Previous Article | Next Article 
Journal of Virology, January 1999, p. 343-351, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Two Nucleotides Immediately Upstream of the
Essential A6G3 Slippery Sequence Modulate the
Pattern of G Insertions during Sendai Virus mRNA Editing
Stéphane
Hausmann,
Dominique
Garcin,
Anne-Sophie
Morel, and
Daniel
Kolakofsky*
Department of Genetics and Microbiology,
University of Geneva School of Medicine, CH1211 Geneva, Switzerland
Received 11 May 1998/Accepted 25 September 1998
 |
ABSTRACT |
Editing of paramyxovirus P gene mRNAs occurs cotranscriptionally
and functions to fuse an alternate downstream open reading frame to the
N-terminal half of the P protein. G residues are inserted into a short
G run contained within a larger purine run (AnGn) in this process,
by a mechanism whereby the transcribing polymerase stutters (i.e.,
reads the same template cytosine more than once). Although Sendai virus
(SeV) and bovine parainfluenza virus type 3 (bPIV3) are closely
related, the G insertions in their P mRNAs are distributed
differently. SeV predominantly inserts a single G residue within the G
run of the sequence 5' AACAAAAAAGGG, whereas
bPIV3 inserts one to six G's at roughly equal frequency within the
sequence 5' AUUAAAAAAGGGG
(differences are underlined). We have examined how the
cis-acting editing sequence determines the number of G's
inserted, both in a transfected cell system using minigenome analogues
and by generating recombinant viruses. We found that the presence of
four rather than three G's in the purine run did not affect the
distribution of G insertions. However, when the underlined AC of the
SeV sequence was replaced by the UU found in bPIV3, the editing
phenotype from both the minigenome and the recombinant virus resembled
that found in natural bPIV3 infections (i.e., a significant fraction of
the mRNAs contained two to six G insertions). The two nucleotides
located just upstream of the polypurine tract are thus key determinants
of the editing phenotype of these viruses. Moreover, the minimum number
of A residues that will promote SeV editing phenotype is six but can be
reduced to five when the upstream AC is replaced by UU. A model for how
the upstream dinucleotide controls the insertion phenotype is presented.
 |
INTRODUCTION |
Sendai virus (SeV), a prototype
paramyxovirus, contains a nonsegmented negative-strand RNA genome. This
genome RNA of 15,384 nucleotides (nt) is found in a helical
nucleocapsid core assembled with a predicted 2,564 copies of the N
protein (i.e., if there is but one N subunit per 6 nt, the rule of six
[2a]), to which ca. 300 copies of the P
(phosphoprotein) and ca. 50 copies of the L (large) protein are bound.
Paramyxovirus genomes serve as templates for both monocistronic mRNAs
and a full-length complementary antigenome strand, the intermediate in
genome replication. The nucleocapsid core can carry out mRNA synthesis
in vitro, and when it is provided with unassembled N protein, genome
replication also takes place. The synthesis of both genomes and
antigenomes is coupled to their assembly, and they are consequently
found only as nucleocapsids assembled with N protein (reviewed in
reference 22).
Six mRNAs (in the order N, P, M, F, HN, and L) are transcribed from the
N RNA genome by the P-L polymerase. All of these viral mRNAs except the
P-gene mRNA express a single primary translation product from a single
open reading frame (ORF). The paramyxovirus P gene mRNAs, in contrast,
generally contain alternate ORFs that overlap the N terminus as well as
the middle region of the P-protein ORF, and they express several
proteins. For SeV, the C-protein ORF overlaps the N-terminal region of
the P ORF and is accessed via ribosomal choice during translational
initiation (8) (Fig. 1a). The
highly conserved, cysteine-rich V ORF which overlaps the middle of the
P ORF, on the other hand, is accessed by a mechanism involving
transcriptional choice, i.e., cotranscriptional mRNA editing (3,
29-31).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
(a) Schematic representation of the paramyxovirus P-gene
mRNAs. The mRNAs are indicated as horizontal lines, and the ORFs are
represented as boxes. For each virus group, the upper line shows the
mRNA which is an exact copy of the gene, and the beginning of the ORF
box indicates the ribosomal start codon. When more than one ORF box is
attached to the line, the ORFs are accessed by alternate initiation
codons. The boxes below indicate alternate downstream ORFs which are
fused into place by G insertions in the mRNAs. The positions of the
insertions are shown by the dotted vertical lines. The three possible
ORFs are indicated by differences in shading. (b) Comparison of
paramyxovirus editing sites. The sequences are written as
positive-strand RNA, 5' to 3', and are grouped into the three genera of
the Paramyxovirinae. Spaces have been introduced to
emphasize the different elements of the sequence. The short G run which
is expanded on mRNA editing is shown on the right, together with the
pattern of G insertions which occurs for each group (dotted brackets).
Note that the A run which precedes the G run is the only part of this
cis-acting sequence which is strictly conserved according to
genera. Also note that the second A residue upstream of the rubulavirus
G run is replaced by a G (highlighted with rectangle), which presumably
accounts for why rubulaviruses insert a minimum of two G residues when
stuttering begins (19, 31). The shaded boxes indicate
sequence conservations. When the highlighted AC is changed to UU as in
the other respiroviruses, SeV edits its mRNA with multiple G
insertions, like PIV3.
|
|
The subfamily Paramyxovirinae is organized in three genera:
respiroviruses (formerly the Paramyxovirus genus), including
SeV and bovine parainfluenza virus type 3 (bPIV3); morbilliviruses (e.g., measles and distemper viruses); and rubulaviruses (e.g., mumps
virus and simian virus 5). Most of these viral P genes contain an
AnGn purine run at the
start of the internal, overlapping V ORF (Fig. 1b). mRNAs with expanded
G runs are transcribed from these genes in addition to those which are
faithful copies of their templates, and the number of G insertions
which occur for each virus group mirrors their requirements to switch
between the in-frame and out-of-frame ORFs (reviewed in reference
19). For the morbilliviruses and SeV, which require
a +1 frameshift to access the V ORF from the genome-encoded P ORF, a
single G is added as the predominant insertional event (Fig. 1a). For
the rubulaviruses, which require a +2 frameshift to access the
remainder of the P ORF from the genome-encoded V ORF, two G's are
added at high frequency when insertions occur. For bPIV3, where both V
and another ORF (called D) overlap the middle of the genome-encoded P
ORF, one to six G's are added at roughly equal frequency, so that
mRNAs encoding all three overlapping ORFs are expressed. Although the
available evidence suggests that these Gs are added cotranscriptionally, the term "mRNA editing" has nevertheless been
retained to describe these events. RNA editing is defined here as a
process in which nucleotide insertion, deletion, or base substitution
produces an RNA whose sequence (and informational capacity) differs
from that of its template, other than by splicing and by 5' and 3' end
formation (1, 4).
Paramyxovirus mRNAs are made in the cytoplasm, and these viruses
consequently must fend for themselves in all aspects of mRNA synthesis.
All negative-strand virus RNA polymerases (RNAPs) which polyadenylate
their mRNAs are thought to do so by stuttering on a short run of
template U residues (4 to 7 nt long), and it was this observation that
first suggested that the G insertions would similarly occur by
pseudo-templated transcription (3, 17, 29). Paramyxovirus
mRNA editing is thought to take place as follows (see Fig. 7a): (i) the
viral polymerase is postulated to pause before the end of the template
C run (nt 1051 to 1053); (ii) the nascent chain, whose 3' end is base
paired to the template, slips backward by one (SeV and morbilliviruses)
or two (rubulaviruses) template positions (Fig. 1); and (iii) as a
result, one or two of the template C residues are copied a second time
when transcription resumes processively. In the realignment of nascent
mRNA and template, U:G (but not A:C) pairs are permitted, and in
analogy to ribosomal frameshifting, the region where alternate base
pairing occurs after realignment is called the slippery sequence
(2, 16, 33). For most viruses, this cycle of slippage and
pseudo-templated synthesis occurs only once, but for bPIV3 it is
postulated to occur repeatedly, generating a range of multiple G
insertions. The presence of a counting mechanism has therefore been
invoked to explain these different patterns of G insertions
(26).
The replacement of the SeV editing region with that of bPIV3 in a SeV
minigenome leads to mRNAs with G insertions whose distribution resembles those found in bPIV3 infections (18). The counting mechanism is thus apparently controlled in large part by a
cis-acting sequence. Here we report experiments which show
that these controlling sequences lie immediately upstream of the
slippery A6G3 purine run and propose a model to
account for the counting mechanism.
 |
MATERIALS AND METHODS |
Construction of minigenomes.
Construction of the internal
deletion SeV minigenome (SH22) is described in reference
15. Briefly, pSH22 is based on pSP65, with the
minigenome inserted directly downstream of the T7 promoter and carrying
the hepatitis delta virus genomic ribozyme directly after the
minigenome. Each minigenome contains 423 nt of the 5' trailer/L-gene region of SeV, a 54-nt polylinker region into which the
103-nt SeV editing cassette has been inserted between EcoRI and XbaI sites, and 146 nt of the 3' end of the SeV
negative-strand genome including the leader/N-gene region.
The A
6G
1-5 series was constructed by inserting
the respective P cassettes in place of the corresponding
Xba-SeV-
EcoRI
fragment of SH22 derivatives. To
maintain hexamer length, 8 to
13 nt were inserted into the polylinker
region (
15). The A
6G
1-5 cassettes
were obtained by PCR amplification from pGEM-P
HA with
primers A
6G
1 (5'
GACTCTAGAGAGCGACTCAACAAAAAAA
GCATAGGAGAG),
A
6G
2, A
6G
4, and
A
6G
5 (identical to A
6G
1
except for the number
of G's at the underlined position), and PEcoP
(5' GGGCACGTCTTGCAAACAC).
The PCR products were then
digested with
Xba and
EcoRI and introduced
in the
corresponding SH22
derivatives.
The Swap series was constructed as described above, using for PCR
the primers Swap8 (5'
GACTCTAGAGAGC
AGGGAATTAAAAAAGGG),
Swap5 (5'
GACTCTAGAGAGCGAC
GAATTAAAAAAAGGG), and Swap2 (5'
GACTCTAGAGAGCGACTCA
TTAAAAAAGGG).
Minigenome expression and direct limited primer extension of the
mini-mRNAs.
The various minigenomes and the SeV N, P, and L genes
were expressed in A549 cells basically as described elsewhere (6, 18). The cells were grown as monolayers in 9-cm-diameter dishes and infected at 2 to 5 PFU/cell with a vaccinia virus expressing T7 RNA
polymerase (vTF7-3 [11]). At 1 h
postinfection (hpi), the medium was replaced with a transfection
mix composed of 20 µl of home-made transfectACE, pGEM-L (1 µg), pGEM-hPIV1-N (2.5 µg), pGEM-HA P
30 (2.5 µg),
pGEM-mini-genome (5 µg), and minimal essential medium to 1 ml. After
2 h at 33°C, an extra 6 ml of minimal essential medium was added
and the cells were incubated for 40 h before harvesting. After
removal of medium, the cells were solubilized and scrapped into 150 mM
NaCl-50 mM Tris (pH 7.4)-10 mM EDTA-0.6% Nonidet P-40. Nuclei were
removed by pelleting at 12,000 × g for 5 min. To
recover mRNA and viral nucleocapsids (6), the cytoplasmic extracts were centrifuged in a step gradient composed of a 5.7 M CsCl
cushion, a 40% CsCl solution, and a 20% CsCl solution at 35,000 rpm
(overnight, in an SW55 rotor). RNAs from either viral nucleocapsids
(found at the 40%-20% interface) or mRNA pellets were analyzed by
limited primer extension using Moloney murine leukemia virus reverse
transcriptase (RT; Gibco-BRL) and the 32P-labeled SeV-edit
primer (5' GATGTGTTCTCTCCTATG) in a reaction mixture
containing ddATP to terminate the extension upstream of the purine run
as described in reference 26. The products were separated on a 10% sequencing gel.
Generation of recombinant SeV constructs (rSeV) containing
mutations upstream of or at the editing site.
The recovery system
was as described previously (12, 13). Briefly, one
9-cm-diameter petri dish of A549 cells was infected with 2 to 3 PFU of
vaccinia virus TF7-3 per cell and transfected 1 h later with 1.5 µg of pGEM-L, 5 µg of pGEM-N, 5 µg of pGEM-HAP (which
does not express the C proteins), 15 µg of FL3-
1, and 5 µg of
one of the pN/PXho/M shuttle vectors. All mutations were
introduced simultaneously in the N/PXho/M shuttle vectors
as well as the pGEM-HAP to avoid loss of the mutation by
recombination. After 24 h, cytosine arabinoside (100 µg/ml) was
added to inhibit vaccinia virus replication; 24 h after that, the
cells were scraped into their medium and directly injected into the
allantoic cavities of two to three 10-day-old embryonated chicken eggs.
Three days later, the allantoic fluids were harvested and reinjected
into eggs undiluted. For further passages, the viruses were diluted 1/500 before injection.
Analysis of the mRNAs by direct limited primer extension or on
the RT-PCR product.
To examine the length of the purine run, mRNA
pelleted through a 5.7 M CsCl cushion was used directly for limited
primer extension with primer SeV-edit as described (26).
Alternatively, an RT reaction was carried out with the oligonucleotide
PEcoP, and a 1/10 aliquot was used for PCR with 50 pmol of each primer
(PEcoP and PEag [5' CCAGCCAACGGCCGCCC]) in 10 mM Tris (pH
8.3)-50 mM KCl-2 mM MgCl2-200 µM deoxynucleoside
triphosphate (dNTP). PCR was carried out in 50 µl with 1 U
Taq polymerase in a GeneAmp PCR system 9600 as follows:
denaturation 94° for 20 s, elongation at 72°C for 30 s,
and annealing at 45° for 20 s, for 18 cycles.
The PCR products were purified on a 2% agarose gel and annealed to a
32P-labeled primer (SeV-edit) complementary to the sequence
immediately
downstream of the editing site. Primer extension was
performed
in 10 µl at 37°C for 6 min with 1 U of T7 DNA polymerase
(Pharmacia)
in the presence of 40 µM each dGTP, dTTP, and dCTP and 4 µM ddATP.
Then 300 µM dNTP was added, and the mix was incubated for
an extra
2 min to chase stalled complexes. The reaction was stopped by
adding 4 µl of stop solution (95% formamide, 20 mM EDTA, 0.1%
bromophenol blue, xylene cyanol FF). The products were boiled
for 1 min
and loaded onto a 10% sequencing
gel.
 |
RESULTS |
Minigenome mRNA editing in transfected cells. (i) The minimum G run
is three.
We previously used a synthetic minigenome in a cell
transfection assay to examine the role of cis-acting
sequences on the editing phenotype (18). The viral functions
required to replicate and transcribe the minigenome (N, P, and L) are
expressed from T7-promoted pGEM plasmids in this system, and the T7 RNA
polymerase is provided by coinfection with a recombinant vaccinia virus
(vTF7 [Fig. 2a]). The minigenome T7
transcript, a negative strand with exact viral ends, is first assembled
with viral N protein, and these negative-strand nucleocapsids are
transcribed and replicated by the SeV N, P, and L proteins (Fig. 2a).
mRNA (CsCl pellet RNA) is then prepared from these cells, and the
presence of G insertions is determined by limited primer extension. As
mentioned above, when the minigenomes were engineered to contain the
mRNA editing region of either bPIV3 or SeV, the resulting mRNA was
found to be edited accordingly (18).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
Minigenome mRNA editing in transfected cells. (a) SeV
minigenome replication and transcription was reconstituted in vaccinia
virus vTF7-infected cells via the transfection of pGEM plasmids which
express the PIV1 N protein (sphere), the P protein with a 10-amino-acid
deletion including the editing site (square), and the L protein (oval),
as well as the minigenome (see text). T7 refers to T7 RNA polymerase
expressed from vTF7-3. The T7 minigenome transcript is assembled with N
protein and is replicated and transcribed by the SeV and hPIV1
proteins. The ensuing mRNAs (bottom line) are examined for G insertions
by limited primer extension. (b) Limited primer extension analysis of
mRNAs and antigenomes from cells transfected with minigenomes
containing A6G1-5 editing sites (indicated
above the lanes). Cytoplasmic extracts of the transfected cells were
prepared at 24 hpi, and their SeV RNAs were separated on CsCl density
gradients into fractions containing the mRNAs (pellet) and
genomes/antigenomes (banded material) (Materials and Methods). A
5'-32P-labeled primer was then extended across the editing
site with RT in the presence of ddATP to limit the extension
(schematized above). The intense lower band in each mRNA lane indicates
the uninserted mRNAs. The fraction of one-G-insertion mRNAs was
determined by densitometry and is shown below the mRNA panel. The
results of a parallel transfection of the A6G4
construct in which pGEM-L was withheld is shown on the left, and the
absence of bands here indicates that the other signals observed are
dependent on the SeV polymerase. An editing-inactive construct,
A4GAG3, was included as another negative
control.
|
|
The above system, however, required selective RT-PCR amplification to
distinguish the pGEM-P mRNA from the minigenome mRNA.
Further, the
precise fraction of edited minigenome mRNAs was sometimes
unclear due
to a background of unedited T7 transcripts present
in the minus-pGEM-L
negative control. These transcripts presumably
arose via recombination
between the pGEM-N and the minigenome
that contains the first 90 nt of
the N gene. To eliminate these
problems, pGEM-
HAP (a tagged
version of P which eliminates C-protein expression)
was replaced by
pGEM-
HAP

30, containing a 30-nt deletion around the
editing site. This
deletion reduces the activity of P ~2-fold
(unpublished data),
but it eliminates the binding site for the primer
used for the
limited extension. This primer thus extends only on
minigenome
transcripts. Second, pGEM-N
hPIV1 was used
instead of pGEM-N
SeV to limit recombination between the
pGEM-N and the minigenome.
The sequence of the N gene of human
parainfluenza virus type 1
(hPIV1) is sufficiently similar to that of
SeV to be active in
this system, but it is sufficiently different in
the first 90
nt to severely limit
recombination.
SeV (5' A
6G
3) and b/hPIV3 (5'
A
6G
4/5) have slightly different numbers of G's
at their editing sites (as for protein-encoding
DNA, plus strands are
written 5' to 3' and minus strands are written
3' to 5'). We therefore
examined the effect of varying the number
of G's in this run from one
to five. The results of limited primer
extension directly on the mRNAs
(CsCl pellet) and antigenomes
(CsCl band) which accumulated in these
transfections of our modified
system are shown in Fig.
2b. Two negative
controls were included:
(i) pGEM-L was withheld from some of the
transfections to ensure
that all of the signal observed was SeV
specific, and (ii) a minigenome
with 5' AAAA
GAGGG
rather than AAAA
AAGGG, known to be
inactive
in mRNA editing (
18) was examined to control for
spurious bands.
In all cases, the constructs were adjusted to generate
minigenomes
of hexamer length (by compensating at an
EcoRV
site ca. 100 nt
downstream of the editing site), as otherwise genomes
are readily
readjusted to hexamer length in this system during
antigenome
synthesis (genome length correction [
15]).
Figure
2b shows the
relative importance of the exact number of G's in
the editing
sequence in this modified system. mRNA from a minigenome
containing
the wild-type (wt) SeV 5' A
6G
3
editing sequence contained a single
G insertion at 15% frequency
(rather than ca. 30% in a natural
viral infection [see below]). Its
expansion to A
6G
4 slightly decreased
the
insertion frequency (to 10%), and this frequency was slightly
less
than 10% when expanded to A
6G
5. In contrast,
no edited mRNAs
were detected in the A
6G
1 and
A
6G
2 constructs. In all cases, examination
of
the CsCl-banded antigenomes showed that no insertions had occurred
here
(Fig.
2b); hence, the single base insertion found in the
minigenome
mRNA had occurred during transcription. Efficient G
insertion thus
occurs when a minimum of three G's are found at
the editing site. The
presence of four or five G's here is relatively
well tolerated and
does not lead to a greater fraction of the
mRNAs with >1 G
insertions.
(ii) The 2 nt upstream of the purine run are a key determinant of
the editing phenotype.
When 18 nt upstream of the SeV
A6G3 run were replaced with the corresponding
sequence of bPIV3 and the G run was increased from three to four (as in
bPIV3), a significant fraction of the resulting mRNAs contained
multiple G insertions, i.e., displayed a PIV3 phenotype
(18). We therefore constructed minigenomes Swap2, -5, and
-8, in which 2, 5, and 8 nt upstream of the
A6G3 run were replaced with the corresponding
sequence of bPIV3, to more precisely define the cis-acting
sequence responsible for this altered phenotype (Fig.
3). When as few as 2 nt of bPIV3 were
placed upstream of the purine run, the minigenome mRNA had a G
insertion pattern reminiscent of that found in natural bPIV3 infections. Bands corresponding to two to five G insertions were now
detected, and the overall fraction of edited mRNA rose from 15 to
>40% (Fig. 3 and 4b). The altered
editing phenotype was not influenced by the number of G's in the
purine run, as Swap8 constructed in the A6G4
background behaved similarly to Swap8 in the
A6G3 background (Fig. 3) as did Swap5 and Swap2
(data not shown). To control that all minigenomes were of hexamer
length and that the G insertions had occurred during mRNA synthesis, the CsCl-banded antigenomes were also directly examined. Only a single
strong band at the nonedited position was detected (Fig. 3). Thus, the
altered insertion pattern of the Swap constructs was due not to the
extra G in the polypurine run (5' A6G4 versus A6G3) but rather to the differences in the
upstream sequence.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3.
Minigenome mRNA editing in cells transfected with Swap2,
-5, and -8. mRNA editing patterns of minigenome constructs in which 2, 5, and 8 nt of the SeV sequence were replaced with that of bPIV3
(Swap2, -5, and -8, highlighted by gray boxes at the top) were examined
as described for Fig. 2. The Swap series was also examined in the
A6G4 background, and only the result for Swap8
is shown in the last lane.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
mRNA editing in cells infected with rSeV-Swap2, -5, and
-8. Parallel A549 cell cultures were infected with 10 PFU/cell of
rSeV-Swap2, -5, or -8 per cell. Other cultures were infected with
either bPIV3, SeV, or an rSeV, for reference, or mock infected. CsCl
pellet RNA from the various cultures was prepared at 24 hpi, and
additions to the purine run were examined by limited primer extension
(a). The positions of bands representing the uninserted (0) and
inserted (+1, etc.) mRNAs are indicated on the sides. As negative
controls, primers were also extended on the Swap8 and SeV DNAs used to
generate the rSeV. The results were quantified by densitometry and are
shown as histograms in panel b. The overall fraction of the mRNA which
contain insertions (edited) and that with insertions of >1 G are
indicated for each panel. The insertion patterns of each minigenome and
rSeV were examined in at least three separate transfections or
infections. One typical result is shown.
|
|
mRNA editing in rSeV infections.
The
vTF7-infected/plasmid-transfected cell system, although highly
artificial, has the advantage that the translational consequences of
the mRNA editing do not feed back on the editing process itself, as all
viral proteins (N, P, and L) are provided via T7 RNA polymerase. mRNA
editing can thus be studied in isolation. However, unlike the case for
natural infections, the transfected cells constitutively produce large
amounts of viral proteins whose stoichiometric balance is not subject
to viral regulation, and this may also affect editing. Moreover, in our
modified transfection system, the NhPIV1 and
HAP
30 genes are used in place of NSeV and
HAP, which reduces the editing frequency. To study mRNA
editing in natural virus infections, we constructed rSeV containing
mutations at the editing site (Materials and Methods). The amino acids
of the P sequence altered by the editing mutations (Fig.
5) appear to lie in a noncritical region
of the protein (7), as all of these rSeV were prepared as
readily as the wt control. A549 cells infected with these viruses all
accumulated similar amounts of N and M protein (at 24 hpi) as judged by
immunoblotting, and similar levels of genomes and antigenomes as
judged by primer extension, as the wt control (data not shown).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Amino acid substitutions in the mutant virus P proteins.
The nucleotide sequence of the P-gene P ORF (positions 1034 to 1054) is
shown in groups of three, and their encoded amino acids are indicated
below in one-letter code. The nucleotide substitutions of the various
mutants are indicated by lowercase letters in bold, and the
corresponding amino acid changes are underlined and in bold.
|
|
Total RNA was isolated from cells infected with these editing mutants
as well as SeV, bPIV3, and an rSeV, and the pattern
of mRNA editing was
examined by limited primer extension. The
primer was also extended on
SeV DNA and Swap8 DNA (used to prepare
the viruses) as negative
controls. The results obtained with natural
virus infections of
rSeV-Swap2, -5, and -8 were basically similar
to those obtained with
the minigenomes in transfected cells (Fig.
4). In contrast to the SeV
and rSeV infections, where the insertion
was mostly limited to a single
G and mRNAs with >1 G insertions
represented only 1.5% of the
population, the substitution of only
2 nt was sufficient to lead to
multiple G insertions in 36% of
the mRNAs (Fig.
6b). The further substitution of 5 and 8 nt led
to a more even distribution of the +3 to +5 insertions, as in
the natural bPIV3 infection. Not any change within the upstream
8 nt
led to a PIV3-like phenotype; e.g., mutating the 8 upstream
nt to
5' UCCCUUGG (mostly the complement of the bPIV3 sequence)
did not lead to detectable >1-G insertions (data not shown). All
the
rSeV-swap constructs edited a greater fraction of the mRNA
than did
either SeV or bPIV3, and the frequencies of one-G insertions
are
clearly increased here as well. Thus, the insertion of multiple
guanylates at the editing site, the hallmark of PIV3 phenotype,
appears
to be governed by the upstream sequence. The two bases
directly
upstream of the 5' A
6G
3 purine run (UU for
h/bPIV3 versus
AC for SeV [Fig.
1b]) appear to be key elements of
this
cis-acting
sequence. We also note that neither the
minigenome nor rSeV-Swap8
pattern precisely mimics that of the natural
bPIV3 infection (Fig.
4b).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 6.
mRNA editing in rSeV with AC, AU, or UU upstream of A5G3
purine runs. Parallel A549 cell cultures were infected at 10 PFU/cell
with the various rSeV whose editing regions are outlined above, and
additions to the purine run of their P mRNAs were examined by limited
primer extension. The results were quantified by densitometry and are
shown as histograms in panel b, along with that of rSeV-Swap2 from Fig.
4. The insertion pattern of each rSeV was examined in at least three
separate infections. One typical result is shown.
|
|
Alteration of the A run and mRNA editing.
Morbilliviruses,
which, like SeV, edit their P mRNAs by the insertion of predominantly a
single G residue, are a more closely related group of viruses than the
respiroviruses. Morbilliviruses also contain a more strongly conserved
sequence at the editing site (5' YCC AUU
A5G3) than the respiroviruses, where
only 5' ANY A6 is conserved (Fig.
1b). As morbilliviruses contain a run of only five adenosines, we were
interested in the editing phenotype of a SeV which contained the
morbillivirus cis-acting sequence. This was accomplished by
converting the sequence 5' A6G3C to
A5G3CC (Fig. 6) so that (i) hexamer genome
length is maintained and (ii) the hexamer phase of the first G of
the G run moves upstream by one position, which is in fact to that
conserved in morbilliviruses (20). The concomitant amino
acid substitutions in the P protein are shown in Fig. 5. Again, these
viruses were prepared readily and grew to similar levels in eggs as wt
virus (data not shown).
Total RNA was isolated from cells infected with each rSeV and examined
by limited primer extension (Fig.
6). Shortening the
A run from six to
five within the context of the SeV upstream
sequence (5'
A
AC A
5G
3) eliminated G insertion.
When the
upstream two bases are further changed to those of the
morbilliviruses
(5' A
UU A
5G
3),
editing activity is regained. However, the
mRNAs are now edited in a
pattern similar to that of bPIV3 rather
than that of SeV or the
morbilliviruses (+1 to +5 are found at
roughly equal frequency and
together represent 44% of the mRNAs).
The substitution of the single
upstream nucleotide within the
A
5G
3
background (AA
U A
5G
3) was also
sufficient to restore
some editing activity, but the overall fraction
of inserted mRNAs
(24%), as well as the extent of the insertions (>1
G, 11%), was
reduced. The SeV polymerase can indeed stutter with an
A
5 run,
but only when U rather than C precedes this run.
Efficient stuttering,
however, requires the replacement of both
upstream
nucleotides.
Thus, shortening the A run from six to five in SeV consistently
decreases the fraction of edited mRNAs as well as the number
of G
insertions per molecule of mRNA. On the other hand, within
the
A
5G
3 background, substitution of U for the
upstream C has
the opposite effect, and the substitution of UU for the
upstream
AC has a even stronger effect in promoting G insertions during
mRNA synthesis. Remarkably, SeV carrying the morbillivirus
cis-acting
sequence (A
UU
A
5G
3) was found to edit its mRNA in a manner
similar to that of bPIV3 rather than that of the
morbilliviruses.
 |
DISCUSSION |
An interesting feature of paramyxovirus mRNA editing is that
each particular virus inserts G residues in a pattern matched to the
organization of its P gene ORFs (Fig. 1a). Furthermore, the SeV
transcription complex can be induced to edit its P mRNA like that of
h/bPIV3 (all respiroviruses), i.e., to switch its editing phenotype, by
simply substituting the bPIV3 editing region for that of SeV. Our
results have highlighted the importance of the sequence immediately
upstream of the AnGn slippery sequence for this phenotype switch, rather than the number of
G's in the G run. A minimum of three G's were found to be required for SeV editing to occur, and increasing the G run to four or five was
tolerated and did not affect the editing phenotype. We have not
examined the effects of further extending the G run. However, a
recombinant measles virus engineered to contain three extra G's at the
editing site (5' AUU A5G6) was found to insert two to four G's with increased frequency (28).
One unexpected finding of this work is that replacing the SeV slippery
sequence (A6G3) with that of measles virus
(A5G3) inactivates the editing process, unlike
the analogous h/bPIV3 (A6G4-5) swap. It is
possible that SeV stuttering is adversely affected by a run of only
five adenylates and/or by the displacement of the hexamer phase of the
G run with respect to the N-protein subunit upstream by 1 position (to
shorten the A run) (20). However, neither of these possible
requirements appears to be critical for stuttering, as replacement of
the upstream AC with the conserved UU restores the G insertions. Most
unexpectedly, significant amounts of mRNAs with multiple G insertions
were generated during this restored editing. This unexpected switch to
the PIV3 phenotype highlights how little we know of how the
cis-acting sequence determines the distribution of G
insertions. It also suggests that there may well be differences in how
the various viral polymerases interact with the cis-acting
sequence and/or that we have as yet identified only one element of the
cis-acting sequence, that which has been conserved. Despite
our limited information, the decision of the viral polymerase to
stutter or not to stutter, and the extent of the stuttering, can be
considered in terms of a competitive kinetic model, as this does not
depend on detailed structural information of the transcription
elongation complex.
A competitive kinetic model for paramyxovirus polymerase
stuttering.
Cellular RNAPs respond to intrinsic signals in the
template DNA and nascent RNA which divert a fraction of the
transcription complexes from the path of rapid chain elongation, e.g.,
to pause or to terminate the chain (23). These processes are
among the best-studied examples of transcriptional choice and thus the
most useful model for us. By analogy to Escherichia coli
RNAP (32), the paramyxovirus elongation complex has two
choices at any template position I: it can extend the
nascent chain by one nucleotide to form a transcript that is
I + 1 residues in length, or it can be induced by
features of the template or nascent chain sequence to form a
processively unstable complex (Fig. 7).
At this point (the first branchpoint; see below), there is a
significant probability that the active site together with its nascent
chain are repositioned one residue upstream of the template C which has
just been copied (shown as C1052 in Fig. 7). This template C is then
copied a second time when nucleotide addition recurs, resulting in a
pseudo-templated G insertion.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 7.
A stuttering model for paramyxovirus mRNA editing. (a)
The putative RNA-RNA hybrid between the polyprimidine tract of the
negative-strand genome (top strand, written 3' to 5') and the
polypurine run of the nascent mRNA chain (bottom strand, written 5' to
3') when the active site of the transcription complex has just
incorporated G1052 (top left). At the editing site (shown as C1052,
highlighted with a gray box), the transcription complex has the choice
of realigning its nascent RNA chain upstream on the template before the
next nucleotide is added. Here, the minimum requirement for stuttering,
that the realigned hybrid be nearly as stable as its predecessor, has
been met because non-Watson-Crick U:G pairs (highlighted in gray) do
not disrupt the helical stack. If the rate constant for
pseudo-templated addition of the G residue
(kpseudo) is greater than that for realignment,
Kstutter will be mostly determined by
krealign. Having stuttered once at template
C1052, the transcription complex is back to where it started and has
the same choice. When the upstream AC is replaced with UU, however,
krestutter is increased relative to
kstutter (see text). Escape from this process
requires the active site to move on to a position where realignment of
the nascent chain upstream does not occur. (b) A model for the
thermodynamic reaction pathway of the transcription elongation complex
at the editing site. Barriers heights are given as G*,
the free energy of activation. The black dot represents the
transcription elongation complex. Note that the activation energy for
extending the chain from I to I + 1 ( G°forward) is shown as being similar for
strictly templated (reaction coordinate 1052) and pseudo-templated
(reaction coordinate 1051) nucleotide addition. When AC is found
upstream of the purine run, the ground state of the transcription
elongation complex after realignment (reaction coordinate 1051) will be
determined mostly by the stability of the hybrid and is therefore
higher than that of its predecessor due to the presence of the U:G
pair. When UU rather than AC is found at this site, the ground state of
the realigned complex is more stable than its predecessor, presumably
due to additional interactions between the exit channel of the
polymerase and the upstream nucleotides. This leads to a greater
fraction of the mRNAs containing pseudo-templated additions and to a
greater number of insertions when stuttering takes place.
|
|
In a competitive kinetic model, the elongation and stuttering processes
are characterized by specific overall rate constants
(
kforward and
kstutter)
at each template position. The magnitude
of these rate constants is
expected to depend on template and
nascent chain sequences and in
particular on the base-pairing
possibilities of the realigned
upstream sequences. For the
E. coli RNAP transcription
elongation complex, where the average
step time for NTP addition is
~30 ms (at typical nonterminator
positions), the activation
barrier height to elongation was calculated
at +16 kcal/mol. The
barrier to termination at these positions,
however, is thought to be
>30 kcal/mol (
32). Transcription thus
occurs with an
infinitesimal probability of spontaneous termination
at
nonterminator positions. At terminator positions, however,
the length
of time the polymerase pauses at this site is roughly
equal to that for
nascent chain release (1 to 10 s), and the barriers
to elongation
and termination are roughly equal (~18 kcal/mol).
By analogy, the
barrier to realignment at nonstuttering sites
is expected to be very
high because of the instability of the
realigned hybrid at
heteropolymeric sequences, and stuttering
does not occur. We
assume that the barrier to nascent chain realignment
at stuttering
sites is strongly reduced (and lower than that to
strictly templated
elongation), such that a significant fraction
of the elongation
complexes are realigned upstream on the template
before the next
nucleotide (G1053 [Fig.
7]) can be
added.
The competitive kinetic model made two predictions for the
E. coli elongation/termination decision
(
32), which should apply
as well to stuttering. First,
stuttering should be possible only
at sites where the realignment
complex is relatively stable, such
that the relative heights of the
elongation and realignment barriers
are now reversed. Because of the
large difference in barrier heights
to realignment at (heteropolymeric)
nonstuttering positions, the
position of stuttering sites should be
strongly determined and
the elongation-stuttering decision should have
the character of
a binary switch. This is of interest because
paramyxovirus polymerase
stuttering (mRNA editing or polyadenylation)
normally does not
occur during antigenome synthesis, where
the viral polymerase
is said to be switched to the replication
mode by the concurrent
encapsidation of the nascent chain.
Second, editing efficiencies
should be easily modified
(or regulated) at editing sites, because
relatively small changes
in either kinetic or thermodynamic components
of the activation energy
barriers (e.g., by the UU/AC substitution)
will produce large changes
in editing efficiency due to the exponential
form of the relationship
(
20a,
32).
For SeV, there is evidence that the editing site is the middle C (nt
1052) of the template 3' U
6C
3 pyrimidine run
(reference
31 and unpublished data), and we assume 7 bp between the nascent
chain and the template (Fig.
7); the
E. coli complex is thought
to contain 8 bp
(
23-25). The SeV transcription complex is proposed
to pause
at the editing site, and the polymerase reaction center
and nascent RNA
3' end are proposed to realign upstream on the
template by one position
before the incorporation of G1053. The
new 7-bp hybrid formed on
realignment is only slightly less stable
than its predecessor, as
one G:C pair has been replaced by a G:U
pair (a difference in
stability of ca. +1 to +2 kcal/mol, ignoring
the protein components).
If the barrier to realignment is lower
than that to elongation, the
reaction center will equilibrate
between these two positions (nt 1051 and 1052) according to the
relative stability of the hybrids (Fig.
7).
If the realigned hybrid
is 1 kcal/mol less stable than the original
hybrid, the active
site would be found ca. 20% of the time at the
realigned position
(nt 1051) and 80% at the strictly templated
elongation position
(nt 1052). If the barrier heights to normal and
pseudo-templated
elongation are equal, a single G will then be inserted
into the
mRNA with a frequency of ca. 20%. Of course, after one round
of
stuttering, the transcription complex is now back to where it
started. If nothing else has changed, the process will be repeated
at
the same frequency. This situation best describes wild-type
virus (5'
A
AC A
6G
3) mRNA editing, where
insertion of a
single G is by far the predominant editing
event.
The
cis-acting editing sequence appears to control two
distinct branchpoints (Fig.
7). In the first, the transcription complex
arrives at a site that allows realignment of the nascent chain
upstream, and this decelerates the rate of strictly templated
nucleotide addition (
kforward). If an NMP is
nevertheless added,
the polymerase can move past the potential site of
editing (to
escape) (Fig.
7). This first branchpoint determines the
overall
efficiency of editing. However, if a stutter occurs, the
frequency
with which it now escapes to strictly templated elongation or
restutters represents a second branchpoint, because h/bPIV3 (and
SeV-AUU A
6G
3) behave differently at this
juncture. The second
branchpoint determines the number of G insertions
once stuttering
has commenced. There is experimental evidence that
kstutter and
krestutter
represent separate parts of this reaction pathway.
Partial substitution
of the GTP in in vitro reactions with ITP
(expected to destabilize the
nascent chain:template G:C pairs
at the editing site), and very low
concentrations of GTP (expected
to increase the step time for
elongation at the editing site),
increases the fraction of mRNAs with
one G inserted ca. 2-fold
(from 20 to 40%), but increases that with
multiple G insertions
ca. 10-fold (from 2 to 20%) (
31). Our
results provide further
evidence that the second branchpoint can be
modulated, during
natural SeV infection, by substituting UU for the AC
immediately
upstream of the 5' A
6G
3 site.
According to a competitive kinetic
model, this substitution would
presumably lead to a more stable
(rather than a less stable)
realignment complex, as the upstream
UU would somehow more than
compensate for the additional U:G pair
in the hybrid on realignment.
The reaction center would thus now
be located mostly at the realigned
position (lower ball at position
1051 in Fig.
7), ensuring that
stuttering would occur repetitively,
and that escape to strictly
templated transcription (incorporation
of G1053) would be
infrequent.
For the
E. coli RNAP transcription complex, the nascent
chain becomes available for annealing with short oligonucleotides
when
it is 14 to 16 nt from the RNA 3' end (
21,
27). The 6
to 8 nt upstream of the 8-bp RNA-DNA hybrid are thought to be
located in an
exit channel (or tunnel), also referred to as the
tight product-binding
site (
5,
25). Alteration of the RNA-protein
interactions in
the
E. coli exit channel due to the formation
of
hairpin structures are thought to somehow stabilize the paused
conformation (
5a). Similarly, the nascent RNA of the
vaccinia
virus RNAP elongation complex exits from the polymerase 16 to
18 nt from the RNA 3' end (
10,
14). This RNAP was recently
found to stutter at the end of a template A9 run (if the templated
guanylate immediately following the run was disfavored by severely
limiting the GTP concentration), adding one to seven pseudo-templated
uridylates to the RNA (
9). These slipped RNAs were released
from the template, and Deng and Shuman (
9) have speculated
that the RNA-protein interactions that normally stabilize the
nascent
chain are weakened when poly(U) occupies most of the RNA
exit channel
on the vaccinia virus polymerase. Assuming that the
basic structural
features of all RNAPs have been conserved throughout
evolution, the
eight bases upstream of the purine run would also
be included in the
SeV polymerase exit channel. The additional
stability conferred by the
upstream UU can then be postulated
to result from base-specific
interactions of the SeV RNAP and
the nascent chain as the latter
traverses the elongation complex.
As long as these base-specific
interactions with the exit channel
can occur, repetitive G insertions
are favored. Each additional
G insertion, however, moves the upstream
UU toward the outside
of the exit channel. These base-specific
interactions (and the
additional stability of the realigned hybrid)
will eventually
no longer be possible. The reaction center will then
revert to
spending most of its time at nt 1052 rather than nt 1051, and
the polymerase will soon escape to strictly templated transcription.
The counting mechanism by which PIV3 inserts one to six G's at
roughly
equal frequency would then be based on the dimensions
of this RNAP exit
channel.
 |
ACKNOWLEDGMENTS |
We are grateful to Hans Geisselmann (Grenoble, France) and Kyle
Tanner (Geneva, Switzerland) for helpful discussions on thermodynamics.
This work was supported by a grant from the Fonds National Suisse.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dept. of
Genetics and Microbiology, University of Geneva School of Medicine,
CMU, 9 Ave. de Champel, CH1211 Geneva, Switzerland. Phone: (41 22) 702 5657. Fax: (41 22) 702 5702. E-mail:
Daniel.Kolakofsky{at}medecine.unige.ch.
 |
REFERENCES |
| 1.
|
Benne, R.
1993.
RNA editing; an overview, p. 13-24.
In
R. Benne (ed.), RNA editing. Ellis Horwood, Chichester, England.
|
| 2.
|
Brierley, I.,
P. Digard, and S. C. Inglis.
1989.
Characterization of an efficient coronavirus ribosomal frameshifting signal: requirement for an RNA pseudoknot.
Cell
57:537-547[Medline].
|
| 2a.
|
Calain, P., and L. Roux.
1993.
The rule of six; a basic feature for efficient replication of Sendai virus defective interfering RNA.
J. Virol.
67:4822-4830[Abstract/Free Full Text].
|
| 3.
|
Cattaneo, R.,
K. Kaelin,
K. Baczko, and M. A. Billeter.
1989.
Measles virus editing provides an additional cysteine-rich protein.
Cell
56:759-764[Medline].
|
| 4.
|
Cattaneo, R.
1991.
Different types of messenger RNA editing.
Annu. Rev. Genet.
25:71-88[Medline].
|
| 5.
|
Chamberlin, M. J.
1995.
New models of transcription elongation and termination.
Harvey Lect.
88:1-21.
|
| 5a.
|
Chan, C. L.,
D. Wang, and R. Landick.
1997.
Multiple interactions stabilize a single paused transcription intermediate in which hairpin to 3' end spacing distinguishes pause and termination pathways.
J. Mol. Biol.
268:54-68[Medline].
|
| 6.
|
Curran, J.,
R. Boeck, and D. Kolakofsky.
1991.
The Sendai virus P gene expresses both an essential protein and an inhibitor of RNA synthesis by shuffling modules via mRNA editing.
EMBO J.
10:3079-3085[Medline].
|
| 7.
|
Curran, J.
1996.
Reexamination of the Sendai virus P protein domains required for RNA synthesis; a possible supplemental role for P.
Virology
221:130-140[Medline].
|
| 8.
|
Curran, J.,
P. Latorre, and D. Kolakofsky.
1998.
Translational gymnastics on the Sendai virus P/C mRNA.
Semin. Virol.
8:351-357.
|
| 9.
|
Deng, L., and S. Shuman.
1997.
Elongation properties of vaccinia virus RNA polymerase: pausing, slippage, 3' end addition, and termination site choice.
Biochemistry
36:15892-15899[Medline].
|
| 10.
|
Deng, L.,
J. Hagler, and S. Shuman.
1996.
Factor-dependent release of nascent RNA by ternary complexes of vaccinia RNA polymerase.
J. Biol. Chem.
271:19556-19562[Abstract/Free Full Text].
|
| 11.
|
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126[Abstract/Free Full Text].
|
| 12.
|
Garcin, D.,
T. Pelet,
P. Calain,
L. Roux,
J. Curran, and D. Kolakofsky.
1995.
A highly recombinogenic system for the recovery of infectious Sendai paramyxovirus from cDNA: generation of a novel copy-back nondefective interfering virus.
EMBO J.
14:6087-6094[Medline].
|
| 13.
|
Garcin, D.,
M. Itoh, and D. Kolakofsky.
1997.
A point mutation in the Sendai virus accessory C proteins attenuates virulence for mice, but not virus growth in cell culture.
Virology
238:424-431[Medline].
|
| 14.
|
Hagler, J., and S. Shuman.
1992.
A freeze-frame view of eukaryotic transcription during elongation and capping of nascent mRNA.
Science
255:983-986[Abstract/Free Full Text].
|
| 15.
|
Hausmann, S.,
J.-P. Jacques, and D. Kolakofsky.
1996.
Paramyxovirus RNA editing and the requirement for hexamer genome length.
RNA
2:1033-1045[Abstract].
|
| 16.
|
Jacks, T., and H. E. Varmus.
1985.
Expression of the Rous sarcoma virus pol gene by ribosomal frameshifting.
Science
230:1237-1242[Abstract/Free Full Text].
|
| 17.
|
Jacques, J.-P., and D. Kolakofsky.
1991.
Pseudo-templated transcription in prokaryotic and eukaryotic organisms.
Gene Dev.
5:707-713[Free Full Text].
|
| 18.
|
Jacques, J.-P.,
S. Hausmann, and D. Kolakofsky.
1994.
Paramyxovirus mRNA editing leads to G deletions as well as insertions.
EMBO J.
13:5496-5503[Medline].
|
| 19.
|
Kolakofsky, D.,
J. Curran,
T. Pelet, and J.-P. Jacques.
1993.
Paramyxovirus P gene mRNA editing, p. 105-123.
In
R. Benne (ed.), RNA editing. Ellis Horwood, Chichester, England.
|
| 20.
|
Kolakofsky, D.,
T. Pelet,
D. Garcin,
S. Hausmann,
J. Curran, and L. Roux.
1998.
Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited.
J. Virol.
72:891-899[Free Full Text].
|
| 20a.
|
Kolakofsky, D., and S. Hausmann.
1998.
Cotranscriptional paramyxovirus mRNA editing: a contradiction in terms, p. 413-420.
In
H. Grosjean, and R. Benne (ed.), Modification and editing of RNA. ASM Press, Washington, D.C.
|
| 21.
|
Komisarrova, N., and M. Kashlev.
1997.
Arrest of transcription: E. coli RNA polymerase translocates backward leaving the 3' end of the RNA intact and extruded.
Proc. Natl. Acad. Sci. USA
94:1755-1760[Abstract/Free Full Text].
|
| 22.
|
Lamb, R. A., and D. Kolakofsky.
1996.
Paramyxoviridae: the viruses and their replication, p. 1177-1204.
In
B. N. Fields, et al. (ed.), virology, 3rd ed. Raven Press, New York, N.Y.
|
| 23.
|
Landick, R.
1997.
RNA polymerase slides home: pause and termination site recognition.
Cell
88:741-744[Medline].
|
| 24.
|
Liu, B.,
M. L. Wong,
R. L. Tinker,
E. P. Geiduschek, and B. M. Alberts.
1993.
The DNA replication fork can pass RNA polymerase without displacing the nascent transcript.
Nature
366:33-39[Medline].
|
| 25.
|
Nudler, E.,
E. Avetissova,
V. Markovtsov, and A. Goldfarb.
1996.
Transcription processivity: RNA polymerase-DNA interactions holding together the elongation complex.
Science
273:211-217[Abstract].
|
| 26.
|
Pelet, T.,
J. Curran, and D. Kolakofsky.
1991.
The P gene of bovine parainfluenza virus 3 expresses all three reading frames from a single mRNA editing site.
EMBO J.
10:443-448[Medline].
|
| 27.
|
Reeder, T. C., and D. K. Hawley.
1996.
Promoter proximal sequences modulate RNA polymerase II elongation by a novel mechanism.
Cell
87:767-777[Medline].
|
| 28.
|
Schneider, H.,
K. Kaelin, and M. A. Billeter.
1997.
Recombinant measles viruses defective for RNA editing and V protein synthesis are viable in cultured cells.
Virology
227:314-322[Medline].
|
| 29.
|
Thomas, S. M.,
R. A. Lamb, and R. G. Paterson.
1988.
Two mRNAs that differ by two nontemplated nucleotides encode the amino coterminal proteins P and V of the paramyxovirus SV5.
Cell
54:891-92[Medline].
|
| 30.
|
Vidal, S.,
J. Curran, and D. Kolakofsky.
1990.
Editing of the Sendai virus P/C mRNA by G insertion occurs during mRNA synthesis via a virus-encoding activity.
J. Virol.
64:239-246[Abstract/Free Full Text].
|
| 31.
|
Vidal, S.,
J. Curran, and D. Kolakofsky.
1990.
A stuttering model for paramyxovirus P mRNA editing.
EMBO J.
9:2017-2022[Medline].
|
| 32.
|
von Hippel, P. H., and T. D. Yager.
1992.
The elongation-termination decision in transcription.
Science
255:809-812[Abstract/Free Full Text].
|
| 33.
|
Weiss, R. B.,
D. M. Dunn,
J. F. Atkins, and R. F. Gesteland.
1990.
Ribosomal frameshifting from 2 to +50 nucleotides.
Prog. Nucleic Acid Res. Mol. Biol.
30:159-183.
|
Journal of Virology, January 1999, p. 343-351, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kulkarni, S., Volchkova, V., Basler, C. F., Palese, P., Volchkov, V. E., Shaw, M. L.
(2009). Nipah Virus Edits Its P Gene at High Frequency To Express the V and W Proteins. J. Virol.
83: 3982-3987
[Abstract]
[Full Text]
-
Lo, M. K., Harcourt, B. H., Mungall, B. A., Tamin, A., Peeples, M. E., Bellini, W. J., Rota, P. A.
(2009). Determination of the henipavirus phosphoprotein gene mRNA editing frequencies and detection of the C, V and W proteins of Nipah virus in virus-infected cells. J. Gen. Virol.
90: 398-404
[Abstract]
[Full Text]
-
Wang, J. T., McElvain, L. E., Whelan, S. P. J.
(2007). Vesicular Stomatitis Virus mRNA Capping Machinery Requires Specific cis-Acting Signals in the RNA. J. Virol.
81: 11499-11506
[Abstract]
[Full Text]
-
Shih, K.-N., Chuang, Y.-T., Liu, H., Lo, S. J.
(2004). Hepatitis D virus RNA editing is inhibited by a GFP fusion protein containing a C-terminally deleted delta antigen. J. Gen. Virol.
85: 947-957
[Abstract]
[Full Text]
-
Mebatsion, T., de Vaan, L. T. C., de Haas, N., Romer-Oberdorfer, A., Braber, M.
(2003). Identification of a Mutation in Editing of Defective Newcastle Disease Virus Recombinants That Modulates P-Gene mRNA Editing and Restores Virus Replication and Pathogenicity in Chicken Embryos. J. Virol.
77: 9259-9265
[Abstract]
[Full Text]
-
Le Mercier, P., Garcin, D., Hausmann, S., Kolakofsky, D.
(2002). Ambisense Sendai Viruses Are Inherently Unstable but Are Useful To Study Viral RNA Synthesis. J. Virol.
76: 5492-5502
[Abstract]
[Full Text]
-
Gubbay, O., Curran, J., Kolakofsky, D.
(2001). Sendai virus genome synthesis and assembly are coupled: a possible mechanism to promote viral RNA polymerase processivity. J. Gen. Virol.
82: 2895-2903
[Abstract]
[Full Text]
-
Barr, J. N., Wertz, G. W.
(2001). Polymerase Slippage at Vesicular Stomatitis Virus Gene Junctions To Generate Poly(A) Is Regulated by the Upstream 3'-AUAC-5' Tetranucleotide: Implications for the Mechanism of Transcription Termination. J. Virol.
75: 6901-6913
[Abstract]
[Full Text]
-
Vulliémoz, D., Roux, L.
(2001). "Rule of Six": How Does the Sendai Virus RNA Polymerase Keep Count?. J. Virol.
75: 4506-4518
[Abstract]
[Full Text]
-
Larsen, B., Wills, N. M., Nelson, C., Atkins, J. F., Gesteland, R. F.
(2000). Nonlinearity in genetic decoding: Homologous DNA replicase genes use alternatives of transcriptional slippage or translational frameshifting. Proc. Natl. Acad. Sci. USA
97: 1683-1688
[Abstract]
[Full Text]
-
Kato, A., Kiyotani, K., Hasan, M. K., Shioda, T., Sakai, Y., Yoshida, T., Nagai, Y.
(1999). Sendai Virus Gene Start Signals Are Not Equivalent in Reinitiation Capacity: Moderation at the Fusion Protein Gene. J. Virol.
73: 9237-9246
[Abstract]
[Full Text]
-
Garcin, D., Latorre, P., Kolakofsky, D.
(1999). Sendai Virus C Proteins Counteract the Interferon-Mediated Induction of an Antiviral State. J. Virol.
73: 6559-6565
[Abstract]
[Full Text]
-
Hausmann, S., Garcin, D., Delenda, C., Kolakofsky, D.
(1999). The Versatility of Paramyxovirus RNA Polymerase Stuttering. J. Virol.
73: 5568-5576
[Abstract]
[Full Text]
-
Zheng, H., Lee, H. A., Palese, P., García-Sastre, A.
(1999). Influenza A Virus RNA Polymerase Has the Ability To Stutter at the Polyadenylation Site of a Viral RNA Template during RNA Replication. J. Virol.
73: 5240-5243
[Abstract]
[Full Text]