract]
[Full Text]
-
Bradley, C. A., Padovan, J. C., Thompson, T. L., Benoit, C. A., Chait, B. T., Rhoads, R. E.
(2002). Mass Spectrometric Analysis of the N Terminus of Translational Initiation Factor eIF4G-1 Reveals Novel Isoforms. J. Biol. Chem.
277: 12559-12571
[Abstract]
[Full Text]
-
Kuyumcu-Martinez, N. M., Joachims, M., Lloyd, R. E.
(2002). Efficient Cleavage of Ribosome-Associated Poly(A)-Binding Protein by Enterovirus 3C Protease. J. Virol.
76: 2062-2074
[Abstract]
[Full Text]
-
Back, S. H., Kim, Y. K., Kim, W. J., Cho, S., Oh, H. R., Kim, J.-E., Jang, S. K.
(2002). Translation of Polioviral mRNA Is Inhibited by Cleavage of Polypyrimidine Tract-Binding Proteins Executed by Polioviral 3Cpro. J. Virol.
76: 2529-2542
[Abstract]
[Full Text]
-
Zamora, M., Marissen, W. E., Lloyd, R. E.
(2002). Multiple eIF4GI-Specific Protease Activities Present in Uninfected and Poliovirus-Infected Cells. J. Virol.
76: 165-177
[Abstract]
[Full Text]
-
Bag, J.
(2001). Feedback Inhibition of Poly(A)-binding Protein mRNA Translation. A POSSIBLE MECHANISM OF TRANSLATION ARREST BY STALLED 40 S RIBOSOMAL SUBUNITS. J. Biol. Chem.
276: 47352-47360
[Abstract]
[Full Text]
-
Lyons, T., Murray, K. E., Roberts, A. W., Barton, D. J.
(2001). Poliovirus 5'-Terminal Cloverleaf RNA Is Required in cis for VPg Uridylylation and the Initiation of Negative-Strand RNA Synthesis. J. Virol.
75: 10696-10708
[Abstract]
[Full Text]
-
Borman, A. M., Michel, Y. M., Kean, K. M.
(2001). Detailed Analysis of the Requirements of Hepatitis A Virus Internal Ribosome Entry Segment for the Eukaryotic Initiation Factor Complex eIF4F. J. Virol.
75: 7864-7871
[Abstract]
[Full Text]
-
Michel, Y. M., Borman, A. M., Paulous, S., Kean, K. M.
(2001). Eukaryotic Initiation Factor 4G-Poly(A) Binding Protein Interaction Is Required for Poly(A) Tail-Mediated Stimulation of Picornavirus Internal Ribosome Entry Segment-Driven Translation but Not for X-Mediated Stimulation of Hepatitis C Virus Translation. Mol. Cell. Biol.
21: 4097-4109
[Abstract]
[Full Text]
-
Martínez-Salas, E., Ramos, R., Lafuente, E., López de Quinto, S.
(2001). Functional interactions in internal translation initiation directed by viral and cellular IRES elements. J. Gen. Virol.
82: 973-984
[Full Text]
-
Feral, C., Guellaen, G., Pawlak, A.
(2001). Human testis expresses a specific poly(A)-binding protein. Nucleic Acids Res
29: 1872-1883
[Abstract]
[Full Text]
-
Kozlov, G., Trempe, J.-F., Khaleghpour, K., Kahvejian, A., Ekiel, I., Gehring, K.
(2001). Structure and function of the C-terminal PABC domain of human poly(A)-binding protein. Proc. Natl. Acad. Sci. USA
10.1073/pnas.071024998v1
[Abstract]
[Full Text]
-
Deo, R. C., Sonenberg, N., Burley, S. K.
(2001). X-ray structure of the human hyperplastic discs protein: An ortholog of the C-terminal domain of poly(A)-binding protein. Proc. Natl. Acad. Sci. USA
10.1073/pnas.071552198v1
[Abstract]
[Full Text]
-
Li, X., Lu, H.-H., Mueller, S., Wimmer, E.
(2001). The C-terminal residues of poliovirus proteinase 2Apro are critical for viral RNA replication but not for cis- or trans-proteolytic cleavage. J. Gen. Virol.
82: 397-408
[Abstract]
[Full Text]
-
Buck, C. B., Shen, X., Egan, M. A., Pierson, T. C., Walker, C. M., Siliciano, R. F.
(2001). The Human Immunodeficiency Virus Type 1 gag Gene Encodes an Internal Ribosome Entry Site. J. Virol.
75: 181-191
[Abstract]
[Full Text]
-
Lyles, D. S.
(2000). Cytopathogenesis and Inhibition of Host Gene Expression by RNA Viruses. Microbiol. Mol. Biol. Rev.
64: 709-724
[Abstract]
[Full Text]
-
Seipelt, J., Liebig, H.-D., Sommergruber, W., Gerner, C., Kuechler, E.
(2000). 2A Proteinase of Human Rhinovirus Cleaves Cytokeratin 8 in Infected HeLa Cells. J. Biol. Chem.
275: 20084-20089
[Abstract]
[Full Text]
-
Gale, M. Jr., Tan, S.-L., Katze, M. G.
(2000). Translational Control of Viral Gene Expression in Eukaryotes. Microbiol. Mol. Biol. Rev.
64: 239-280
[Abstract]
[Full Text]
-
Goldstaub, D., Gradi, A., Bercovitch, Z., Grosmann, Z., Nophar, Y., Luria, S., Sonenberg, N., Kahana, C.
(2000). Poliovirus 2A Protease Induces Apoptotic Cell Death. Mol. Cell. Biol.
20: 1271-1277
[Abstract]
[Full Text]
-
Belsham, G. J., McInerney, G. M., Ross-Smith, N.
(2000). Foot-and-Mouth Disease Virus 3C Protease Induces Cleavage of Translation Initiation Factors eIF4A and eIF4G within Infected Cells. J. Virol.
74: 272-280
[Abstract]
[Full Text]
-
Elgadi, M. M., Smiley, J. R.
(1999). Picornavirus Internal Ribosome Entry Site Elements Target RNA Cleavage Events Induced by the Herpes Simplex Virus Virion Host Shutoff Protein. J. Virol.
73: 9222-9231
[Abstract]
[Full Text]
-
Bushell, M., Wood, W., Carpenter, G., Pain, V. M., Morley, S. J., Clemens, M. J.
(2001). Disruption of the Interaction of Mammalian Protein Synthesis Eukaryotic Initiation Factor 4B with the Poly(A)-binding Protein by Caspase- and Viral Protease-mediated Cleavages. J. Biol. Chem.
276: 23922-23928
[Abstract]
[Full Text]
-
Kozlov, G., Trempe, J.-F., Khaleghpour, K., Kahvejian, A., Ekiel, I., Gehring, K.
(2001). From the Cover: Structure and function of the C-terminal PABC domain of human poly(A)-binding protein. Proc. Natl. Acad. Sci. USA
98: 4409-4413
[Abstract]
[Full Text]
-
Deo, R. C., Sonenberg, N., Burley, S. K.
(2001). From the Cover: X-ray structure of the human hyperplastic discs protein: An ortholog of the C-terminal domain of poly(A)-binding protein. Proc. Natl. Acad. Sci. USA
98: 4414-4419
[Abstract]
[Full Text]