Previous Article | Next Article 
Journal of Virology, January 1999, p. 46-50, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Influenza C Virus CM2 Protein Is Produced from a 374-Amino-Acid
Protein (P42) by Signal Peptidase Cleavage
Seiji
Hongo,1
Kanetsu
Sugawara,1
Yasushi
Muraki,1
Yoko
Matsuzaki,1
Emi
Takashita,1
Fumio
Kitame,2 and
Kiyoto
Nakamura1,*
Department of
Bacteriology1 and
Department of
Nursing,2 Yamagata University School of
Medicine, Iida-Nishi, Yamagata 990-2331, Japan
Received 1 July 1998/Accepted 8 October 1998
 |
ABSTRACT |
Although unspliced mRNA from influenza C virus RNA segment 6 (M
gene) has a single open reading frame capable of encoding a
374-amino-acid protein (Mr, 42,000), the major
polypeptide synthesized from this mRNA species is the CM2 protein, with
an Mr of 18,000. The present study was
performed to investigate the mechanism by which CM2 is generated
from the unspliced mRNA. It was reported previously that the
374-amino-acid protein (P42) is an integral membrane protein having two
internal hydrophobic domains, one of which (residues 241 to 252) is
followed by two sequences (252 Ile-Thr-Ser and 257 Ala-Ser-Ala)
favorable for cleavage by signal peptidase. To examine the possibility
that P42 is cleaved by signal peptidase after Ser residue 254 or Ala
residue 259 to yield CM2, we constructed three mutated M gene cDNAs in
which either or both of the two sequences were eliminated and tested
their ability to synthesize CM2 in the transfected COS cells. The
results showed that CM2 synthesis was blocked completely when the
second recognition motif for signal peptidase was removed. It was also
found that when the mRNA transcript of the wild-type M gene was
translated in vitro, P42, but not CM2, was synthesized in the absence
of dog pancreas microsomal membranes, whereas CM2, in addition
to a polypeptide (designated M1') slightly larger than matrix protein (M1), was synthesized in the presence of microsomes. When the same
experiment was done with the transcript of the mutated M gene in which
the second recognition motif was removed, synthesis of CM2 could not be
seen, even in the presence of microsomes. From these results,
we conclude that cleavage of P42 by signal peptidase after Ala residue
259 produces CM2, composed of the C-terminal 115 amino acids, in
addition to M1', composed of the N-terminal 259 amino acids.
| |
INTRODUCTION |
The influenza C virus genome
consists of seven single-stranded RNA segments of
negative polarity. RNA segment 6 (M gene) of C/Yamagata/1/88 is 1,181 nucleotides long and has a single open reading frame (positions
27 to 1148) capable of encoding a polypeptide of 374 amino acids, with
a predicted Mr of 42,000 (2).
However, the predominant mRNA transcript of this RNA segment lacks a
region from nucleotides 755 to 982 and encodes a 242-amino-acid matrix (M1) protein with an Mr of 27,000; elimination
of the intron results in the introduction of a termination codon
(consisting of nucleotides 753, 754, and 983) after amino acid residue
242 (2, 14). Unspliced mRNA from RNA segment 6 is
synthesized in infected cells, but its amount is very low (13% of
spliced mRNA) (2). This mRNA species is capable of coding
for a 374-amino-acid protein containing an additional 132 amino acids
from the C terminus of M1. However, immunoprecipitation
experiments with anti-GST/CM2 serum which was raised against
the glutathione S-transferase fusion protein containing the
extra C-terminal region identified a protein (CM2) with an
Mr of 18,000 in infected cells (2).
Recently, our laboratory (3) as well as Pekosz and Lamb
(6) demonstrated that CM2 is an integral membrane protein
that has many of the same biochemical properties (including
NoutCin membrane orientation, the sizes of the
ectodomain and cytoplasmic tail, and the ability to form
disulfide-linked dimers and tetramers) as influenza A virus M2 and
influenza B virus NB having an ion channel activity (1, 7, 10,
11). More recently, we succeeded in detecting the 374-amino-acid
protein (designated P42) and its N-glycosylated form (designated P44)
in influenza C virus-infected cells as well as in eukaryotic cells
transfected with the M gene cDNA, although their amounts were extremely
low compared with that of CM2 (4). P42/P44 is an integral
membrane protein containing two regions (amino acid residues 241 to 252 and 287 to 318) sufficiently hydrophobic to interact with membranes
(see Fig. 5 for its possible orientation in membranes) (4).
The mechanism by which CM2 is produced from the unspliced mRNA is not
known. However, it has previously been pointed out (2, 6)
that three initiation codons lie in the same reading frame as that used
for M1 at nucleotides 732 to 734, 741 to 743, and 747 to 749, one of
which (residues 732 to 734) is in the context considered most favorable
for initiation of protein synthesis (A/GNNAUGG) (5),
suggesting that the unspliced mRNA may be translated from the
initiation codon at nucleotides 732 to 734 to the termination codon at
nucleotides 1,149 to 1,151, generating a 139-amino-acid CM2 protein. In
this study, however, we present data showing that none of the three AUG
codons located between nucleotides 732 and 749 are used for initiation
of CM2 synthesis and provide evidence which indicates that a
374-amino-acid protein (P42/P44) is cleaved by signal peptidase to
produce a 115-amino-acid CM2 protein, in addition to the previously
unrecognized protein of 259 amino acids.
| |
MATERIALS AND METHODS |
Virus and cells.
The Yamagata/1/88 strain of influenza C
virus was grown in the amniotic cavities of 9-day-old embryonated
hen's eggs (15). COS cells were cultured in Dulbecco's
modified Eagle's medium containing 10% fetal calf serum.
Plasmid construction and site-directed mutagenesis.
To
construct plasmid pME18S-CM2ORF used for expressing the putative CM2
coding region (nucleotides 732 to 1148), the DNA fragment corresponding
to positions 728 to 1181 was obtained by PCR, with plasmid pCM5-3'F
(2) (which contains nucleotides 3 to 1168 of the
C/Yamagata/1/88 virus M gene and nucleotides 1169 to 1181 of the C/Ann
Arbor/1/50 virus M gene) as a template and two primers (plus-sense
primer composed of the EcoRI site followed by the sequence
corresponding to positions 728 to 749 and minus-sense primer
corresponding to positions 1181 to 1159). The PCR product was cut with
EcoRI and EcoNI and inserted into the
EcoRI and EcoNI sites of pCM5-3'F. The DNA
fragment composed of residues 728 to 1181 was then excised by digestion
with EcoRI and SalI and subcloned into the
EcoRI and XhoI sites of a transient expression
vector, pME18S (12) (a generous gift of Y. Takebe, National
Institute of Infectious Diseases) to give pME18S-CM2ORF.
The mutated M gene cDNAs (except for DL705) were made by PCR with
mutant primers. To create an ATG codon mutant IC-1 (see Fig. 1A), the
450-bp DNA fragment corresponding to positions 732 to 1181 was prepared
by PCR with pCM5-3'F as a template and a plus-sense mutant primer
(5'-dGCGGGACGAATGGCAATGAAATG [altered nucleotides are underlined]) corresponding to positions 732 to 754 and
a minus-sense primer corresponding to positions 1181 to 1159. The
557-bp DNA fragment corresponding to positions 175 to 731 was also
prepared with primers corresponding to positions 175 to 194 (plus-sense) and 731 to 711 (minus-sense). The 557- and 450-bp PCR
products were cut with NcoI and EcoNI,
respectively, and the resulting fragments (residues 237 to 731 and 732 to 1080) were phosphorylated with T4 polynucleotide kinase and then
ligated into the NcoI and EcoNI sites of plasmid
pCM5-5'3'F (4), which contains nucleotides 1 to 1168 of the
C/Yamagata/1/88 virus M gene and nucleotides 1169 to 1181 of the C/Ann
Arbor/1/50 virus M gene. The DNA molecules containing a full-length
copy of the altered M gene were excised by digestion with
EcoRI and SalI and then subcloned into the
EcoRI and XhoI sites of pME18S. The remaining four mutated M genes shown in Fig. 1A were created according to the
same procedures as those used for the creation of mutant IC-1, except
that different mutant primers were used for preparation of the 450-bp
DNA fragments (IC-1,2, IC-2,3, and IC-1,2,3) and that two DNA fragments
corresponding to positions 175 to 704 and 706 to 1181 were first
synthesized by PCR(DL705).
To create mutant SP-1, having an amino acid sequence change of 252 Ile-Thr-Ser to 252 Met-Thr-Thr (see Fig.
3A), the 618-bp
DNA fragment
corresponding to nucleotide positions 175 to 792
was generated by PCR
with a plus-sense primer (corresponding to
positions 175 to 194) and a
minus-sense mutant primer
(5'-dGTTGA
GTTGT
CATAGAGAAATATATTATAACAAC
[altered nucleotides are underlined]) corresponding to
positions
792 to 759. In parallel, a 389-bp DNA fragment corresponding
to
positions 793 to 1181 was prepared by using primers corresponding
to
positions 793 to 815 (plus-sense) and 1181 to 1159 (minus-sense).
For
construction of mutant SP-2 with a change of 257 Ala-Ser-Ala
to 257 Met-Ser-Met (see Fig.
3A), a plus-sense mutant primer
(5'dCT
ATGTCT
ATGTGCAATCTAAAGACCTGTCTAAACC
[altered nucleotides are underlined]) corresponding to 793 to
828 was used for synthesis of the 389-bp DNA fragment. In either
case,
the 618- and 389-bp PCR products were digested with
NcoI
and
EcoNI, respectively, and the resulting fragments were
phosphorylated
and ligated into the
NcoI and
EcoNI sites of pCM5-5'3'F. The mutated
M gene cDNA was then
excised and subcloned into pME18S, as described
above. The nucleotide
sequences of all the mutant cDNAs in the
pCM-5'3'F plasmid were
confirmed by dideoxynucleotide chain-terminating
sequencing.
Transfection, metabolic labeling, and
immunoprecipitation.
Subconfluent monolayers of COS cells in
3.5-cm-diameter petri dishes were transfected with the recombinant
pME18S plasmid (1 µg/plate) containing the wild-type (WT) or mutated
M gene by the lipofectamine procedure and incubated at 37°C. At
48 h posttransfection, cells were labeled with 40 µCi of
[35S]methionine (ARC)/ml for 1 h in
methionine-deficient Dulbecco's modified Eagle's medium. Cells were
then disrupted in 0.01 M Tris-HCl (pH 7.4) containing 1% Triton X-100,
1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 0.15 M
NaCl, and a cocktail of protease inhibitors (3) and
immunoprecipitated as described previously (8), utilizing
anti-GST/CM2 serum or monoclonal antibody against the M1 protein (L2)
(9). The immunoprecipitates obtained were analyzed by
SDS-polyacrylamide gel electorophoresis (PAGE) on 17.5% gels
containing 4 M urea under reducing conditions and processed for
analysis by fluorography (15).
In vitro transcription and translation.
This procedure was
carried out with the TnT T7 Quick Coupled Transcription/Translation
system, which contains rabbit reticulocyte lysates, T7 RNA polymerase,
ribonucleotides, and RNase inhibitor, according to the directions
provided by the supplier (Promega). The recombinant Bluescript II KS(+)
plasmid (1 µg), containing either the WT M gene (pCM5-5'3'F) or the
mutated M gene, together with [35S]methionine (30 µCi),
was added to a reaction mixture (50 µl), and reactions were allowed
to proceed at 30°C for 70 min in the presence or absence of canine
pancreas microsomal membranes (2.5 µl) (Promega). Translation
products were analyzed by SDS-PAGE either directly or after
immunoprecipitation with anti-GST/CM2 serum or anti-M1 monoclonal antibody.
| |
RESULTS AND DISCUSSION |
Three initiation codons present between nucleotides 732 and 749 are
not used to initiate CM2 synthesis.
To examine the possibility
that one of the three AUG codons located at nucleotide positions 732 to
734, 741 to 743, and 747 to 749 is used for initiation of CM2
synthesis, COS cells were transfected with the recombinant plasmid
pME18S-CM2ORF constructed to contain nucleotides 728 to 1181 of the M
gene, labeled with [35S]methionine, and analyzed by
immunoprecipitation with either anti-GST/CM2 serum or anti-M1
monoclonal antibody. The results (Fig.
1B) show that CM2 (but not M1) was
synthesized in the transfected cells, as has been observed by Pekosz
and Lamb (6) with the vac-T7 expression system, a finding
which supports the idea described above. To identify the initiation
codon used for CM2 synthesis, therefore, we created four different ATG
codon mutants (IC-1; IC-2,3; IC-1,2; and IC-1,2,3) shown in Fig. 1A and
tested their ability to synthesize CM2 by expression in COS cells. When
cells were transfected with plasmid pME18S-CM, containing the WT M gene (4), and immunoprecipitated with anti-GST/CM2 serum,
it was found that three forms of CM2 (CM20, CM2a, and
CM2b) were synthesized, in addition to a trace amount of P42
(Fig. 1B). We demonstrated previously that a
mannose-rich oligosaccharide core is added to unglycosylated CM20 (Mr, 16,000) to
form CM2a (Mr, 18,000) and that the maturation
of oligosaccharide chain from the high-mannose type to the complex one
converts CM2a into CM2b (Mr, 22,000 to 30,000)
(3). Immunoprecipitation with anti-M1 monoclonal antibody also revealed the synthesis of M1 in the transfected cells.
View larger version (57K):
[in this window]
[in a new window]
|
FIG. 1.
The three initiation codons present between nucleotides
732 and 749 are not used to initiate CM2 synthesis. (A) Nucleotide
substitutions in the ATG codon mutants (IC-1; IC-2,3; IC-1,2; and
IC-1,2,3) and the deletion mutant (DL705) are shown. The three
initiation codons, which have previously been suggested to be used for
initiating CM2 synthesis (2, 6), are underlined. The open
triangle indicates deletion of a nucleotide residue. The position of
the newly generated termination codon in the mutant DL705 is boxed. (B)
COS cells were transfected with the recombinant plasmid constructed to
contain the WT M gene (WT), the mutated M gene (DL705; IC-1; IC-2,3;
IC-1,2; or IC-1,2,3), the putative CM2 open reading frame (CM2ORF), or
the influenza A/Aichi/68 virus HA gene (A-HA) (a generous gift of E. Nobusawa, Nagoya City University). Cells were then labeled with
[35S]methionine for 1 h at 48 h
posttransfection and immunoprecipitated with either anti-GST/CM2 serum
(lanes S) or anti-M1 monoclonal antibody (lanes M), and the resulting
precipitates were analyzed by SDS-PAGE. COS cells infected with
C/Yamagata/1/88 virus and labeled with [35S]methionine
for 1 h at 26 h postinfection were also analyzed by
immunoprecipitation followed by SDS-PAGE (VIC). In this experiment, P44
could not be unequivocally identified because of its comigration with a
cellular protein. Numbers at the right show Mrs
(in thousands).
|
|
Among the three AUG codons in question, the first one (nucleotides 732 to 734) is in the strongest context for ribosome initiation
(A/GNNAUGG)
(
5) and has been thought to be the most likely
initiation
codon used for CM2 synthesis (
2,
6). Unexpectedly,
however,
elimination of this initiation codon by converting residues
732 to 734 from ATG to GCG (mutant IC-1) did not affect the amounts
of CM2,
P42, and M1 synthesized in the transfected cells at all
(Fig.
1B).
Moreover, it became evident that CM2, in addition to
M1 and P42,
was synthesized in cells transfected with any of the
double (IC-1,2 and
IC-2,3) or triple (IC-1,2,3) ATG codon mutants.
These results led
us to conclude that none of the three initiation
codons located
between nucleotide positions 732 and 749 are used
when CM2 is
synthesized from the colinear mRNA transcript of the
M gene, although
one or more of them is used in the absence of
nucleotides 1 to 727. To
further confirm this conclusion, we introduced
a deletion of nucleotide
residue 705 into the M gene to give a
mutant DL705 (Fig.
1A). In DL705,
a deletion of residue 705 introduced
a translation termination codon at
positions 748 to 750, resulting
in the loss of the ability to
synthesize P42 and M1 as well as
in the acquisition of the capacity to
encode a 240-amino-acid
protein, the N-terminal 227 residues of which
are identical with
those of M1. More importantly, mutant DL705
should retain the
ability to synthesize CM2 if one of the three
initiation codons
described above is used for synthesis of the protein,
since they
are all preserved in the mutated M gene. Transfection of COS
cells
with mutant DL705 followed by immunoprecipitation with
anti-GST/CM2
serum or anti-M1 monoclonal antibody showed that
neither P42 nor
CM2 was synthesized in the transfected cells,
although synthesis
of a protein with the electrophoretic
mobility indistinguishable
from that of M1 (which presumably represents
a 240-amino-acid
protein) could be detected (Fig.
1B). The
finding that the failure
of DL705 to synthesize P42 was accompanied by
the failure to generate
CM2 led us to postulate that
synthesis of P42 may be a prerequisite
for the production of
CM2; P42 may be the primary product of unspliced
mRNA from the M gene
and may be cleaved co- or posttranslationally
to yield
CM2.
It should be noted in regard to Fig.
1B that the amount of CM2
(relative to the amount of M1) synthesized in cells transfected
with
the WT and mutant M gene cDNAs (except for DL705) was much
larger than
that in influenza C virus-infected cells, raising
the possibility that
virus-specific proteins other than the M
gene products may regulate
splicing of the colinear M gene
transcript.
Kinetics of the production of P42 and CM2.
We reported
previously that the precursor-product relationship between P42
and CM2 could not be detected in pulse-chase experiments in which
a pulse-labeling period of 10 min was employed (4). To
further examine the possibility that P42 is cleaved
posttranslationally to yield CM2, COS cells transfected with
pME18S-CM (containing the WT M gene) were pulse-labeled for an
extremely short period (1, 2, 4, or 6 min) at 48 h
posttransfection and then immunoprecipitated with anti-GST/CM2
serum. As shown in Fig. 2, the amounts of
P42 and its N-glycosylated form (P44) were very low compared
with those of CM2 (CM2a and CM20), even when cells were
pulse-labeled for only 1 or 2 min, a result similar to that obtained
with the transfected cells labeled for 1 h (Fig. 1B). This
observation suggests strongly that if a cleavage event is
involved in the biosynthesis of CM2, it must occur, cotranslationally
or otherwise, immediately after the completion of translation.
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
[35S]methionine labeling of the M gene
cDNA-transfected cells for a short period. COS cells transfected with
the recombinant plasmid pME18S-CM (containing the WT M gene) were
labeled with [35S]methionine for 1 min (lane 1), 2 min
(lane 2), 4 min (lane 3), or 6 min (lane 4) and immunoprecipitated with
anti-GST/CM2 serum, and the resulting precipitates were analyzed
by SDS-PAGE.
|
|
Cleavage of P42/P44 by signal peptidase produces CM2.
The
first hydrophobic domain (residues 241 to 252) of P42 is followed by
two sequences (252 Ile-Thr-Ser and 257 Ala-Ser-Ala) favorable for
cleavage by signal peptidase (13), raising the possibility that P42/P44, during or after penetration of the
endoplasmic reticulum membrane, may be cleaved by signal peptidase
after either Ser residue 254 or Ala residue 259, yielding CM2. To
investigate this possibility, three different M gene mutants (SP-1,
SP-2, and SP-1,2) shown in Fig. 3A, were
constructed, and their ability to synthesize CM2 was tested. In mutant
SP-1,2, the two recognition motifs for signal peptidase were both
eliminated. Immunoprecipitation of SP-1,2-transfected COS cells with
anti-GST/CM2 serum or anti-M1 monoclonal antibody followed by SDS-PAGE
showed that this mutant lacks the ability to synthesize CM2, although
it is capable of synthesizing M1 (Fig. 3B). It was also evident
that the amounts of P42 and P44 synthesized in SP-1,2-transfected
cells were much larger than those synthesized in the WT-transfected
cells. These observations indicate that the existence of at least one
of the two recognition motifs is essential for producing CM2 and that the failure of this mutant to produce CM2 is accompanied by the accumulation of P42 and P44. In mutants SP-1 and SP-2, the first and
second consensus sequences for signal peptidase cleavage were removed,
respectively. As clearly seen in Fig. 3B, synthesis of CM2 was
detected in the SP-1-transfected cells but not in the SP-2-transfected cells, indicating the critical role of the second recognition motif in CM2 synthesis. If P42/P44 is certainly cleaved by
signal peptidase after Ala residue 259, this cleavage event should
yield a 259-amino-acid protein which contains 17 additional amino acids
from the C terminus of M1 in addition to a 115-amino-acid protein, CM2.
In the SDS-PAGE patterns of the immunoprecipitates obtained after the
WT- or SP-1-transfected cell lysates were treated with anti-M1
monoclonal antibody, a thin band (indicated by an arrowhead) with
slightly slower electrophoretic mobility than that of M1 could be seen
(Fig. 3B). This band is likely to correspond to the 259-amino-acid
protein described above, since it was undetectable in the cells
transfected with SP-2 or SP-1,2 in which the cleavage of P42/P44 did
not occur. This protein was designated M1'.
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
The existence of the second recognition motif
for signal peptidase is essential for producing CM2. (A) Amino acid
substitutions in mutants with alterations in the recognition motifs for
signal peptidase are shown. Two sequences favorable for cleavage by
signal peptidase are indicated by solid underlines. The hydrophobic
domain that can interact with a lipid bilayer is indicated by a dotted
underline. The N-glycosylation site is boxed. (B) COS cells transfected
with the recombinant plasmid containing the WT M gene (WT), the
mutated M gene (SP-2, SP-1, or SP-1,2) or influenza A/Aichi/68 virus HA
gene (A-HA) were labeled with [35S]methionine for 1 h at 48 h posttransfection and immunoprecipitated with
anti-GST/CM2 serum (lanes S) or anti-M1 monoclonal antibody (lanes M),
and the resulting precipitates were analyzed by SDS-PAGE.
C/Yamagata/1/88 virus-infected COS cells labeled with
[35S]methionine for 1 h at 26 h postinfection
were also analyzed by immunoprecipitation followed by SDS-PAGE
(VIC). Arrowheads indicate the 259-amino-acid protein (M1') that
presumably contains an additional 17 amino acids from the C terminus
of M1.
|
|
To obtain unequivocal evidence which indicates that P42/P44 is the
primary product of unspliced mRNA from RNA segment 6 and
is cleaved by
signal peptidase to generate CM2, the WT and mutated
M gene cDNAs (SP-1
and SP-2) were transcribed and then translated
in vitro by using a kit
described in Materials and Methods. The
translation products obtained
were analyzed by SDS-PAGE following
immunoprecipitation with
anti-GST/CM2 serum or anti-M1 monoclonal
antibody (Fig.
4). We should mention here that because
of the
lack of splicing machinery, the M1 protein encoded by a spliced
mRNA is not synthesized in this system. When the mRNA transcript
of the
WT M gene was translated in vitro in the absence of dog
pancreas
microsomal membranes, P42 was the only product detected.
In the
presence of microsomes, by contrast, the almost-complete
disappearance
of P42 was accompanied by the appearance of CM2a
(detected by
immunoprecipitation with anti-GST/CM2) and M1' (detected
by
immunoprecipitation with anti-M1 monoclonal antibody). Essentially
identical results were obtained with mutant SP-1. When mutant
SP-2
was subjected to in vitro transcription and translation,
by contrast,
neither CM2 nor M1' was synthesized, even in the
presence of microsomal
membranes, P44 being the only translation
product detected.
View larger version (72K):
[in this window]
[in a new window]
|
FIG. 4.
In vitro transcription and translation of the
mutant cDNAs with alteration in one of the two recognition motifs
for signal peptidase. The WT M gene cDNA (WT) and the mutated M gene
cDNAs (SP-2 and SP-1) were transcribed and then translated in vitro in
the presence (+) or absence ( ) of dog pancreas microsomal membranes,
according to the procedures described in Materials and Methods. The
translation products obtained were analyzed by SDS-PAGE either
directly (LYS) or after immunoprecipitation with anti-GST/CM2
serum (S) or anti-M1 monoclonal antibody (M). The
immunoprecipitates obtained from COS cells transfected with pME18S-CM
(a plasmid containing the WT M gene) and then labeled with
[35S]methionine for 1 h at 48 h
posttransfection were also analyzed by SDS-PAGE (TFC).
|
|
Conclusions.
Based on the data presented here, we
conclude that biosynthesis of CM2 proceeds in the following manner
(Fig. 5). (i) Unspliced mRNA from RNA
segment 6 is first translated into a 374-amino-acid protein, P42. (ii)
Cotranslationally or immediately after the completion of translation,
P42 begins to be inserted into the endoplasmic reticulum with the aid
of the first hydrophobic domain, composed of amino acid residues 241 to
252. (iii) Translocation of P42 through the membrane is halted by the
presence of the second hydrophobic domain, consisting of residues 287 to 318. (iv) P42 is then N-glycosylated at Asn residue 270 (6), generating P44. (v) Either before or after the
addition of an oligosaccharide chain, P42/P44 is cleaved by signal
peptidase at the C-terminal side of Ala residue 259, producing the M1'
and CM2 proteins, composed of the N-terminal 259 amino acids and
the C-terminal 115 amino acids, respectively. It should be
noted, however, that the orientation of M1' in membranes, as well as
the fate of the protein in infected cells and its role in virus
replication, remains to be determined in future studies.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
Proposed model for the biosynthesis of CM2. The
374-amino-acid protein (P42) has two hydrophobic domains capable of
interacting with a lipid bilayer (shaded) and a
N-glycosylation site (CHO). This protein is cleaved by signal peptidase
after Ala residue 259 to produce the M1' and CM2 proteins composed of
the N-terminal 259 amino acids and C-terminal 115 amino acids,
respectively.
|
|
| |
ACKNOWLEDGMENTS |
We thank N. Iizuka (Nagoya City University) for helpful
discussions and Y. Takebe (National Institute of Infectious Diseases) and E. Nobusawa (Nagoya City University) for providing the plasmids.
This work was supported by a grant-in-aid for scientific research from
Ministry of Education, Science, and Culture, Japan.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Bacteriology, Yamagata University School of Medicine, Iida-Nishi,
Yamagata 990-2331, Japan. Phone: 81 236 28 5247. Fax: 81 236 28 5250.
| |
REFERENCES |
| 1.
|
Ciampor, F.,
P. M. Bayley,
M. V. Nermut,
E. M. A. Hirst,
R. J. Sugrue, and A. J. Hay.
1992.
Evidence that the amantadine-induced, M2-mediated conversion of influenza A virus hemagglutinin to the low pH conformation occurs in an acidic trans Golgi compartment.
Virology
188:14-24[Medline].
|
| 2.
|
Hongo, S.,
K. Sugawara,
H. Nishimura,
Y. Muraki,
F. Kitame, and K. Nakamura.
1994.
Identification of a second protein encoded by influenza C virus RNA segment 6.
J. Gen. Virol.
75:3503-3510[Abstract/Free Full Text].
|
| 3.
|
Hongo, S.,
K. Sugawara,
Y. Muraki,
F. Kitame, and K. Nakamura.
1997.
Characterization of a second protein (CM2) encoded by RNA segment 6 of influenza C virus.
J. Virol.
71:2786-2792[Abstract].
|
| 4.
|
Hongo, S.,
P. Gao,
K. Sugawara,
Y. Muraki,
Y. Matsuzaki,
Y. Tada,
F. Kitame, and K. Nakamura.
1998.
Identification of a 374 amino acid protein encoded by RNA segment 6 of influenza C virus.
J. Gen. Virol.
79:2207-2213[Abstract].
|
| 5.
|
Kozak, M.
1986.
Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.
Cell
44:283-292[Medline].
|
| 6.
|
Pekosz, A., and R. A. Lamb.
1997.
The CM2 protein of influenza C virus is an oligomeric integral membrane glycoprotein structurally analogous to influenza A virus M2 and influenza B virus NB proteins.
Virology
237:439-451[Medline].
|
| 7.
|
Pinto, L. H.,
L. J. Holsinger, and R. A. Lamb.
1992.
Influenza virus M2 protein has ion channel activity.
Cell
69:517-528[Medline].
|
| 8.
|
Sugawara, K.,
H. Nishimura,
F. Kitame, and K. Nakamura.
1986.
Antigenic variation among human strains of influenza C virus detected with monoclonal antibodies to gp88 glycoprotein.
Virus Res.
6:27-32[Medline].
|
| 9.
|
Sugawara, K.,
H. Nishimura,
S. Hongo,
F. Kitame, and K. Nakamura.
1991.
Antigenic characterization of the nucleoprotein and matrix protein of influenza C virus with monoclonal antibodies.
J. Gen. Virol.
72:103-109[Abstract/Free Full Text].
|
| 10.
|
Sugrue, R. J., and A. J. Hay.
1991.
Structural characteristics of the M2 protein of influenza A viruses: evidence that it forms a tetrameric channel.
Virology
180:617-624[Medline].
|
| 11.
|
Sunstrom, N. A.,
L. S. Premkumar,
A. Premkumar,
G. Ewart,
G. B. Cox, and P. W. Gage.
1996.
Ion channels formed by NB, an influenza B virus protein.
J. Membr. Biol.
150:127-132[Medline].
|
| 12.
|
Takebe, Y.,
S. Motoharu,
J. Fujisawa,
P. Hoy,
K. Yokota,
K. Arai,
M. Yoshida, and N. Arai.
1988.
SR promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat.
Mol. Cell. Biol.
8:466-472[Abstract/Free Full Text].
|
| 13.
|
von Heijne, G.
1986.
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res.
14:4683-4690[Abstract/Free Full Text].
|
| 14.
|
Yamashita, M.,
M. Krystal, and P. Palese.
1988.
Evidence that the matrix protein of influenza C virus is coded for by a spliced mRNA.
J. Virol.
62:3348-3355[Abstract/Free Full Text].
|
| 15.
|
Yokota, M.,
K. Nakamura,
K. Sugawara, and M. Homma.
1983.
The synthesis of polypeptides in influenza C virus-infected cells.
Virology
130:105-117[Medline].
|
Journal of Virology, January 1999, p. 46-50, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Betakova, T., Hay, A. J.
(2007). Evidence that the CM2 protein of influenza C virus can modify the pH of the exocytic pathway of transfected cells. J. Gen. Virol.
88: 2291-2296
[Abstract]
[Full Text]
-
Muraki, Y., Washioka, H., Sugawara, K., Matsuzaki, Y., Takashita, E., Hongo, S.
(2004). Identification of an amino acid residue on influenza C virus M1 protein responsible for formation of the cord-like structures of the virus. J. Gen. Virol.
85: 1885-1893
[Abstract]
[Full Text]
-
Hagmaier, K., Jennings, S., Buse, J., Weber, F., Kochs, G.
(2003). Novel Gene Product of Thogoto Virus Segment 6 Codes for an Interferon Antagonist. J. Virol.
77: 2747-2752
[Abstract]
[Full Text]
-
Li, Z.-N., Hongo, S., Sugawara, K., Sugahara, K., Tsuchiya, E., Matsuzaki, Y., Nakamura, K.
(2001). The sites for fatty acylation, phosphorylation and intermolecular disulphide bond formation of influenza C virus CM2 protein. J. Gen. Virol.
82: 1085-1093
[Abstract]
[Full Text]
-
Pekosz, A., Lamb, R. A.
(2000). Identification of a Membrane Targeting and Degradation Signal in the p42 Protein of Influenza C Virus. J. Virol.
74: 10480-10488
[Abstract]
[Full Text]
-
Kochs, G., Weber, F., Gruber, S., Delvendahl, A., Leitz, C., Haller, O.
(2000). Thogoto Virus Matrix Protein Is Encoded by a Spliced mRNA. J. Virol.
74: 10785-10789
[Abstract]
[Full Text]
Top
Abstract
Introduction
