INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Measles virus (MV) is a negative-strand RNA virus. The clinical symptoms caused by MV infection appear between 2 and 3 weeks after infection. The appearance of the rash is a sign of the peaking immune response and is associated with clearance of the virus (17). Although now well controlled by vaccination programs in developed countries, measles is still a major problem in sub-Saharan Africa (14, 15). Children below the age of 1 year are particularly at risk and are hard to protect with the current vaccine (30). In young children, MV causes around one million deaths per annum and there is also a large morbidity. Secondary infection by other agents is common (2, 20), while malnutrition may increase the risk of this complication (1, 32). Such secondary infections are believed to largely result from immunosuppression by MV infection which can persist for several weeks (33). The effect was first described as a delayed type hypersensitivity defect in MV-infected patients (37). Proliferation of lymphocytes in response to mitogen in vitro is also reduced after MV infection (16, 33, 39, 42).

While the humoral immune response is important in protecting against reinfection, the cellular response, especially the CD8⁺ T-cell response, is important in the clearance of established MV infection (3, 18, 36). Some primary infections with persistent viruses, such as human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), and Epstein-Barr virus (EBV), stimulate a very strong CD8⁺ T-cell response, with development of large clonal and oligoclonal expansions of these cells (5, 7, 25, 40). Such expansions may comprise up to 40% of CD8⁺ T cells and thus cause distortions of the T-cell receptor (TCR) repertoire. Clonally expanded populations can persist for many months after primary infection with these persistent viruses. While indirect evidence suggests that these T-cell expansions are antigen driven, little is known about their functional capacity, such as cytolysis.

In this study, we wished to determine whether similar distortions in the T-cell repertoire occur in MV infection. We therefore studied the TCR repertoire in peripheral blood lymphocytes of children with acute MV infection and of healthy Gambian infants given the standard live, attenuated MV vaccine. We found marked distortions of the T-cell repertoires in the majority of infected patients and in two of the four vaccinees. These expanded T lymphocytes have cytotoxic activity and are likely therefore to play a major role in the clearance of infected cells.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Patients and controls. Nineteen patients with acute MV infection from The Gambia were studied. The patients were aged from 6 months to 9 years, with a mean of 2.8 years. Categorization of disease severity was based on previously described criteria (21). Five showed severe and 10 showed moderate symptoms; the rest had mild disease. The study also included four children who were vaccinated with the attenuated Edmonston strain of MV at the age of 9 months. Patients were bled within a week of the onset of rash, and vaccinees were sampled 2 to 4 weeks after vaccination. Ten Gambian children, with a mean age of 8.1 years, recovering from malaria infection at least 4 months, were included as controls. Approval for this study was given by the Gambian Government/MRC Ethics Committee.

Isolation and fractionation of lymphocyte preparations. Peripheral blood mononuclear cells (PBMC) were isolated from whole blood by Ficoll-Hypaque density gradient centrifugation. The cells were cryopreserved until tested. In the clonality expansion study, CD4⁺ cells were depleted from PBMC by anti-CD4-conjugated Dynabeads (Dynal UK Ltd.).

Flow cytometry analysis for T-cell repertoire. Two-color staining was carried out as described previously (28). PBMC were stained with a panel of monoclonal antibodies (MAb) specific for the -chain variable region of the TCR (V) by using a second-layer rabbit anti-mouse antibody directly conjugated to fluorescein isothiocyanate (Dako Ltd.). The anti-CD8 MAb was directly conjugated to phycoerythrin (Dako Ltd.). The panel of anti-human TCR V-region MAb is as follows: B237.2 (BV1), E2.2E7.2 (BV2), LE89 (BV3), 30/3D6 (BV5S2/S3), OT145 (BV6S7), 3G5D5 (BV7S1), JR2 (BV8), MKB1P.2-10 (BV9), S511 (BV12), H131 (BV13S1), H132 (BV13S2), C1 (BV17), ELL1.4 (BV20), 1G125 (BV21S3), and HUT78#7 (BV23). These antibodies were part of the human TCR MAb workshop. Cells were analyzed on a Becton-Dickinson FACScan using CELLQUEST software. CD8⁺ T lymphocytes within an individual V family were considered to have attained significant expansion when the percent staining was higher than three standard deviations above the mean staining of that V family in the control population.

Molecular cloning and sequencing of TCR beta chains. RNA was extracted from CD4-depleted T cells by using TRIreagent (Sigma Chemical Co.) and used in first-strand cDNA synthesis with CB14 primer, CTCAGCTCCACGTG as described previously (40). The cDNA was used as a template in PCRs using 3' CB-R primer (ATACTGGAGTCGACCTTCTGATGGCTCAAACAC) and 5' BV primer. The 5' primers were BV7, ATAAGAATGCGGCCGCGTTTGTCTACAGCTATGAGAAACTCT; BV8, TTCTAGAAGCGGCCGCACGTTCCGATAGATGATTCAG; and BV17, ATAAGAATGCGGCCGCACAGCGTCTCTCGGGAGA. The PCR conditions were as previously described (5). The PCR products were gel purified using the Wizard PCR purification kit (Promega). The purified product was cloned in a pMOSBLUE T-vector (Amersham Life Sciences). Plasmid DNA was extracted by the DNA purification system (Promega). Double-stranded DNA sequencing was performed with T7 DNA polymerase (Pharmacia) and M13 20 primer (GTAAAACGACGGCCAGT).

Depletion of expanded T cells. PBMC were cultured overnight at 37°C in the presence of 10 U of interleukin-2/ml of RPMI 1640 plus 10% fetal calf serum (R10). Cells were counted for live cells and split into two groups. One group was kept as untreated cells. The other was incubated with antibodies against the expanded V TCR for 1 h at 4°C. After washing, goat anti-mouse immunoglobulin G-coated Dynabeads (Dynal) were added to the cells and rotated for 1 h at 4°C and then removed using a magnet. Unbound cells were tested for cytotoxic T-lymphocyte (CTL) activity.

CTL activity. CTL activity was assayed as described previously (18). Briefly, autologous EBV-transformed B cells, target cells, were infected with vaccinia virus recombinants expressing the measles virus fusion protein (F), hemagglutinin (H), or nucleoprotein (NP) at a multiplicity of infection of 5 for 2 h at 37°C. Cells were then washed and left at 37°C in R10 for 16 h before labelling them with ⁵¹chromium. An effector-to-target ratio of 20 to 1 was used in a 4-h ⁵¹chromium release assay.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

The CD8⁺ T-cell repertoire is distorted during acute MV infection. By staining PBMC with a panel of 15 MAbs specific for the TCR V chain, we found expanded populations of CD8⁺ T cells expressing particular V chains (V expansions) in 16 of 19 children with acute MV infection and 2 of 4 vaccinees (Table 1). Up to four different V expansions were found in any one individual. The expansions were not confined to particular TCR V families, and there was no association with HLA class I (Table 1). There was no correlation between severity of the disease and the number or size of the expansions (data not shown). Follow-up samples were examined 4 to 9 months after acute infection and 8 to 10.5 months after vaccination. By this time, most of the expansions were reduced in size or were no longer detectable, with only a few V expansions persisting.

CD8⁺ TCR V expansions are clonal or oligoclonal. To determine whether the expansions observed were derived from one (clonal) or a few (oligoclonal) T-cell clones, we examined the predicted amino acid sequences of the V chain CDR3 regions (between V and J) of the expanded CD8⁺ T cells in three children. In patient M42, 64% of the expanded BV8⁺ CD8⁺ T-cell transcripts were identical, showing that a single clone of T cells accounted for most of this expansion of 16% of CD8⁺ T cells (Table 2). In the follow-up sample taken from this child, the repertoire, as assessed using TCR V-specific MAbs, had returned to normal. However, sequence analysis of the BV8 CDR3 region showed that the clonotype that dominated the primary response was still detectable, albeit at a lower frequency (44%).

Expanded T lymphocytes show virus-specific cytotoxic function. To determine whether the expanded T cells were cytotoxic, the patients' PBMC were tested with autologous B cells infected with vaccinia virus expressing MV protein, i.e., fusion protein (F), hemagglutinin (H), or nucleoprotein (NP), at an effector/target ratio of 20:1. Patient M152 had a CD8⁺ T-cell expansion of T cells expressing BV13S1 (9.28% compared to 3.35% ± 0.96 in Gambian controls) (Table 1) at the time of acute MV infection. PBMC from this patient after overnight culture in the absence of antigen lysed F-expressing vaccinia virus-infected cells. This killing activity was reduced from 30 to 1% after removing the BV13S1⁺ cells from PBMC (Fig. 1).

View larger version (22K): [in this window] [in a new window]   FIG. 1.   Cytotoxic activity from patients with acute MV infection was tested before and after depleting V expansions from PBMC. The percent specific lysis of target cells expressing vaccinia virus recombinants expressing fusion protein (F) and hemagglutinin (H) was shown. In patients M152 and M342, all the expanded T cells were removed. In patient M111, only 2 of 4 V expansions were depleted. Patient M132, who had no particular TCR expansion, was used as negative control. PBMC of these patients were also tested for cytotoxic activity against -galactosidase-expressing vaccinia virus, on a different occasion, as a control. All samples had less than 5% killing against this recombinant.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

Distortion of the human T-cell repertoire during acute and chronic infection with HIV, SIV, and EBV has been demonstrated (5, 7, 25, 40). Those reports described expansions in particular V T-cell subsets during the acute phase of infection. Most of the expansions declined to baseline levels in follow-up samples several weeks later, but in some cases V T-cell expansions could persist, as detected by PCR, for up to 2 years (40, 41). In order to determine whether skewing of the T-cell repertoire is also characteristic of nonpersistent virus infections, we examined the TCR repertoire of CD8⁺ T cells in patients with acute MV infection. Expansions similar to those detected during primary HIV or EBV infection were found. Recipients of attenuated MV vaccine showed similar results; in two of four vaccinees the T-cell responses were greater than those in naturally infected patients. This may reflect the reduced immunosuppressive effects of the vaccine strain of virus. It is noteworthy that no TCR expansions were found in control children recovering from malaria infection. Although there is good evidence that CD8⁺ T cells respond to liver-stage antigens (27), the response may be very weak compared to that in an acute virus infection.

The TCR -chain CDR3 region highly variable. It is important in interacting with antigenic peptides presented by HLA molecules (9, 12, 13). Sequence analysis of this highly variable region of the TCR indicates whether the T cells are clonal or oligoclonal, suggesting selection by an antigen, or polyclonal. In patient M42 and vaccinee CBL121, the V expansions were dominated by a single clone, whereas in patient M43 the expanded BV7S1⁺ CD8⁺ T cells showed oligoclonality, with selection for CDR3 length and heavy bias toward the use of joining chain BJ2S7. This joining chain is one of two J families containing a glutamate-glutamine motif (highlighted in Table 3) (35) which has been shown to be involved in antigen recognition by the TCR (19). The clonal and oligoclonal nature of the expansions found during primary MV infection strongly suggests that they are driven by antigen specificity.

Following recovery from MV infection, the T-cell repertoire, as determined using TCR V-specific MAbs, usually returned to normal. However, a few expansions sometimes remained. Half the vaccinees showed results similar to those infected naturally, with some persistent, oligoclonal T-cell expansions. Chronic clonal expansion in a persistent infection probably results from continuous activation by antigens; however, in MV infection the virus disappears from the blood and tissue within 1 month (17), yet the expansions can persist much longer. Why these clones persist and escape from activation-induced cell death is not known. Not all clones persist, however, for example, the BV7S1 population in M43 was lost.

Until now it has been difficult to show that the expanded CD8⁺ T cells found in acute virus infections can mediate antigen-specific cytotoxicity (5, 25). Recently, staining of expanded T cells with tetrameric HLA-peptide complexes has confirmed that they are antigen specific (6, 11, 41), and when sorted by flow cytometry, these T cells secrete gamma interferon in response to antigen challenge (10). Pantaleo et al. (25) showed cytotoxic capacity in sorted CD8⁺ T cells expressing BV17, an expanded cell population in an HIV patient. However, the sorted cells had to be stimulated in culture with an anti-CD3 MAb for 10 days, and a surprisingly high effector-to-target (E:T) cell ratio was needed to demonstrate significant killing. Here, we tested the virus-specific cytotoxic activity of fresh unstimulated PBMC before and after depleting the expanded population. When the expanded T cells were removed from PBMC of patients with acute MV infection, cytotoxic activity against target cells infected with MV-expressing vaccinia virus was completely lost. The antibody only removed the T cells carrying that receptor, and the BV13S1 antibody only impaired the lytic response when there was a BV13S1 expansion, excluding nonspecific effects. This study therefore provides direct evidence that the expanded CD8⁺ T cells are specific for MV antigens and function as cytotoxic effector cells.

The magnitude of the clonal expansions which develop in response to acute virus infection is very variable. Massive clonal expansions could lead to exhaustion and anergy (22, 26). Gallimore et al. (11) showed reduced function in some expanded CD8⁺ T-cell populations in mice after acute infection with an aggressive variant of lymphocytic choriomenigitis virus. In patients M152 and M342, expansions comprised 8 to 11% CD8⁺ T lymphocytes. Cytotoxicity was abolished after depleting these particular populations. In contrast, in patient M111, no significant cytotoxicity was found in the expanded T cells. This patient had four expansions, the largest against BV17, consisting of 23% of the CD8⁺ T cells. PBMC from this patient killed target cells expressing H but not those expressing F and NP. The killing activity was only slightly decreased after depleting cells expressing BV17 and BV21S3 which together comprised 30% of CD8⁺ T cells. Thus, the specificity for H probably resided in the smaller expansions. The depleted T-cell clones might react to other MV proteins which were not tested, although Jaye et al. (18) have shown that F, H, and NP are normally the major targets for CTL. Alternatively, the large, expanded BV17 and BV21S3 T-cell population in this patient might comprise cells at a late stage of differentiation with poor cytotoxic function (8). Thus, although the expanded CD8⁺ T cells can be shown in some cases to have very specific cytotoxic function, it is possible that further expansion could lead to a decrease in function. This issue needs further examination. A third possibility is that these cells are bystander expansions in response to cytokines; although bystander effects have been described previously (34), such expansions are not oligoclonal and their magnitude has been questioned (4, 24).

In conclusion, we have demonstrated large expansions of virus-specific CD8⁺ T-cell clones that have cytolytic activity in acute MV infection. Similar expansions were found after vaccination with live, attenuated MV. In many cases, the expansions persisted for several months. Such expansions comprise a few clones and are remarkable for their magnitude. It is likely that they contribute to the control and clearance of MV infection.