Previous Article | Next Article 
Journal of Virology, January 1999, p. 453-465, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mutations in Nonconserved Domains of Ty3 Integrase
Affect Multiple Stages of the Ty3 Life Cycle
M. Henrietta
Nymark-McMahon and
Suzanne B.
Sandmeyer*
Department of Biological Chemistry,
University of California, Irvine, Irvine, California 92697
Received 20 April 1998/Accepted 15 September 1998
 |
ABSTRACT |
Ty3, a retroviruslike element of Saccharomyces
cerevisiae, transposes into positions immediately upstream of RNA
polymerase III-transcribed genes. The Ty3 integrase (IN) protein is
required for integration of the replicated, extrachromosomal Ty3 DNA.
In retroviral IN, a conserved core region is sufficient for strand transfer activity. In this study, charged-to-alanine scanning mutagenesis was used to investigate the roles of the nonconserved amino- and carboxyl-terminal regions of Ty3 IN. Each of the 20 IN
mutants was defective for transposition, but no mutant was grossly
defective for capsid maturation. All mutations affecting steady-state
levels of mature IN protein resulted in reduced levels of replicated
DNA, even when polymerase activity was not grossly defective as
measured by exogenous reverse transcriptase activity assay. Thus, IN
could contribute to nonpolymerase functions required for DNA production
in vivo or to the stability of the DNA product. Several mutations in
the carboxyl-terminal domain resulted in relatively low levels of
processed 3' ends of the replicated DNA, suggesting that this domain
may be important for binding of IN to the long terminal repeat. Another
class of mutants produced wild-type amounts of DNA with correctly
processed 3' ends. This class could include mutants affected in nuclear
entry and target association. Collectively, these mutations demonstrate
that in vivo, within the preintegration complex, IN performs a central role in coordinating multiple late stages of the retrotransposition life cycle.
 |
INTRODUCTION |
Ty3 is a 5.4-kb retroviruslike
element of the yeast Saccharomyces cerevisiae that has a
life cycle similar to that of animal retroviruses. Integrated Ty3 DNA
is transcribed to produce a 5.2-kb genomic RNA that is translated into
Gag3p and Gag3-Pol3p polyproteins (33-35, 48). The
polyproteins are processed and assembled together with genomic RNA into
viruslike particles (VLPs) analogous to retroviral cores. Ty3 is a
member of the gypsylike family of retroelements (used here to
collectively refer to retroviruses and retroviruslike elements). The
two open reading frames, GAG3 and POL3, encode the major structural proteins capsid (CA) and nucleocapsid (NC) and the
enzymes protease (PR), reverse transcriptase (RT), and integrase (IN),
respectively. Reverse transcription produces full-length Ty3 DNA. Two
extra bases at each 3' end of this DNA are removed by IN prior to
integration (49). This feature is shared with animal
retroviruses, but is less common among characterized retrotransposons. Ty3 is also different from most other retroelements in that
transposition occurs close to the site of transcription initiation of
genes transcribed by RNA polymerase III (11). IN, the
subject of this investigation, is required for integration and is thus
a candidate for mediating position-specific integration.
Integration into the host genome is a critical step in the life cycle
of all retroelements. Integration of retroviruses and some
retroviruslike elements is preceded by the removal of two nucleotides
3' of a conserved CA dinucleotide at the viral DNA 3' ends (3'-end
processing) (6, 26, 42, 69). Integration is a concerted
reaction in which the newly exposed 3' hydroxyls of the viral DNA ends
attack the phosphodiester bonds in the host DNA, joining the 3' ends of
the viral DNA to host DNA (strand transfer) (6, 14, 23, 26).
The unpaired nucleotides at the 5' ends of the viral DNA are removed,
and the gaps are repaired.
Alignment of retroelement IN proteins shows poorly conserved amino- and
carboxyl-terminal regions flanking a conserved central region.
Approximately 20 residues within this region are absolutely conserved
among retroviral IN proteins, including residues contributing to a zinc
finger-like motif (HHCC) and to a D,D(35)E motif required for
divalent-metal cation binding in several classes of proteins involved
in polynucleotide transfer reactions (3, 10, 15, 20, 25, 39, 46,
51, 70). Mutations in the conserved residues disrupt retrovirus
replication in vivo (10, 21, 24, 53, 54, 59, 74, 75, 81,
82). In vitro assays with recombinant IN mutants and with IN
subdomains have been useful in dissecting the contributions of
subdomains to IN activity. Mutations in the metal finger and in the
D,D(35)E motif disrupt both 3'-end processing and strand transfer with
oligonucleotide substrates in vitro, showing that both motifs are
essential for IN activity and possibly long terminal repeat (LTR)
recognition (8, 9, 16-18, 20, 40, 46, 51, 55, 71, 77-79). However, a recombinant protein representing only the core region (without the zinc finger) is competent for disintegration, a reversal of the strand transfer reaction (8, 12). Mutations in the conserved residues of the catalytic triad D,D(35)E further abolish this
polynucleotidyl transfer activity in vitro, indicating that this domain
represents the catalytic site of IN (8, 9, 19, 20, 51, 55,
77). Not surprisingly, the core region is also implicated in DNA
binding and target site selection (22, 30, 38, 43, 44, 65,
73). UV cross-linking studies showed that lysine residues near
the active site specifically interact with the deoxyadenosine of the
conserved CA dinucleotide at the ends of viral DNA (38). In
addition, mutational analyses showed that the core domain recognizes
critical features in substrate DNA, such as the CA dinucleotide, the
unpaired 5'-end dinucleotide following end processing, and target DNA
flanking the site of viral DNA joining (30). In vitro strand
transfer experiments with IN chimeras between human immunodeficiency
virus type 1 (HIV-1) and feline immunodeficiency virus showed that
patterns of insertion site sequence bias correlated with the derivation
of the core domain (73). In addition to a role in DNA
binding, the core contributes to IN multimer formation. Two-hybrid,
mutational, and X-ray crystal analyses have shown that the core and
carboxyl-terminal domains mediate IN dimer formation (19, 37,
41).
The carboxyl-terminal domain of several retroviral IN proteins has been
shown to mediate nonspecific DNA binding (22, 43, 57, 64, 66, 76,
79, 83, 84). UV cross-linking studies showed that the
carboxyl-terminal domain of HIV-1 IN binds DNA nonspecifically in the
absence of divalent metal ions whereas the core requires metal ions to
bind specific substrate DNA used in the in vitro integration assay
(22, 66). The possible functions of nonspecific DNA binding
by IN include initial binding of IN to viral DNA prior to 3'-end
processing and integration, and interaction of IN with target DNA.
In particular retroelement systems, functions in addition to those
directly required for catalysis are performed by IN. In avian
sarcoma-leukosis viruses, the major species of RT in the virus is a
heterodimer, consisting of an RT subunit (
) and an RT-IN fusion
subunit (
) (13, 29, 32, 72). Recent studies have shown
that avian sarcoma virus IN (50), HIV-1 IN (28), and Ty1 IN (45, 63) contain functional nuclear localization signals (NLSs) located carboxyl-terminal to the core region. In the
case of the retroviral systems, it has been difficult to define the
physiological significance of the signal. Avian sarcoma virus is not
known to infect nondividing cells, the most obvious instance where
function of a signal could be detected. Although HIV infects nondividing cells, mutations in the HIV-1 NLS also disrupt replication in dividing cells, suggesting that the region plays a role in addition
to nuclear localization. HIV-1 IN participates in catalysis, reverse
transcription, and nuclear localization and is also one of the major
nucleus-localized components of the preintegration complex (7,
62). The extent to which it plays a structural role in organizing
the preintegration complex is not known.
Ty3 IN is also potentially complex with respect to its functions in the
Ty3 life cycle. Immunoblot analysis of Ty3 VLPs showed previously that
Ty3 IN is represented in three species, a 115-kDa RT-IN fusion and 61- and 58-kDa IN proteins (35, 48). Previous attempts to
mutagenize Ty3 IN by introducing small deletions into the
carboxyl-terminal domain resulted in VLPs that lacked DNA (49). This, together with the existence of an RT-IN fusion
protein, led to the hypothesis that Ty3 RT might be composed of an
-
heterodimer similar to the avian RTs and therefore that the Ty3 IN domain is essential for RT activity. In addition, because the nuclear membrane of yeast does not break down during the cell cycle,
nuclear localization might be mediated by Ty3 IN. The carboxyl-terminal nonconserved region of retroviral IN has been inferred to be involved in target DNA interactions. In comparison to the retroviral
carboxyl-terminal domains, the analogous Ty3 domain is larger and does
not show significant sequence similarity. If this domain in Ty3 IN is
involved in target interactions, it might interact with DNA or RNA
polymerase III transcription factors required for target association or both.
The present study was undertaken to investigate the functions of the
nonconserved amino- and carboxyl-terminal domains of Ty3 IN by using
charged-to-alanine scanning mutagenesis (4, 31). Twenty
positions were identified from amino acid positions 1 to 92 and
positions 412 to 536 where multiple charged amino acid residues were
present within a five-residue region and one to three amino acids in
each cluster were converted to alanines. The Ty3 mutants were analyzed
for transposition, particle formation, the presence of DNA in the
particle, in vitro RT activity, and 3'-end processing of the DNA. The
results showed that the nonconserved domains of Ty3 IN contribute
essential functions throughout the later stages of the Ty3 life cycle.
 |
MATERIALS AND METHODS |
Strains and culture conditions.
Escherichia coli and
S. cerevisiae strains were cultured and transformed by
standard methods (1). S. cerevisiae yTM443 (61) (previously referred to as TMy18) (MATa
trp1-H3 ura3-52 his3-
200 ade2-101 lys2-1 leu1-12 can1-100
Ty3 bar1::hisG GAL3+), a derivative
of yVB110 which contains no endogenous copies of Ty3 (34),
was used for transposition assays and whole-cell extract DNA and
protein analyses. VLP protein analysis was performed with yTM443 or
AGY-9 (MATa ura3-52 his4-539 lys2-801 trp1-
63 leu2-
1 spt3) (a gift from J. D. Boeke, The Johns Hopkins
University). AGY-9 transformed with plasmids expressing Ty3 was used
for production of VLPs for in vitro RT activity assays because the
mutation in SPT3 reduces Ty1 expression and therefore
eliminates the complication of non-Ty3 RT activity. E. coli
RZ1032 (lysA[61-62] thi-1 relA1 spoT1
dut-1 ung-1 [Tetr] supE44) was used for
production of single-stranded DNA for site-directed mutagenesis by the
method of Kunkel (52). Plasmids were amplified in HB101
(F
hsd-20 [rB
mB
] recA13 leuB6 ara-14 proA2
lacY1 galK2 rpsL20 [Smr] xyl-5 mtl-1
supE44 
).
Recombinant DNA manipulations.
All recombinant DNA
techniques were performed essentially as described in Current
Protocols in Molecular Biology (1). Ty3 elements,
modified by replacement of the regulatory region with sequences from
the GAL1-10 promoter, were used for transposition studies
and whole-cell extract and VLP analyses. Plasmid pEGTy3-1 (34), which was used in all experiments, contains a fusion
of the GAL1-10 upstream activator sequence upstream of the
Ty3 promoter. In addition, pEGTy3-1 contains the 2µm sequence for
maintenance at high copy number in S. cerevisiae and the
yeast selectable marker URA3, which allows cells containing
this plasmid to be selected for by growth on medium lacking uracil or
to be selected against on medium containing 5-fluoroorotic acid. The
target plasmid, pCH2bo19V (47), which was used in the
transposition assays, contains the ARS1 and CEN4
sequences for maintenance at low copy number in S. cerevisiae and the yeast selectable marker HIS3. Plasmid pEGTy3-1 was used for charged-to-alanine scanning mutagenesis of Ty3 IN. Nineteen oligonucleotides (364 to 371 and 373 to 383) (Table
1) were used to insert alanines in place
of two or three (oligonucleotide 374) charged amino acids within a
window of five residues in the nonconserved amino- and
carboxyl-terminal domains of IN spanning amino acid residues 1 to 92 and 412 to 536, respectively. Oligonucleotide 384 was used to change a
glutamate to an alanine residue at codon 519 in the polypurine tract of
IN. Mutants are referred to by the codon position of the first residue
in the mutagenized cluster of charged residues, followed by an A to
indicate a change to alanine and a number in parentheses to indicate
how many residues were changed in the respective cluster. Mutations in
pEGTy3-1 were confirmed by sequence analysis.
Transposition assays.
Quantitative plasmid-based suppressor
target assays were performed essentially as previously described
(47). The assay is based on expression of Ty3 under control
of the GAL1-10 promoter on a URA3-marked donor
plasmid (pEGTy3-1) and subsequent integration of the replicated Ty3
into a HIS3-marked target plasmid (pCH2bo19V). The target
plasmid contains two divergent tRNA genes. One of these acts to recruit
Ty3 to the target site. The other gene is a transcriptionally inactive
ochre suppressor tRNATyr gene (sup2-o), which is
activated by Ty3 integration into the target site. Transposition is
scored by suppression of the ade2-101 lys2-1 ochre nonsense
mutations in yeast strain yTM443. Suppression in cells that have
undergone transposition results in papillations on minimal medium
supplemented with leucine and tryptophan. YTM443 cells transformed with
pEGTy3-1, carrying wild-type Ty3 or 1 of the 20 mutant derivatives, and
the target plasmid pCH2bo19V were grown in raffinose-containing liquid
medium lacking uracil and histidine to select for cells containing
donor and target plasmids, respectively. Raffinose was used as the
carbon source to neither induce nor repress Ty3 expression. Cells were
grown to mid-log phase and washed, and 106 cells were
plated in duplicate or triplicate onto synthetic complete medium
containing galactose (SG) or glucose (SD) and lacking uracil and
histidine, in order to induce or repress Ty3 expression, respectively. The plates were incubated at 30°C for 29 h on SD medium or
48 h on SG medium, and the cells were replica plated to minimal
medium containing leucine and tryptophan. The plates were incubated at 30°C for 6 days, and transposition was scored as papillations. Quantitative transposition assays were performed at least twice with
one or two independent transformants for wild-type Ty3 and IN mutants.
In a qualitative patch assay for Ty3 transposition, independent
colonies containing yTM443 cells transformed with pEGTy3-1,
carrying a
wild-type Ty3 or a derivative carrying a mutant Ty3,
and pCH2bo19V were
patched onto SD medium lacking uracil and histidine.
The plate was
incubated at 30°C for 24 h, and the cells were replica
plated to
minimal medium containing leucine and tryptophan (data
not shown) and
to SG medium lacking uracil and histidine to induce
Ty3 transposition.
After 48 h (30°C) on SG medium, the patches
were replica plated
onto minimal medium containing leucine and
tryptophan and incubated at
30°C for 6 days. Transposition was
scored as papillations on minimal
medium containing leucine and
tryptophan.
To characterize Ty3 integration sites by nucleotide sequence analysis,
colonies were streaked onto medium containing 5-fluoroorotic
acid and
lacking histidine to select for cells that had lost the
URA3-marked donor plasmid but retained the
HIS3-marked target
plasmid. Target plasmids were isolated
from yeast by the method
of Hoffman and Winston (
36),
amplified in
E. coli, and prepared
for analysis by standard
methods (
58). Ty3 insertions into the
target were
characterized by sequence
analysis.
VLP preparation.
One-liter cultures of AGY-9 or yTM443 cells
transformed with pEGTy3-1, carrying a wild-type Ty3 or a derivative
carrying a mutant Ty3, were grown to late log phase in SG medium to
induce Ty3 expression. A mock VLP preparation was made with AGY-9 cells that were not transformed with the expression plasmid. VLPs were partially purified from whole-cell extracts as previously described (33). Briefly, the cells were harvested, washed in buffer,
digested with Zymolyase, lysed by vortexing with glass beads, and
fractionated over a 70%, 30%, and 20% (5, 5, and 15 ml,
respectively) sucrose step gradient by centrifugation in an SW28 rotor
at 83,000 × g for 3 h at 4°C. A total of 4 ml
from the 70%-30% interface of each gradient was collected and divided
into two portions. One portion (3 ml) was extracted with
phenol-chloroform-isoamyl alcohol (25:24:1), and the nucleic acid was
precipitated with ethanol and 0.3 M sodium acetate. The other portion
(1 ml) was concentrated by centrifugation in a Ti50 rotor at
100,000 × g for 1 h at 4°C and resuspended in
50 µl of buffer (9 mM HEPES [pH 7.8], 13.5 mM KCl, 4.5 mM
MgCl2, 10% glycerol). VLP nucleic acid was used for
analysis of Ty3 DNA 3' termini, and protein was used for RT immunoblot
analysis and RT activity assays.
Whole-cell extraction.
Cultures (10 ml) of yTM443 cells
transformed with pEGTy3-1 carrying a wild-type Ty3, or a derivative
carrying a mutant Ty3, were grown to an absorbance at 600 nm of ~1.0
in SG medium. The cultures were divided into two equal portions for
protein and nucleic acid extraction, and the cells were pelleted. One
portion was suspended in 600 µl of whole-cell extract buffer (0.1 mM
EDTA, 25 mM HEPES [pH 7.5], 50 mM KCl, 5 mM MgCl2, 10%
glycerol) containing 1 µg of leupeptin per ml, 1 µg of pepstatin A
per ml, and 1 mM phenylmethylsulfonyl fluoride. The cells were lysed by
being vortexed with glass beads at maximum speed for 15 s and
plunged into ice for 15 s. This was repeated five times. The
extract was centrifuged in an Eppendorf microcentrifuge (Brinkmann).
The supernatant was transferred to a new tube. The protein
concentration was determined by Bradford assay (5). The
other portion of the cell culture was suspended in 200 µl of
cell-breaking buffer (1 mM EDTA, 100 mM NaCl, 10 mM Tris [pH 8.0],
1% sodium dodecyl sulfate [SDS], 2% Triton X-100) and extracted
with phenol-chloroform-isoamyl alcohol (25:24:1) while being vortexed
with glass beads for 5 min at maximum speed. The nucleic acid in the
aqueous phase was precipitated with ethanol and 0.3 M sodium acetate.
DNA analysis.
The concentration of nucleic acid isolated
from whole-cell extracts was measured by monitoring the absorbance at
260 nm. To detect full-length, replicated DNA, 10 µg of total nucleic
acid was treated with 1 µg of RNase A and digested with 10 U of
BamHI in a total volume of 20 µl for 1 h at 37°C to
linearize the expression plasmid (pEGTy3-1). The samples were separated
on a 1% agarose gel by electrophoresis, transferred to nitrocellulose
(Duralon UV; Stratagene), immobilized by cross-linking with UV light in a Stratalinker 1800 (Stratagene), and probed with a Ty3
internal-domain-specific probe, produced by BglII-digestion
and labeled with [
-32P]dATP.
HindIII-digested lambda DNA served as DNA size markers.
Immunoblot analysis.
Proteins from whole-cell extracts or
VLPs were fractionated by SDS-polyacrylamide gel electrophoresis,
transferred electrophoretically to nitrocellulose membranes (Hybond
ECL; Amersham), and probed with antibody to CA or IN (61)
for whole-cell extract protein analysis or with antibody to RT (a
generous gift from T. M. Menees, University of Missouri, Kansas
City, Mo.) for VLP protein analysis. Secondary antibodies to rabbit
immunoglobulin G were detected by chemiluminescence, using the ECL
system as described by the manufacturer (Amersham).
RT assays.
VLPs were prepared as described above from AGY-9
cells expressing wild-type Ty3 or IN mutant Ty3 or from nontransformed
cells. Exogenous RT activity was measured under conditions optimized for Ty3 RT (33), with some modifications to the protocol
(60). A 10-µg portion of VLP protein for each sample was
mixed with 20 mM Tris (pH 7.8), 20 mM dithiothreitol, 15 mM
MgSO4, 4 U of RNasin, 10 µM cold dTTP (Pharmacia
Biotech), 1 µg of poly(rA) · p(dT)12-18
template-primer (Pharmacia Biotech), and 1 µCi of
[
-32P]dTTP (3000 Ci/mmol; Amersham) in a total
reaction volume of 60 µl and incubated at 25°C for 2 h. RT
activity was measured as the incorporation of
[
-32P]dTTP. The counts per minute (cpm) incorporated
was plotted as a function of time, with each datum point representing
the average of duplicate samples.
Southern analysis of VLP DNA.
To detect 3'-end processing of
Ty3 DNA, the plus-strand sequences in the U5 region of the LTR were
analyzed essentially as previously described (49). The
concentration of DNA isolated from VLP preparations was measured by
fluorometry with a TKO 100 DNA fluorometer (Hoefer Scientific
Instruments). We used 0.5 to 4 µg of VLP DNA for the experiment,
depending on the relative amount of Ty3 DNA available, as determined by
Southern analysis of whole-cell extract DNA. Thus, 0.5 µg of VLP DNA
was used for IN mutants with at least wild-type levels of DNA whereas 1 to 4 µg of VLP DNA was used for IN mutants with lower DNA levels to
detect 3'-end processing for these mutants. The VLP nucleic acid was
treated with RNase A, digested with HinfI, and separated on
an 8% polyacrylamide gel containing 6 M urea adjacent to a sequence
ladder representing the 3' terminus of Ty3 DNA (size ladder not shown).
The fragments were transferred onto a nylon membrane (GeneScreen;
DuPont), immobilized by UV cross-linking (as described above) and
baking at 80°C for 2 h, and subjected to Southern analysis with
32P-5'-end-labeled oligonucleotide 202 (5'TACGGGCTCGAGTAATCTCGGAGTGTCTTGACA3'; probe C).
Hybridization was performed with 2 × 106 cpm of
5'-end-labeled oligonucleotide at 50°C for 16 h. The blots were
washed and exposed to a PhosphorImager screen and analyzed with a
PhosphorImager (Molecular Dynamics). The experiment was performed at
least twice for IN mutants with near normal DNA levels, as determined
by Southern analysis of whole-cell extract DNA, and at least three
times for mutants with small amounts of DNA, with the exception of
499A(2), which was tested twice. For these mutants, increasing amounts
of VLP DNA were used in each additional experiment.
 |
RESULTS |
Mutations in nonconserved regions of Ty3 IN block Ty3
transposition.
To study the functions of distinct Ty3 IN domains,
mutagenesis was used to generate a panel of 20 IN mutants. To produce
less disruptive mutations, substitutions of alanine for one to three charged amino acids within a window of five residues were made in the
nonconserved amino- and carboxyl-terminal regions (Fig. 1 and Table 1). These regions were
defined as the amino-terminal domain upstream of the HHCC motif,
spanning amino acid residues 1 to 92, and the carboxyl-terminal domain
spanning residues 412 to 536. Eight mutations were made in the
amino-terminal domain, and 12 were made in the carboxyl-terminal
domain, including one in the polypurine tract. Twenty mutagenic
oligonucleotides were used to introduce the mutations by site-directed
mutagenesis, and the mutations were confirmed by sequence analysis.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
Ty3 IN amino acid sequence numbered from the
amino-terminal residue (48). Shaded residues indicate the
charged amino acid residues converted to alanine. The number above a
shaded residue indicates the position of the first amino acid within a
cluster of charged amino acid residues. These numbers are also used to
refer to the corresponding mutants. Amino acid residues that are highly
conserved among retroviruses and retroviruslike elements are indicated
by an asterisk (10, 51). There was no clear basis upon which
to distinguish the first and second histidines, which are each
indicated by an asterisk.
|
|
Previous studies showed that Ty3 elements with mutations in the
conserved D,D(35)E motif, as well as elements with carboxyl-terminal
truncations of Ty3 IN, failed to complement transposition of a
marked
donor in a genetic helper-donor transposition assay (
49).
In
this study, transposition of Ty3 IN mutants was monitored by
using both quantitative and qualitative versions of a plasmid-based
suppressor target assay (Fig.
2)
(
47). The assay is based on
the expression of a
transposition-competent Ty3 under control
of the
GAL1-10
promoter, carried on a
URA3-marked donor plasmid,
and its
transposition into a
HIS3-marked target plasmid. The target
plasmid contains two divergent tRNA genes,
sup2-o and
tDNA
Val. The tDNA
Val gene acts to recruit Ty3
to the target site. The
sup2-o gene
is a transcriptionally
inactive gene encoding an ochre suppressor
tRNA
Tyr.
Expression of this suppressor is activated by Ty3 integration
into the
target site. Ty3 wild-type and IN mutant strains were
grown on medium
containing galactose and lacking histidine and
uracil, to induce
transposition and select for Ty3 and target
plasmids, and then replica
plated to minimal medium containing
leucine and tryptophan. Under these
conditions, cells must be
Ade
+ and Lys
+ to
grow. Transposition was scored as papillations on the latter
medium,
resulting from suppression of the ochre nonsense markers,
ade2-101 lys2-1, in the host strain yTM443 (Fig.
2). A
quantitative
assay in which 10
6 cells were plated in
duplicate or triplicate onto SD or SG medium
lacking uracil and
histidine was performed. The mutants were tested
at least twice by
using one or two separate transformants. These
data are described in
Fig.
2A. An example of the qualitative patch
assay is shown in Fig.
2B;
these results were in good agreement
with those of the quantitative
assay. The polypurine tract mutant
519A(1) was the least affected, with
near wild-type levels of
transposition. Ty3 IN mutants 11A(2) and
43A(2) retained 60 to
90% of the transposition activity relative to
the wild type. Mutants
33A(2) and 69A(2) had 30 to 60% of the
transposition activity
compared to the wild type, and mutant 436A(2)
had 10 to 30% of
the transposition activity compared to the wild type.
Transposition
was indistinguishable from background for the majority
(14 of
20) of the IN mutants. Thus, in addition to the previously
characterized
D,D(35)E motif, charged residues in the nonconserved
amino- and
carboxyl-terminal domains of Ty3 IN are required for Ty3
position-specific
transposition.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 2.
Ty3 transposition assay. (A) Schematic diagram and
transposition activity of charged-to-alanine scanning Ty3 IN mutants.
The conserved HHCC zinc finger motif and the D,D(35)E motif are
indicated. The positions of the mutations in the 536-amino-acid protein
are indicated by lines. A quantitative plasmid-based suppressor target
assay was used to score transposition events for each of the Ty3 IN
mutants (see Materials and Methods). Transposition was scored by
suppression of the ade2-101 lys2-1 markers of yeast strain
yTM443 as papillations on minimal medium containing leucine and
tryptophan. Quantitative transposition assays were performed at least
twice with one or two independent transformants for wild-type Ty3 and
IN mutants. A comparison of transposition levels between each mutant
and the wild type (wt) is shown. (B) Qualitative assay for Ty3
transposition. Ty3 IN mutants were patched onto SD medium lacking
uracil and histidine to select for the donor and target plasmids,
respectively. The plate was incubated at 30°C for 24 h, and the
cells were replica plated to minimal medium containing leucine and
tryptophan (results not shown) and to SG lacking uracil and histidine
to induce Ty3 transposition. After 48 h at 30°C on SG, the
patches were replica plated onto minimal medium containing leucine and
tryptophan and incubated at 30°C for 6 days. Transposition was scored
as described in panel A.
|
|
It is not known whether disruption of Ty3 integration specificity
results in a default to no integration or relaxed specificity
of
integration. Therefore, it was of interest, even among this
set of
targeted integrants, to examine the accuracy of insertion.
Defects in
3'-end processing of Ty3 DNA or targeting of Ty3 could
potentially be
detected by sequence analysis of the transposed
element. Thus, a total
of 16 independent Ty3 insertions (1 to
3 insertions per Ty3 element)
into the target plasmid were recovered
and mapped for two wild-type Ty3
elements and the six Ty3 IN mutants
that retained transposition
activity (Fig.
3). A previous study
with
the same target and wild-type Ty3 elements showed that insertions
from
positions

16 to

20 relative to the tDNA
Val structural
sequence could be detected, with the majority (59%)
of insertions
occurring at position

19 (
47). In the present
study, the
two wild-type Ty3 insertions occurred at positions

17 and

21
relative to the tDNA
Val structural sequence. Fourteen
insertions of the mutant Ty3 elements
occurred at positions

17 and

19 relative to the tDNA
Val coding region; 13 of these
were at position

19 and were thus
similarly located to wild-type
insertions in the previous study.
Each of the 14 mutant insertions
displayed the characteristic
5-bp target repeats. The sequence of these
insertions suggests
that IN mutant elements inserted into the target do
not display
relaxed targeting.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Positions of Ty3 insertions recovered after selection
for suppressor tRNA gene expression. The structural coding sequences of
the divergent tRNA genes of the target plasmid and the 19-bp sequence
separating the genes are indicated. The positions and numbers of
independent integration events that were isolated at those positions
are represented by the arrowheads and height of the bars, respectively.
Two wild-type Ty3 insertions and 14 IN mutant insertions into the
target were rescued, with 1 to 3 insertions for each of the six
transposition-competent IN mutants [11A(2), 33A(2), 43A(2), 69A(2),
436A(2), and 519A(1)]. Wild-type Ty3 sequence (solid bars) begins at
positions 17 and 21 relative to tDNAVal, and IN mutant
Ty3 sequence (checked bars) begins at positions 17 and 19. The
dashed line demarcates the first base pair of the sup2-o
structural sequence.
|
|
Mutations in IN do not affect GAG3 protein synthesis or
assembly but can affect the stability and processing of the IN
domain.
Ty3 particles are composed primarily of protein derived
from the GAG3 reading frame. Nevertheless, stable particle
formation is dependent on PR activity and so requires Gag3-Pol3p fusion protein in addition to mature CA (48). To determine whether polyprotein processing was affected in the IN mutants, whole-cell extract isolated from cells expressing Ty3 was separated on an SDS-polyacrylamide gel and either stained with Coomassie blue (Fig.
4A), or transferred to nitrocellulose
membranes and subjected to immunoblot analysis with antibody to CA
(Fig. 4B) and IN (Fig. 4C). All 20 IN mutants had wild-type levels of
mature CA (26 kDa), indicating that polyprotein processing and VLP
assembly are not grossly affected in these mutants. Mature Ty3 IN
species (61 and 58 kDa) result from differential amino-terminal
processing (48). These are both visible only in VLP
preparations, but the 61-kDa IN species is the primary species detected
in the whole-cell extract samples (unpublished data). Based on the
results of several immunoblot analyses, none of the eight mutations in
the amino-terminal domain of Ty3 IN, proximal to the processing sites,
affected steady-state levels of mature 61 kDa IN protein. However, 3 of
the 12 mutations in the carboxyl-terminal domain [431A(2), 442A(2),
and 496A(2)] resulted in undetectable levels of mature IN and two
[477A(2) and 488A(2)] displayed a species that was smaller than 61 kDa and also present at lower levels than wild-type IN. Thus, mutations in nonconserved regions of Ty3 IN can affect IN processing and/or stability.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 4.
Immunoblot analysis of Ty3 proteins. (A) A 1-µg
portion of wild-type Ty3 VLP protein or 10 µg of whole-cell extract
isolated from yTM443 cells overexpressing wild-type Ty3 (WT) or IN
mutant Ty3 or from nontransformed cells (NTC) was separated on a
denaturing SDS-10% polyacrylamide gel and stained with Coomassie
blue. (B and C) Identical samples were transferred to nitrocellulose
(Hybond ECL; Amersham) and subjected to immunoblot analysis with a
polyclonal rabbit anti-CA immunoglobulin G antibody (B) or a polyclonal
rabbit anti-IN immunoglobulin G antibody (C). The positions of the
structural proteins p38 (38 kDa), p31 (31 kDa), and CA (26 kDa) and the
IN species (61 and 58 kDa [apparent only for VLP protein]) are
indicated on the left. The 115-kDa RT-IN fusion protein was not
detectable with anti-IN antibody on immunoblots of whole-cell
extracts.
|
|
Mutations in IN severely affect the amount of reverse-transcribed
DNA in vivo but do not completely disrupt RT activity in vitro.
Reverse transcription of Ty3 DNA requires maturation of Ty3 RT. A
previous study showed that even modest carboxyl-terminal truncations
(27 amino acids) of Ty3 IN severely reduced the amount of Ty3 DNA
present in vivo (49) but did not completely eliminate RT
activity in vitro. The predominant Ty3 extrachromosomal DNA species in
cells expressing wild-type or IN catalytic-site mutant Ty3 is the
linear, full-length 5.4-kb species. To examine whether Ty3
extrachromosomal DNA was affected for the IN mutants in this study,
nucleic acid was isolated from cells expressing Ty3, digested with
BamHI to linearize the vector carrying the Ty3 element, and subjected to Southern analysis with a probe to the internal (non-LTR) portion of Ty3 DNA (Fig. 5). Mutations in
both amino-terminal [20A(2) and 76A(2)] and carboxyl-terminal
[431A(2), 442A(2), 450A(2), and 496A(2)] domains of Ty3 IN resulted
in nearly undetectable amounts of reverse-transcribed DNA. Additional
mutants [53A(2), 62A(2), 453A(2), 477A(2), 488A(2), and 499A(2)] had
lower than wild-type levels of DNA. In contrast, mutants 43A(2),
419A(3), and 519A(1) consistently displayed higher than wild-type
levels of DNA. Although it might be anticipated that Ty3
extrachromosomal DNA would accumulate in the presence of mutations
blocking integration, this was not observed for the catalytic
site D,D(35)E mutant (49). As anticipated, Ty3 IN mutants
that were capable of transposition retained at least wild-type levels
of reverse-transcribed DNA. However, the transposition-deficient
mutants 412A(2) and 419A(3) also had at least wild-type levels of DNA,
suggesting that in these mutants, and possibly in others, transposition
was affected at a step after reverse transcription.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 5.
Southern blot analysis of nucleic acid from cells
expressing Ty3 IN mutants. A 10-µg sample of total nucleic acid
digested with BamHI was separated on a 1% agarose gel,
transferred to nitrocellulose (Duralon UV; Stratagene) and probed with
a 32P-labeled, BglII-digested DNA fragment
containing the internal (non-LTR) region of Ty3. The position of the
5.4-kb replicated, full-length, extrachromosomal linear Ty3 DNA is
indicated; the upper band represents the expression plasmid (P).
|
|
Decreased levels of VLP-associated Ty3 DNA could be attributable to
incorrectly processed or unstable Ty3 RT protein or to
inactive RT. Ty3
RT is not as reproducibly detectable as IN on
immunoblots with
whole-cell extracts. Therefore, to investigate
whether the replication
defect of the Ty3 IN mutants resulted
from aberrant processing or gross
instability of RT, VLPs were
isolated from cells expressing Ty3, as
described in Materials
and Methods. VLP proteins were separated on an
SDS-polyacrylamide
gel and subjected to immunoblot analysis with
antisera to RT (Fig.
6). Two forms of RT
have previously been detected by immunoblot
analysis, a 55-kDa species
and a 115-kDa RT-IN fusion protein
(
49). All IN mutants,
except 431A(2), had the mature 55-kDa
species of RT. Based on this and
other immunoblot analyses with
antisera to RT, mutants 431A(2),
442A(2), and 496A(2) lacked the
115-kDa RT-IN fusion protein. Mature IN
was also lacking in whole-cell
extracts for each of these mutants (Fig.
4C). This suggests that
the IN domain may have been destabilized by
these mutations. VLPs
from transposition-competent IN mutants, with
normal levels of
DNA, were not analyzed.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
Immunoblot analysis of VLP proteins from cells
expressing Ty3 IN mutants. VLPs were isolated from either AGY-9 or
yTM443 cells expressing wild-type Ty3 (WT) or IN mutant Ty3, or
fractions at the position of VLPs were taken from nontransformed cells
(NTC). AGY-9 cells were used as the source of VLPs for mutants 20A(2),
431A(2), 442A(2), 488A(2), and 496A(2), as well as for the
nontransformed cell control. YTM443 cells were used as the source of
VLPs for 53A(2), 62A(2), 76A(2), 412A(2), 419A(3), 450A(2), 453A(2),
477A(2), and 499A(2). Equal amounts of protein (~1.2 µg) were
separated on a denaturing SDS-10% polyacrylamide gel, transferred to
nitrocellulose (Hybond ECL; Amersham), and probed with a polyclonal
rabbit anti-RT immunoglobulin G antibody. The positions of the 55-kDa
RT and 115-kDa RT-IN fusion protein are indicated on the left.
|
|
Ty3 VLPs represent a heterogeneous collection of particles at different
stages of particle morphogenesis. Because of this,
the VLP fraction
contains both RNA and DNA and RT activity. To
determine whether
specific RT activity was affected by mutations
in IN, VLPs were
isolated from cells expressing Ty3 and used in
a standard exogenous RT
assay. RT activity was measured as the
incorporation of
[

-
32P]dTTP, using a poly(rA) · p(dT)
12-18 template-primer, as
described in Materials and
Methods. Incorporation was measured
at 0, 30, 60, and 120 min. The
wild-type VLP fraction displayed
a linear increase in incorporation
from 0 to 60 min. The RT activity
of the IN mutant VLP fractions ranged
from 22 to 55% of the activity
of the wild-type VLP fraction (Fig.
7). Five IN mutants with reduced
levels
of VLP-associated DNA, as determined by Southern analysis
of whole-cell
extract DNA, were analyzed. Ty3 RT activity was
severely diminished for
mutant 431A(2). This was not surprising,
since the 55-kDa RT protein
was not detectable by immunoblot analysis
(Fig.
6). Mutant 20A(2)
displayed both IN and RT proteins (Fig.
4C and
6, respectively) and
lacked replicated DNA in vivo. However,
it retained considerable RT
activity in vitro (Fig.
7). Mutants
442A(2), 488A(2), and 496A(2) had
aberrant patterns of IN (Fig.
4C). The mutants had wild-type levels of
55-kDa RT protein, but
442A(2) and 496A(2) lacked the 115-kDa RT-IN
fusion protein (Fig.
6). All three were replication defective in vivo
yet retained
significant RT activity in vitro (Fig.
7). Thus, residues
in the
nonconserved domains of Ty3 IN appear critical for reverse
transcription
in vivo and/or stability of full-length replicated Ty3
DNA within
the VLP, even when the 55-kDa RT species is present. In
contrast
to the absence of DNA in these VLPs, the level of RT activity
in vitro, with exogenous template and primer, was substantial.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7.
In vitro RT activity of Ty3 IN mutants. VLPs were
isolated from AGY-9 cells expressing wild-type Ty3 (wt) or IN mutant
Ty3, or fractions at the position of VLPs were taken from
non-transformed cells (NTC). A 10-µg portion of VLP protein was used
for each sample. RT activity was measured as the incorporation of
[ -32P]dTTP at 25°C, using a poly(rA) · p(dT)12-18 template-primer (Pharmacia). The cpm
incorporated was plotted as a function of time. Points represent
averages of duplicate samples differing at the most by 10%. This
activity assay was performed three times; the plot represents the
results of one such experiment.
|
|
Residues in the carboxyl-terminal domain of Ty3 IN are required for
3'-end processing of Ty3 DNA.
Full-length, replicated Ty3 DNA
contains two bases at each 3' end that are removed by IN in a reaction
termed 3'-end processing. In a previous study, residues of the
conserved D,D(35)E motif of Ty3 IN were shown to be absolutely required
for 3'-end processing activity (49). To examine whether
mutations in the nonconserved regions of Ty3 IN affected 3'-end
processing of Ty3 DNA, nucleic acid was extracted from sucrose gradient
fractions containing Ty3 VLPs and treated with RNase A and
HinfI. The resulting fragments were separated on a
denaturing polyacrylamide gel, as for sequencing, and transferred onto
a nylon membrane for Southern analysis. Probe C, which is complementary
to the U5 sequences at the 3' end of the plus strand, was used to
monitor the 3'-end processing event (Fig. 8,
top). Previous analysis of the
3'-terminal structure of Ty3 plus-strand DNA revealed a hybridization
pattern consisting of two distinct bands, representing the preprocessed
(146-nucleotide [nt]) and the processed (144-nt) forms of Ty3 DNA at
the U5 end of the LTR (49). A sequence ladder, representing
the 3'-terminal region of Ty3 DNA, served as a molecular standard for
determining the size of the 3'-end fragments (data not shown). In this
study, VLP DNA from wild-type Ty3 served as a positive control for the pattern of cleaved and uncleaved plus-strand ends (Fig. 8, lane WT);
DNA from a catalytic-site mutant (D225E, E261D), known to be defective
for 3'-end processing activity (49), was used as a negative
control (lane M). Uncut wild-type VLP DNA treated with RNase was used
as a control for the detection of any Ty3 fragments that were not a
result of HinfI digestion (lane UC). IN mutants with ample
amounts of DNA [11A(2), 33A(2), 43A(2), 69A(2), 412A(2), 419A(3),
436A(2), and 519A(1)] were tested at least twice; mutants with small
amounts of DNA [20A(2), 53A(2), 62A(2), 76A(2), 431A(2), 442A(2), 450A(2), 453A(2), 477A(2), 488A(2) and 496A(2)]
were tested at least three times, with the exception of 499A(2),
which was tested twice. Increasing amounts of VLP DNA were used in each additional experiment in an attempt to resolve whether 3'-end processing could occur in these mutants. DNA preparations from mutants
with amino-terminal Ty3 IN mutations [11A(2), 20A(2), 33A(2), 43A(2),
53A(2), 62A(2), 69A(2), and 76A(2)], as well as mutants 412A(2),
419A(3), 436A(2), 450A(2), and 519A(1), showed two prominent
bands (146 and 144 nt), similar to the wild-type pattern (Fig. 8).
Thus, these IN mutants were capable of 3'-end processing. Of these
mutants, 53A(2), 76A(2), and 450A(2), displayed a somewhat reduced
ratio of processed to unprocessed DNA compared to that of the wild
type. Although unprocessed DNA was detectable in VLPs from
four mutants with carboxyl-terminal IN mutations [453A(2),
477A(2), 488A(2), and 496A(2)], very little or no processed Ty3
DNA was detected, indicating that these mutants are defective for
3'-end processing. Of these mutants, 453A(2) displayed correctly processed IN (Fig. 4C) and RT (Fig. 6) proteins, as well as the 115-kDa
RT-IN species (Fig. 6). Because of the limited amount of DNA available
for evaluating mutants 431A(2), 442A(2), and 499A(2), it was difficult
to accurately determine the ratio of processed to unprocessed forms of
Ty3 DNA. Although mutant 499A(2) produced low but detectable levels of
DNA in vivo based on Southern analysis of whole-cell extracts (Fig. 5),
it is interesting that VLPs prepared from this mutant, in contrast to
several other mutants with low levels of DNA in that assay, contained
virtually no detectable DNA.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 8.
Detection of 3'-end processing of Ty3 DNA by Southern
analysis. A schematic diagram of Ty3 with the LTR regions U3, R, and U5
is shown at the top. VLP nucleic acid was isolated from cells
expressing wild-type Ty3 (WT) or IN mutant Ty3. The catalytic-site
double mutant (D225E, E261D) (lane M) was used as a control. VLP DNA,
at 0.5 to 4 µg depending on the availability of DNA, was digested
with HinfI or not digested for a WT DNA uncut control (UC),
and separated on an 8% polyacrylamide gel containing 6 M urea. A
sequence ladder (not shown) representing the 3' terminus of Ty3 DNA was
run in adjacent lanes to serve as a molecular standard for determining
the size of the Ty3 DNA fragments. The fragments were transferred onto
a nylon membrane (GeneScreen) for Southern analysis with a
32P-5'-end-labeled oligonucleotide, probe C, which is
complementary to plus-strand sequences in the U5 region of the LTR, as
indicated in the top panel. Predicted fragment sizes from
HinfI-digested Ty3 DNA are shown in the top panel, and
corresponding fragment sizes are indicated next to the blots, with the
146- and 144-nt species representing the 3' preprocessed and processed
Ty3 DNAs, respectively. The 158-nt species represents the
HinfI fragment from the 3' end of the plus-strand
strong-stop DNA extended into the tRNA minus-strand primer. The
composite of three blots shown on the left includes mutants for which
sufficient amounts of VLP DNA were available for analysis. The
composite blot on the right shows mutants with substantially smaller
amounts of VLP DNA. This group of mutants was tested at least three
times, with increasing amounts of DNA used in each experiment. The
contrast of this blot was computer enhanced to display faint bands.
|
|
 |
DISCUSSION |
The catalytic functions of retroelement IN have been defined by in
vitro assays of wild-type and mutant recombinant proteins. Despite the
success of these in vitro studies of recombinant IN protein and its
derivatives, understanding the multiple functions of IN in vivo in DNA
replication, uncoating, nuclear entry, and target access is ongoing. In
this respect, the Ty3 retrotransposon system offers certain advantages:
IN protein function can be assessed without a requirement for
infectivity; production of proteins is simple to assay; a linear form
of the DNA can be directly analyzed to assess 3'-end processing in
vivo; and, similar to HIV, nuclear targeting, presumably accompanied by
uncoating, is required for integration. In addition, if Ty3 IN is
directly involved in targeting, understanding Ty3 target specificity
may help to discriminate the roles of IN domains in donor and target association.
In the present study, the contributions of the nonconserved domains of
Ty3 IN in vivo were investigated at the stages of protein maturation,
particle assembly, DNA replication, 3'-end processing, and
transposition. Charged-to-alanine scanning mutagenesis was used
to dissect the functions of the nonconserved amino- and
carboxyl-terminal domains of the protein. Twenty Ty3 IN mutants
were assayed at multiple stages of the Ty3 life cycle. The results of
this study are summarized in Fig. 9.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 9.
Summary of charged-to-alanine scanning Ty3 IN mutant
phenotypes. Open boxes indicate Ty3 IN mutants with no detectable
defect or presumed defect at the corresponding step of the life cycle.
Shaded boxes indicate IN mutants with a slight defect. Solid boxes
indicate IN mutants with a severe defect at the step of the Ty3 life
cycle tested. Hatched boxes indicate IN mutants that could not be
definitively analyzed in the corresponding assay.
|
|
Transposition, as assayed by a plasmid-based suppressor target assay,
was abolished for 14 of the 20 IN mutants. This transposition assay
allows the recovery of insertions within a small window upstream of the
tRNA target gene. Ty3 insertions into the target plasmid were recovered
and mapped for the six IN mutants that retained transposition activity.
Although only a few integrants were assayed per mutant, these
insertions were distributed similarly to insertions of wild-type
elements. However, the suppressor target assay used in this study would
not have detected transpositions where targeting was
significantly relaxed or abolished. Therefore, mutants strongly
affected in targeting would have a transposition-negative phenotype if
they transposed nonspecifically.
Since the majority of the Ty3 IN mutants were severely affected for
transposition, all the mutants were investigated to assess whether
polyprotein processing and VLP assembly occurred. Immunoblot analysis
of whole-cell extracts with antibodies against Ty3 CA showed that all
the mutants were able to produce the mature, 26-kDa form of Ty3 CA
protein at levels similar to the levels of CA in cells expressing
wild-type Ty3. Unlike retroviruses, where accumulation of polyprotein
precursors and formation of immature particles occurs in host cells and
is observed in virions of PR mutants, only low levels of precursor
polyproteins are present in Ty3 PR mutants, suggesting that immature
particles are not stable (48). Thus, the normal amounts of
mature protein observed suggested that VLP assembly is not grossly
disturbed in the IN mutants and that Ty3 PR is active on properly
displayed protein substrates. Therefore, the transposition defects of
these mutants are more likely to involve downstream steps in Ty3 VLP
assembly, such as specific steps in Gag3-Pol3p protein maturation,
reverse transcription, 3'-end processing, uncoating, nuclear entry, or
targeting of the preintegration complex to the target site.
Ty3 IN maturation was examined by performing immunoblot analysis on
whole-cell extracts with antibodies to Ty3 IN. IN was correctly
processed in the majority of mutants. No mutations in the
amino-terminal region, proximal to the processing sites
(48), affected the amount or mass of the IN species
observed. Five mutants with changes in the carboxyl-terminal domain
were defective for IN, as evidenced by an undetectable amount of mature
IN or an aberrant pattern of IN-related protein. In four of these
mutants, the 55-kDa RT species was produced, suggesting that
amino-terminal processing of IN was probably not affected. The high
proportion of mutations directed at predicted surface residues that
apparently reduced IN stability suggests that the carboxyl-terminal IN
domain mediates intermolecular protein or DNA interactions important for IN folding or changes in conformation concomitant with reverse transcription or uncoating.
Previous studies showed that carboxyl-terminal deletions of Ty3 IN had
severe effects on DNA replication in vivo (49).
Similarly, the present study showed that point mutations in both
amino- and carboxyl-terminal domains affected the amount of
reverse-transcribed Ty3 DNA observed associated with VLPs. Data from
previous studies suggested that Ty3 RT is a heterodimer, composed of
RT-IN together with RT, such as the RT heterodimers of avian
retroviruses. The amino terminus of the 55-kDa protein was determined
by Edman degradation (48), and the size of this protein is
consistent with a carboxyl-terminal end located close to the amino
terminus of IN. This 55-kDa protein includes polymerase and RNase H
domains (48). The 115-kDa protein observed in immunoblot
analyses with antibody against RT and IN is of a size consistent with
inclusion of both the 55-kDa RT and 61-kDa IN domains. In addition,
mutations causing carboxyl-terminal truncation of IN resulted in
similarly truncated species derived from the 115-kDa protein
(49). These results, coupled with the low levels of DNA in
Ty3 mutants truncated in the carboxyl-terminal domain of IN, led to the
hypothesis that the Ty3 polymerase is an RT/RT-IN heterodimer. In the
present study, abnormally small amounts of particle-associated DNA were
also observed. Therefore, immunoblot analysis was performed with VLP
protein from transposition-deficient IN mutants to examine whether the
mutations in Ty3 IN affected the maturation of Ty3 RT and RT-IN. All
mutants, except 431A(2), displayed mature 55-kDa Ty3 RT protein. Not
surprisingly, the 115-kDa RT-IN fusion protein was absent in the three
mutants [431A(2), 442A(2), and 496A(2)] that also lacked mature IN.
Consistent with the heterodimer hypothesis, each mutant that lacked IN
was deficient for DNA. Despite this apparent correlation, a reduction
in the amount of DNA recovered was observed for roughly half of the IN mutants in our study, including several mutants that correctly processed both RT and IN. Formally, there are five possible
explanations of the DNA defects produced by mutations in IN (Fig.
10). These are not mutually exclusive
scenarios; thus, it is possible that the low DNA recovery in mutants
stems from more than one cause. IN could (i) be required for assembly
or activity of the reverse transcription initiation complex (Fig. 10A);
(ii) affect strand transfer, for example by modulating RNase H activity
(Fig. 10B); (iii) contribute a subdomain of a heterodimeric RT,
composed of RT and RT-IN (Fig. 10C); (iv) facilitate correct folding of
an RT-RT homodimer (Fig. 10D); or (v) stabilize Ty3 DNA within the VLP
(Fig. 10E).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 10.
Hypothetical functions of Ty3 IN during in vivo
replication. (A) Stabilization of the interaction between the initiator
tRNAMet primer and primer binding site. (B) Mediation of
primer/strong-stop strand transfer, possibly by modulation of RNase H
activity. (C) Component of the subdomain of heterodimeric RT. (D)
Chaperone for the RT-RT homodimer. (E) Stabilization of the
full-length, replicated DNA within the VLP. The bipartite
tRNAMet primer structure is shown schematically, according
to the model for Ty3 reverse transcription initiation by Gabus et al.
(27).
|
|
As indicated above, IN could be implicated at multiple stages in
the retroelement life cycle, several of which could affect the
presence of DNA in the preintegration complex. To determine whether the
IN domain is essential for polymerization activity of Ty3 RT, a
standard exogenous RT assay was performed. This showed that, except for
mutant 431A(2), Ty3 IN mutants with severely diminished amounts of
reverse-transcribed DNA in vivo displayed significant RT activity in
vitro. Thus, the 115-kDa species, including the nonconserved domains of
Ty3 IN, appeared not to be essential for RT activity on the exogenous
primer and template. This finding argues against the models in Fig. 10C
and D, where IN either is part of a heterodimeric RT or is necessary
for folding RT. It is possible that the exogenous assay is relatively
insensitive compared to in vivo replication, since the exogenous assay
could reflect the cumulative activity of multiple polymerase molecules present in the VLP. The exogenous assay would fail to distinguish defects in the interaction between the tRNAMet primer and
primer binding site (Fig. 10A) or at later steps in reverse
transcription initiation, including RNase H degradation of the template
RNA or primer/strong-stop strand transfer (Fig. 10B). These two roles
for IN could be required for reverse transcription in vivo but are
circumvented in an RT activity assay, where the template and primer are
supplied exogenously. Because of the low level of activity of wild-type
Ty3 VLPs in endogenous assays, it is difficult to directly test for
defects in endogenous activity of the mutant particles. The fifth
possibility involves IN, not in reverse transcription per se but in
stabilizing full-length replicated DNA after the completion of reverse
transcription (Fig. 10E). Because Ty3 DNA must be translocated into the
nucleus, a transition from a relatively large particle composed
primarily of Gag3-derived protein to a preintegration complex is deemed likely. By analogy to HIV-1, the preintegration complex may be composed
primarily of IN, RT, NC, and certain host factors (7, 62). A
structural role for IN in stabilizing the preintegration complex would
be consistent with preservation of RT activity in the IN mutants and
would also explain why VLPs of some mutants, in particular mutant
499A(2), appeared to contain very small or undetectable amounts of Ty3
DNA, although full-length DNA was detectable by Southern analysis of
whole-cell extract nucleic acid. If IN is required to stabilize Ty3
DNA, it can be argued that mutants that lack IN completely, in
particular 442A(2) and 496A(2), may be unable to form stable
preintegration complexes. Thus, the low-DNA phenotype in these mutants
would not be due to a defect in reverse transcription but, rather,
would be due to degradation of Ty3 DNA released from a defective
preintegration complex. This model could also explain the DNA-negative
phenotype of HIV-1 IN deletion mutants that have RT activity (10,
54). Interestingly, a Moloney murine leukemia virus mutant with a
portion of IN deleted was not affected for DNA levels (80).
Because Moloney murine leukemia virus is not transported into the
nucleus, IN may contribute less to the structure of the preintegration complex, and thus it is possible that the complex is correspondingly less sensitive to perturbations caused by defects in IN. In summary, it
is quite likely that different explanations are appropriate for
different Ty3 IN mutants with low levels of DNA. For example, mutants
that process IN correctly but have almost no detectable DNA [20A(2),
76A(2), and 450A(2)] may assemble preintegration complexes correctly
but be defective in reverse transcription. On the other hand, Ty3 IN
mutants that do not have detectable IN would be candidates for
defective preintegration complexes.
Still other mutants [11A(2), 33A(2), 43A(2), 69A(2), 412A(2),
419A(3), 436A(2), and 519A(1)] had levels of DNA
indistinguishable from those in the wild type and thus were affected in
transposition at stages downstream of DNA production. Candidate steps
in the life cycle would include uncoating, 3'-end processing, nuclear localization, and integration. Of these mutants, 412A(2) and 419A(3) were the most dramatically affected, with no detectable
transposition. Mutants 33A(2), 69A(2), and 436A(2) retained up to 60%
of their transposition activity compared to the wild type. The majority of Ty3 IN mutants produced ample amounts of DNA for 3'-end
analysis. Results from these experiments showed that mutants
453A(2), 477A(2), 488A(2), and 496A(2) were disrupted for 3'-end
processing, producing very little or no processed DNA species. In
addition, mutants with mutations in both amino- and carboxyl-terminal
domains of Ty3 IN [53A(2), 76A(2), and 450A(2)], which had diminished
levels of DNA, had reduced ratios of processed to preprocessed DNA
species. Although the amount of Ty3 DNA is reduced in cells expressing these mutants, the amount of IN is similar to that in the wild type for
mutants 53A(2), 76A(2), 450A(2), and 453A(2). Assuming that Ty3
particles contain one or a few DNA genomes, the concentration of DNA
within a particle should not be affected in these mutants. Thus, the
failure of processing to occur is likely to reflect a defect in
IN rather than in the levels of IN or substrate. For mutants
431A(2), 442A(2), and 499A(2), the amount of DNA recovered from the
VLPs was so small that it was difficult to reproducibly judge the
ratios of processed to unprocessed DNA species. Recombinant retroviral
IN core domain, with the amino- and carboxyl-terminal domains deleted,
can perform disintegration but not 3'-end processing in vitro (8,
17). Mutations in the zinc finger domain of retroviral IN
interfere with 3'-end processing and strand transfer (20, 55, 77,
78). Although the Ty3 IN zinc finger was not mutated, it is
possible that one or more of these mutations, for example the mutation
in 69A(2), affected its function. Based on the similarity of Ty3 and
retroviral IN core domains, we infer that these mutations either cause
the amino- or carboxyl-terminal region to interfere with catalysis or,
more probably disrupt association with the LTR.
Previous studies have failed to produce Ty3 IN mutants that are
defective for transposition but retain RT and IN 3'-end processing activity. In the present study, charged-to-alanine scanning mutagenesis of Ty3 IN was successfully used to create such mutants. The phenotypes of the IN mutants in this study are complex and suggest that IN participates in multiple aspects of the Ty3 life cycle (Fig. 9). Recent
studies with Ty3 IN mutants 412A(2) and 419A(3), which are completely
defective for transposition but display wild-type phenotypes at other
stages of the Ty3 life cycle, showed that these mutations in the
context of Ty3 IN fused to green fluorescent protein (GFP) disrupt the
localization of IN-GFP to the nucleus (56). These data
suggest that Ty3 IN contains an NLS located within the
carboxyl-terminal domain of IN, which, at least in part, is composed of
the mutated residues in IN mutants 412A(2) and 419A(3). Interestingly,
these mutations did not affect 3'-end processing activity. These
results do not rule out a role for this region in targeting, but they
suggest for the first time that VLPs or their derivatives do not
require association with the chromosomal target for 3'-end processing
to occur. Instead, Ty3 IN, at least in this case, displayed catalytic
activity in the cytoplasm, prior to nuclear entry of the preintegration
complex. This is similar to what is observed for retroviruses (62,
68), but it appears to be different from the case of the
site-specific element Tn7, which does not activate its
transposase until it is in the presence of the target DNA complex
(2). A subset of Ty3 IN mutants, in particular mutants
53A(2), 62A(2), and 69A(2) with mutations in the amino-terminal domain
and mutant 436A(2) with a mutation in the carboxyl-terminal domain,
produced and processed DNA, albeit at lower levels than in the wild
type for mutants 53A(2) and 62A(2). The mutations in 69A(2) and 436A(2) lie in the vicinity of the Ty3 IN zinc finger and putative NLS, respectively, and could thus interfere with the proper folding or
functions of these regions. Although the transposition deficiencies that we observed for these mutants could be attributable solely to the defects described above, it is possible that late steps of the
Ty3 life cycle are affected as well. Because the region immediately
surrounding mutations 412A(2) and 419A(3) appears sufficient to
localize GFP to the yeast cell nucleus (56), it is possible
that mutations outside this region affect a late step in the Ty3 life
cycle other than nuclear entry. Although targeting specificity is a
possible step that could have been affected, additional experiments are
required to determine whether any of the above mutants are defective
for targeting.
Studies of retroviral IN mutants in vivo have also shown pleiotropic
effects on viral replication, including mutants with defects in virion
morphology, polyprotein processing, and DNA synthesis and at post-DNA
synthesis stages (10, 21, 54, 59, 67, 75, 81). More
specifically, mutations in the zinc finger-like domain of HIV-1 IN were
found to severely affect DNA synthesis in the mutant virions, as
assayed by PCR, without affecting RT activity in vitro (54,
59). It is possible that these mutations affected the stability
of the replicated DNA, similarly to what is proposed here for the Ty3
IN mutants. Analysis of effects of point mutations in the
carboxyl-terminal region of HIV-1 identified two replication-defective
mutants with normal levels of DNA and IN activity in vitro, suggesting
that IN may be required for correct assembly and function of the
preintegration complex in vivo (54). These mutations may be
comparable to the late-acting mutations found in the present study.
In summary, the integrity of the Ty3 IN protein in the VLP is essential
for DNA production and integration. Our results also suggest that IN
plays a central role in the transition from an RNA to DNA genome and in
the changes required for both nuclear access and target presentation.
The mutants collected in this study can be used in epistasis studies to
further define the order of IN functions in the retroelement life cycle
and in suppression studies to identify cellular components that may
interact directly with IN at later stages of the life cycle.
 |
ACKNOWLEDGMENTS |
We thank T. M. Menees and W. E. Robinson for helpful discussions.
This work was supported by Public Health Service grant GM33281 to
S.B.S.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biological Chemistry, University of California, Irvine, 240D Med. Sci. I, Irvine, CA 92697-1700. Phone: (949) 824-7571. Fax: (949) 824-2688. E-mail: sbsandme{at}uci.edu.
 |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1998.
Current protocols in molecular biology.
Greene Publishing Associates/Wiley-Interscience, New York, N.Y.
|
| 2.
|
Bainton, R. J.,
K. M. Kubo,
J. Feng, and N. L. Craig.
1993.
Tn7 transposition: target DNA recognition is mediated by multiple Tn7-encoded proteins in a purified in vitro system.
Cell
72:931-943[Medline].
|
| 3.
|
Baker, T. A., and L. Luo.
1994.
Identification of residues in the Mu transposase essential for catalysis.
Proc. Natl. Acad. Sci. USA
91:6654-6658[Abstract/Free Full Text].
|
| 4.
|
Bass, S. H.,
M. G. Mulkerrin, and J. A. Wells.
1991.
A systematic mutational analysis of hormone-binding determinants in the human growth hormone receptor.
Proc. Natl. Acad. Sci. USA
88:4498-4502[Abstract/Free Full Text].
|
| 5.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding.
Anal. Biochem.
72:248-254[Medline].
|
| 6.
|
Brown, P. O.,
B. Bowerman,
H. E. Varmus, and J. M. Bishop.
1989.
Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein.
Proc. Natl. Acad. Sci. USA
86:2525-2529[Abstract/Free Full Text].
|
| 7.
|
Bukrinsky, M. I.,
N. Sharova,
T. L. McDonald,
T. Pushkarskaya,
W. G. Tarpley, and M. Stevenson.
1993.
Association of integrase, matrix, and reverse transcriptase antigens of human immunodeficiency virus type 1 with viral nucleic acids following acute infection.
Proc. Natl. Acad. Sci. USA
90:6125-6129[Abstract/Free Full Text].
|
| 8.
|
Bushman, F. D.,
A. Engelman,
I. Palmer,
P. Wingfield, and R. Craigie.
1993.
Domains of the integrase protein of human immunodeficiency virus type 1 responsible for polynucleotidyl transfer and zinc binding.
Proc. Natl. Acad. Sci. USA
90:3428-3432[Abstract/Free Full Text].
|
| 9.
|
Bushman, F. D., and B. Wang.
1994.
Rous sarcoma virus integrase protein: Mapping functions for catalysis and substrate binding.
J. Virol.
68:2215-2223[Abstract/Free Full Text].
|
| 10.
|
Cannon, P. M.,
W. Wilson,
E. Byles,
S. M. Kingsman, and A. J. Kingsman.
1994.
Human immunodeficiency virus type 1 integrase: effect on viral replication of mutations at highly conserved residues.
J. Virol.
68:4768-4775[Abstract/Free Full Text].
|
| 11.
|
Chalker, D. L., and S. B. Sandmeyer.
1992.
Ty3 integrates within the region of RNA polymerase III transcription initiation.
Genes Dev.
6:117-128[Abstract/Free Full Text].
|
| 12.
|
Chow, S. A.,
K. A. Vincent,
V. Ellison, and P. O. Brown.
1992.
Reversal of integration and DNA splicing mediated by integrase of human immunodeficiency virus.
Science
255:723-726[Abstract/Free Full Text].
|
| 13.
|
Copeland, T. D.,
D. P. Grandgenett, and S. Oroszlan.
1980.
Amino acid sequence analysis of reverse transcriptase subunits from avian myeloblastosis virus.
J. Virol.
36:115-119[Abstract/Free Full Text].
|
| 14.
|
Craigie, R.,
T. Fujiwara, and F. D. Bushman.
1990.
The IN protein of Moloney murine leukemia virus processes the viral DNA ends and accomplishes their integration in vitro.
Cell
62:829-837[Medline].
|
| 15.
|
Doak, T.,
F. Doerder,
C. Jahn, and G. Herrick.
1994.
A proposed superfamily of transposase genes: transposon-like elements in ciliated protozoa and a common "D35E" motif.
Proc. Natl. Acad. Sci. USA
91:942-946[Abstract/Free Full Text].
|
| 16.
|
Drelich, M.,
M. Haenggi, and J. Mous.
1993.
Conserved residues Pro-109 and Asp-116 are required for interaction of the human immunodeficiency virus type 1 integrase protein with its viral DNA substrate.
J. Virol.
67:5041-5044[Abstract/Free Full Text].
|
| 17.
|
Drelich, M.,
R. Wilhelm, and J. Mous.
1992.
Identification of amino acid residues critical for endonuclease and integrase activities of HIV-1 IN protein in vitro.
Virology
188:459-468[Medline].
|
| 18.
|
Ellison, V.,
J. Gerton,
K. A. Vincent, and P. O. Brown.
1995.
An essential interaction between distinct domains of HIV-1 integrase mediates assembly of the active multimer.
J. Biol. Chem.
270:3320-3326[Abstract/Free Full Text].
|
| 19.
|
Engelman, A.,
F. D. Bushman, and R. Craigie.
1993.
Identification of discrete functional domains of HIV-1 integrase and their organization within an active multimeric complex.
EMBO J.
12:3269-3275[Medline].
|
| 20.
|
Engelman, A., and R. Craigie.
1992.
Identification of conserved amino acid residues critical for human immunodeficiency virus type 1 integrase function in vitro.
J. Virol.
66:6361-6369[Abstract/Free Full Text].
|
| 21.
|
Engelman, A.,
G. Englund,
J. M. Orenstein,
M. A. Martin, and R. Craigie.
1995.
Multiple effects of mutations in human immunodeficiency virus type 1 integrase on viral replication.
J. Virol.
69:2729-2736[Abstract].
|
| 22.
|
Engelman, A.,
A. B. Hickman, and R. Craigie.
1994.
The core and carboxyl-terminal domains of the integrase protein of human immunodeficiency virus type 1 each contribute to nonspecific DNA binding.
J. Virol.
68:5911-5917[Abstract/Free Full Text].
|
| 23.
|
Engelman, A.,
K. Mizuuchi, and R. Craigie.
1991.
HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer.
Cell
67:1211-1221[Medline].
|
| 24.
|
Englund, G.,
T. S. Theodore,
E. O. Freed,
A. Engelman, and M. A. Martin.
1995.
Integration is required for productive infection of monocyte-derived macrophages by human immunodeficiency virus type 1.
J. Virol.
69:3216-3219[Abstract].
|
| 25.
|
Fayet, O.,
P. Ramond,
P. Polard,
M. F. Prere, and M. Chandler.
1990.
Functional similarities between retroviruses and the IS3 family of bacterial insertion sequences?
Mol. Microbiol.
4:1771-1777[Medline].
|
| 26.
|
Fujiwara, T., and K. Mizuuchi.
1988.
Retroviral DNA integration: structure of an integration intermediate.
Cell
54:497-504[Medline].
|
| 27.
|
Gabus, C.,
D. Ficheux,
M. Rau,
G. Keith,
S. Sandmeyer, and J.-L. Darlix.
1998.
The yeast Ty3 retrotransposon contains a 5'-3' bipartite primer binding site and encodes nucleocapsid protein NCp9 functionally homologous to HIV-1 NCp7.
EMBO J.,
17:4873-4880[Medline].
|
| 28.
|
Gallay, P.,
T. Hope,
D. Chin, and D. Trono.
1997.
HIV-1 infection of non-dividing cells through the recognition of integrase by the importin/karyopherin pathway.
Proc. Natl. Acad. Sci. USA
94:9825-9830[Abstract/Free Full Text].
|
| 29.
|
Gerard, G. F., and D. P. Grandgenett.
1980.
Retrovirus reverse transcriptase, p. 345-394.
Academic Press, Inc., New York, N.Y.
|
| 30.
|
Gerton, J. L., and P. O. Brown.
1997.
The core domain of HIV-1 integrase recognizes key features of its DNA substrates.
J. Biol. Chem.
272:25809-25815[Abstract/Free Full Text].
|
| 31.
|
Gibbs, C. S., and M. J. Zoller.
1991.
Rational scanning mutagenesis of a protein kinase identifies functional regions involved in catalysis and substrate interactions.
J. Biol. Chem.
266:8923-8931[Abstract/Free Full Text].
|
| 32.
|
Grandgenett, D.,
T. Quinn,
P. J. Hippenmeyer, and S. Oroszlan.
1985.
Structural characterization of the avian retrovirus reverse transcriptase and endonuclease domains.
J. Biol. Chem.
260:8243-8249[Abstract/Free Full Text].
|
| 33.
|
Hansen, L. J.,
D. L. Chalker,
K. J. Orlinsky, and S. B. Sandmeyer.
1992.
Ty3 GAG3 and POL3 genes encode the components of intracellular particles.
J. Virol.
66:1414-1424[Abstract/Free Full Text].
|
| 34.
|
Hansen, L. J.,
D. L. Chalker, and S. B. Sandmeyer.
1988.
Ty3, a yeast retrotransposon associated with tRNA genes, has homology to animal retroviruses.
Mol. Cell. Biol.
8:5245-5256[Abstract/Free Full Text].
|
| 35.
|
Hansen, L. J., and S. B. Sandmeyer.
1990.
Characterization of a transpositionally active Ty3 element and identification of the Ty3 integrase protein.
J. Virol.
64:2599-2607[Abstract/Free Full Text].
|
| 36.
|
Hoffman, C. S., and F. Winston.
1987.
A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli.
Gene
57:267-272[Medline].
|
| 37.
|
Jenkins, T. M.,
A. Engelman,
R. Ghirlando, and R. Craigie.
1996.
A soluble active mutant of HIV-1 integrase: involvement of both the core and carboxyl-terminal domains in multimerization.
J. Biol. Chem.
271:7712-7718[Abstract/Free Full Text].
|
| 38.
|
Jenkins, T. M.,
D. Esposito,
A. Engelman, and R. Craigie.
1997.
Critical contacts between HIV-1 integrase and viral DNA identified by structure-based analysis and photo-crosslinking.
EMBO J.
16:6849-6859[Medline].
|
| 39.
|
Johnson, M. S.,
M. A. McClure,
D.-F. Feng,
J. Gray, and R. F. Doolittle.
1986.
Computer analysis of retroviral pol genes: assignment of enzymatic functions to specific sequences and homologies with non-viral enzymes.
Proc. Natl. Acad. Sci. USA
83:7648-7652[Abstract/Free Full Text].
|
| 40.
|
Jonsson, C. B., and M. J. Roth.
1993.
Role of the His-Cys finger of Moloney murine leukemia virus integrase protein in integration and disintegration.
J. Virol.
67:5562-5571[Abstract/Free Full Text].
|
| 41.
|
Kalpana, G. V., and S. P. Goff.
1993.
Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.
Proc. Natl. Acad. Sci. USA
90:10593-10597[Abstract/Free Full Text].
|
| 42.
|
Katzman, M.,
R. A. Katz,
A. M. Skalka, and J. Leis.
1989.
The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration.
J. Virol.
63:5319-5327[Abstract/Free Full Text].
|
| 43.
|
Katzman, M.,
J. P. G. Mack,
A. M. Skalka, and J. Leis.
1991.
A covalent complex between retroviral integrase and nicked substrate DNA.
Proc. Natl. Acad. Sci. USA
88:4695-4699[Abstract/Free Full Text].
|
| 44.
|
Katzman, M., and M. Sudol.
1995.
Mapping domains of retroviral integrase responsible for viral DNA specificity and target site selection by analysis of chimeras between human immunodeficiency virus type 1 and visna virus integrases.
J. Virol.
69:5687-5696[Abstract].
|
| 45.
|
Kenna, M. A.,
C. Baker Brachmann,
S. E. Devine, and J. D. Boeke.
1998.
Invading the yeast nucleus: a nuclear localization signal at the C terminus of Ty1 integrase is required for transposition in vivo.
Mol. Cell. Biol.
18:1115-1124[Abstract/Free Full Text].
|
| 46.
|
Khan, E.,
J. P. Mack,
R. A. Katz,
J. Kulkosky, and A. M. Skalka.
1991.
Retroviral integrase domains: DNA binding and the recognition of LTR sequences.
Nucleic Acids Res.
19:851-860[Abstract/Free Full Text].
|
| 47.
|
Kinsey, P., and S. Sandmeyer.
1995.
Ty3 transposes in mating populations of yeast: a novel transposition assay for Ty3.
Genetics
139:81-94[Abstract].
|
| 48.
|
Kirchner, J., and S. B. Sandmeyer.
1993.
Proteolytic processing of Ty3 proteins is required for transposition.
J. Virol.
67:19-28[Abstract/Free Full Text].
|
| 49.
|
Kirchner, J., and S. B. Sandmeyer.
1996.
Ty3 integrase mutants defective in reverse transcription or 3' end processing of extrachromosomal Ty3 DNA.
J. Virol.
70:4737-4747[Abstract].
|
| 50.
|
Kukolj, G.,
K. S. Jones, and A. Skalka.
1997.
Subcellular localization of avian sarcoma virus and human immunodeficiency virus type 1 integrases.
J. Virol.
71:843-847[Abstract].
|
| 51.
|
Kulkosky, J.,
K. S. Jones,
R. A. Katz,
J. P. G. Mack, and A. M. Skalka.
1992.
Residues critical for retroviral integrative recombination in a region that is highly conserved among retroviral/retrotransposon integrases and bacterial insertion sequence transposases.
Mol. Cell. Biol.
12:2331-2338[Abstract/Free Full Text].
|
| 52.
|
Kunkel, T. A.
1985.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Proc. Natl. Acad. Sci. USA
82:488-492[Abstract/Free Full Text].
|
| 53.
|
LaFemina, R. L.,
C. L. Schneider,
H. L. Robbins,
P. L. Callahan,
K. LeGrow,
E. Roth,
W. A. Schleif, and E. A. Emini.
1992.
Requirement of active human immunodeficiency virus type 1 integrase enzyme for productive infection of human T-lymphoid cells.
J. Virol.
66:7414-7419[Abstract/Free Full Text].
|
| 54.
|
Leavitt, A. D.,
G. Robles,
N. Alesandro, and H. Varmus.
1996.
Human immunodeficiency virus type 1 integrase mutants retain in vitro integrase activity yet fail to integrate viral DNA efficiently during infection.
J. Virol.
70:721-728[Abstract].
|
| 55.
|
Leavitt, A. D.,
L. Shiue, and H. E. Varmus.
1993.
Site-directed mutagenesis of HIV-1 integrase demonstrates differential effects on integrase functions in vitro.
J. Biol. Chem.
268:2113-2119[Abstract/Free Full Text].
|
| 56.
| Lin, S. S., and S. B. Sandmeyer.
Unpublished data.
|
| 57.
|
Lodi, P. J.,
J. A. Ernst,
J. Kuszewski,
A. B. Hickman,
A. Engelman,
R. Craigie,
G. M. Clore, and A. M. Gronenborn.
1995.
Solution structure of the DNA binding domain of HIV-1 integrase.
Biochemistry
34:9826-9833[Medline].
|
| 58.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1989.
Molecular cloning a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 59.
|
Masuda, T.,
V. Planelles,
P. Krogstad, and I. S. Chen.
1995.
Genetic analysis of human immunodeficiency virus type 1 integrase and the U3 att site: unusual phenotype of mutants in the zinc finger-like domain.
J. Virol.
69:6687-6696[Abstract].
|
| 60.
| Menees, T. M. Personal communication.
|
| 61.
|
Menees, T. M., and S. B. Sandmeyer.
1994.
Transposition of the yeast retroviruslike element Ty3 is dependent on the cell cycle.
Mol. Cell. Biol.
14:8229-8340[Abstract/Free Full Text].
|
| 62.
|
Miller, M. D.,
C. M. Farnet, and F. D. Bushman.
1997.
Human immunodeficiency virus type 1 preintegration complexes: studies of organization and composition.
J. Virol.
71:5382-5390[Abstract].
|
| 63.
|
Moore, S. P.,
L. A. Rinckel, and D. J. Garfinkel.
1998.
A Ty1 integrase nuclear localization signal required for retrotransposition.
Mol. Cell. Biol.
18:1105-1114[Abstract/Free Full Text].
|
| 64.
|
Mumm, S. R., and D. P. Grandgenett.
1991.
Defining nucleic acid-binding properties of avian retrovirus integrase by deletion analysis.
J. Virol.
65:1160-1167[Abstract/Free Full Text].
|
| 65.
|
Pahl, A., and R. M. Flugel.
1995.
Characterization of the human spuma retrovirus integrase by site-directed mutagenesis, by complementation analysis, and by swapping the zinc finger domain of HIV-1.
J. Biol. Chem.
270:2957-2966[Abstract/Free Full Text].
|
| 66.
|
Puras Lutzke, R. A.,
C. Vink, and R. H. A. Plasterk.
1994.
Characterization of the minimal DNA-binding domain of the HIV integrase protein.
Nucleic Acids Res.
22:4125-4131[Abstract/Free Full Text].
|
| 67.
|
Reicin, A. S.,
S. Paik,
R. D. Berkowitz,
J. Luban,
I. Lowy, and S. Goff.
1995.
Linker insertion mutations in the human immunodeficiency virus type 1 gag gene: effects on virion particle assembly, release, and infectivity.
J. Virol.
69:642-650[Abstract].
|
| 68.
|
Roe, T.,
S. A. Chow, and P. O. Brown.
1997.
3'-End processing and kinetics of 5'-end joining during retroviral integration in vivo.
J. Virol.
71:1334-1340[Abstract].
|
| 69.
|
Roth, M. J.,
P. L. Schwartzberg, and S. P. Goff.
1989.
Structure of the termini of DNA intermediates in the integration of retroviral DNA: dependence on IN function and terminal DNA sequence.
Cell
58:47-54[Medline].
|
| 70.
|
Rowland, S. J., and K. G. Dyke.
1990.
Tn552, a novel transposable element from Staphylococcus aureus.
Mol. Microbiol.
4:961-975[Medline].
|
| 71.
|
Schauer, M., and A. Billich.
1992.
The N-terminal region of HIV-1 integrase is required for integration activity, but not for DNA binding.
Biochem. Biophys. Res. Commun.
185:874-880[Medline].
|
| 72.
|
Schiff, R. D., and D. P. Grandgenett.
1978.
Virus-coded origin of a 32,000-dalton protein from avian retrovirus cores:structural relatedness of p32 and the beta polypeptide of the avian retrovirus DNA polymerase.
J. Virol.
28:279-291[Abstract/Free Full Text].
|
| 73.
|
Shibagaki, Y., and S. A. Chow.
1997.
Central core domain of retroviral integrase is responsible for target site selection.
J. Biol. Chem.
272:8361-8369[Abstract/Free Full Text].
|
| 74.
|
Shin, C.-G.,
B. Taddeo,
W. A. Haseltine, and C. M. Farnet.
1994.
Genetic analysis of the human immunodeficiency virus type 1 integrase protein.
J. Virol.
68:1633-1642[Abstract/Free Full Text].
|
| 75.
|
Taddeo, B.,
W. A. Haseltine, and C. M. Farnet.
1994.
Integrase mutants of human immunodeficiency virus type 1 with a specific defect in integration.
J. Virol.
68:8401-8405[Abstract/Free Full Text].
|
| 76.
|
van Gent, D. C.,
Y. Elgersma,
M. W. J. Bolk,
C. Vink, and R. H. A. Plasterk.
1991.
DNA binding properties of the integrase proteins of human immunodeficiency viruses types 1 and 2.
Nucleic Acids Res.
19:3821-3837[Abstract/Free Full Text].
|
| 77.
|
van Gent, D. C.,
A. A. M. Oude Groeneger, and R. H. A. Plasterk.
1992.
Mutational analysis of the integrase protein of human immunodeficiency virus type 2.
Proc. Natl. Acad. Sci. USA
89:9598-9602[Abstract/Free Full Text].
|
| 78.
|
Vincent, K. A.,
V. Ellison,
S. A. Chow, and P. O. Brown.
1993.
Characterization of human immunodeficiency virus type 1 integrase expressed in Escherichia coli and analysis of variants with amino-terminal mutations.
J. Virol.
67:425-437[Abstract/Free Full Text].
|
| 79.
|
Vink, C.,
A. A. M. Oude Groeneger, and R. H. A. Plasterk.
1993.
Identification of the catalytic and DNA-binding region of the human immunodeficiency virus type 1 integrase protein.
Nucleic Acids Res.
21:1419-1425[Abstract/Free Full Text].
|
| 80.
|
Wei, S.-Q.,
K. Mizuuchi, and R. Craigie.
1997.
A large nucleoprotein assembly at the ends of the viral DNA mediates retroviral DNA integration.
EMBO J.
16:7511-7520[Medline].
|
| 81.
|
Wiskerchen, M., and M. A. Muesing.
1995.
Human immunodeficiency virus type 1 integrase: effects of mutations on viral ability to integrate, direct viral gene expression from unintegrated viral DNA templates, and sustain viral propagation in primary cells.
J. Virol.
69:376-386[Abstract].
|
| 82.
|
Wiskerchen, M., and M. A. Muesing.
1995.
Identification and characterization of a temperature-sensitive mutant of human immunodeficiency virus type 1 by alanine scanning mutagenesis of the integrase gene.
J. Virol.
69:597-601[Abstract].
|
| 83.
|
Woerner, A. M.,
M. Klutch,
J. G. Levin, and C. J. Marcus-Sekura.
1992.
Localization of DNA binding activity of HIV-1 integrase to the C-terminal half of the protein.
AIDS Res. Hum. Retroviruses
8:297-304[Medline].
|
| 84.
|
Woerner, A. M., and C. J. Marcus-Sekura.
1993.
Characterization of a DNA binding domain in the C-terminus of HIV-1 integrase by deletion mutagenesis.
Nucleic Acids Res.
21:3507-3511[Abstract/Free Full Text].
|
Journal of Virology, January 1999, p. 453-465, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Atwood-Moore, A., Yan, K., Judson, R. L., Levin, H. L.
(2006). The Self Primer of the Long Terminal Repeat Retrotransposon Tf1 Is Not Removed during Reverse Transcription.. J. Virol.
80: 8267-8270
[Abstract]
[Full Text]
-
Wilhelm, M., Wilhelm, F.-X.
(2005). Role of Integrase in Reverse Transcription of the Saccharomyces cerevisiae Retrotransposon Ty1. Eukaryot Cell
4: 1057-1065
[Abstract]
[Full Text]
-
Gorinsek, B., Gubensek, F., Kordis, D.
(2004). Evolutionary Genomics of Chromoviruses in Eukaryotes. Mol Biol Evol
21: 781-798
[Abstract]
[Full Text]
-
Padow, M., Lai, L., Deivanayagam, C., DeLucas, L. J., Weiss, R. B., Dunn, D. M., Wu, X., Kappes, J. C.
(2003). Replication of Chimeric Human Immunodeficiency Virus Type 1 (HIV-1) Containing HIV-2 Integrase (IN): Naturally Selected Mutations in IN Augment DNA Synthesis. J. Virol.
77: 11050-11059
[Abstract]
[Full Text]
-
Lener, D., Budihas, S. R., Le Grice, S. F. J.
(2002). Mutating Conserved Residues in the Ribonuclease H Domain of Ty3 Reverse Transcriptase Affects Specialized Cleavage Events. J. Biol. Chem.
277: 26486-26495
[Abstract]
[Full Text]
-
Nymark-McMahon, M. H., Beliakova-Bethell, N. S., Darlix, J.-L., Le Grice, S. F. J., Sandmeyer, S. B.
(2002). Ty3 Integrase Is Required for Initiation of Reverse Transcription. J. Virol.
76: 2804-2816
[Abstract]
[Full Text]
-
Lai, L., Liu, H., Wu, X., Kappes, J. C.
(2001). Moloney Murine Leukemia Virus Integrase Protein Augments Viral DNA Synthesis in Infected Cells. J. Virol.
75: 11365-11372
[Abstract]
[Full Text]
-
Lin, S. S., Nymark-McMahon, M. H., Yieh, L., Sandmeyer, S. B.
(2001). Integrase Mediates Nuclear Localization of Ty3. Mol. Cell. Biol.
21: 7826-7838
[Abstract]
[Full Text]
-
Aye, M., Dildine, S. L., Claypool, J. A., Jourdain, S., Sandmeyer, S. B.
(2001). A Truncation Mutant of the 95-Kilodalton Subunit of Transcription Factor IIIC Reveals Asymmetry in Ty3 Integration. Mol. Cell. Biol.
21: 7839-7851
[Abstract]
[Full Text]
-
Rausch, J. W., Grice, M. K. B.-L., Henrietta, M., Nymark-McMahon, , Miller, J. T., Le Grice, S. F. J.
(2000). Interaction of p55 Reverse Transcriptase from the Saccharomyces cerevisiae Retrotransposon Ty3 with Conformationally Distinct Nucleic Acid Duplexes. J. Biol. Chem.
275: 13879-13887
[Abstract]
[Full Text]
-
Malik, H. S., Eickbush, T. H.
(1999). Modular Evolution of the Integrase Domain in the Ty3/Gypsy Class of LTR Retrotransposons. J. Virol.
73: 5186-5190
[Abstract]
[Full Text]