JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Menotti, L.
Right arrow Articles by Campadelli-Fiume, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Menotti, L.
Right arrow Articles by Campadelli-Fiume, G.

 Previous Article  |  Next Article 

Journal of Virology, January 1999, p. 325-333, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Trafficking to the Plasma Membrane of the Seven-Transmembrane Protein Encoded by Human Herpesvirus 6 U51 Gene Involves a Cell-Specific Function Present in T Lymphocytes

Laura Menotti,1 Prisco Mirandola,1 Massimo Locati,2,3 and Gabriella Campadelli-Fiume1,*

Section on Microbiology and Virology, Department of Experimental Pathology, University of Bologna, Bologna,1 Institute of Pharmacological Research "M. Negri," Milan,2 and Section on General Pathology, Department of Biotechnology, University of Brescia, Brescia,3 Italy

Received 3 August 1998/Accepted 15 October 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The sequence of human herpesvirus 6 (HHV-6) U51 open reading frame predicts a protein of 301 amino acid residues with seven transmembrane domains. To identify and characterize U51, we derived antipeptide polyclonal antibodies and developed a transient expression assay. We ascertained that U51 was synthesized in cord blood mononuclear cells infected with either variant A- or variant B-HHV-6 and was transported to the surface of productively infected cells. When synthesized in transient expression systems, U51 intracellular trafficking was regulated in a cell-type-dependent fashion. In human monolayer HEK-293 and 143tk- cells, U51 accumulated predominantly in the endoplasmic reticulum and failed to be transported to the cell surface. In contrast, in T-lymphocytic cell lines J-Jhan, Molt-3, and Jurkat, U51 was successfully transported to the plasma membrane. We infer that transport of U51 to the cell surface requires a cell-specific function present in activated T lymphocytes and T-cell lines.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Proteins with seven-transmembrane-domain structures are divided into two superfamilies depending on their ability to bind G proteins and are classified as G-protein-coupled receptors and nonreceptor seven-transmembrane-domain proteins (29). Beta- and gammaherpesviruses encode seven-transmembrane-domain proteins which function as chemokine receptors and whose roles in the viral replicative cycle are diversified. Thus, human cytomegalovirus (HCMV) US28 binds beta -chemokines, and its signaling ability can be monitored as intracellular Ca2+ mobilization (20, 36). The protein encoded by human herpesvirus 8 (HHV-8) open reading frame (ORF) 74 functions as a promiscuous chemokine receptor for alpha - and beta -chemokines and appears to be constitutively active in signal transduction, raising the possibility that it is part of the transforming potential of the virus (3, 9). The ECRF3 protein encoded by herpesvirus saimiri behaves as an alpha -chemokine receptor with specificity for interleukin 8, GRO-alpha , and NAP-2 (1, 37). Human and murine CMV encode two additional G-protein-coupled receptors (UL33 and UL78) not yet characterized (4, 12, 34, 38). Recently, the viral and cellular seven-transmembrane G-protein-coupled receptors have been the focus of much interest because some of them, including HCMV US28, act as coreceptors for entry of human immunodeficiency virus into cells (42) and, in the case of poxviruses, because they appear to be effectors of viral immune response evasion strategies (reviewed in references 24, 43, and 44).

Notwithstanding extensive studies on the epidemiology of HHV-6 infections and associated diseases (reviewed in references 6 and 7), little is known of the functions of specific gene products and of their role in the viral infectious cycle and associated diseases. In vivo, HHV-6 appears to infect T lymphocytes, monocytes, astrocytes, oligodendrocytes (8, 10, 28, 30, 47), and possibly other not yet characterized cells in various tissues (see references 6, 7, and 13). T lymphocytes and/or monocytes are believed to be the site of latency (30). Because of its ability to persist in the host after primary infection, the virus must have evolved strategies to evade the immune system. The molecular bases for this phenomenon are not yet clear. In vitro, the virus grows in activated T lymphocytes and monocytes, in T-cell lines (33), and, to a limited extent, in some epithelial and endothelial cell lines (see references 6 and 46). The sequence of the HHV-6 genome predicts two proteins with seven transmembrane domains encoded by U51 and U12 ORFs (23, 31). U12 was recently shown to be expressed late in the viral replicative cycle; to function as a receptor for the beta -chemokines RANTES, MCP-1, and MIP-1alpha ; and to respond to chemokine binding with a signaling pathway evidenced as mobilization of intracellular Ca2+ (27).

The initial objective of this study was to identify the protein encoded by HHV-6 U51 ORF. We ascertained that U51 protein is expressed in productively infected cord blood mononuclear cells (CBMCs) and is transported to the infected cell surface. In the course of these studies, a rather unusual trafficking property of U51 emerged, as we noticed that U51 failed to be transported to the cell surface in human monolayer cells, where it accumulated predominantly in the endoplasmic reticulum (ER), but reached the plasma membrane of T-lymphocytic cell lines. The results indicate that transport of U51 to the cell surface requires a cell-specific function present in T lymphocytes.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cells and viruses. Human embryonic kidney 293 (HEK-293) cells, human 143tk- cells, and Vero green monkey kidney cells were grown in Dulbecco's modified Eagle medium containing 5% fetal calf serum (Gibco Laboratories). Primary CBMCs were cultured as described elsewhere (17). HHV-6(A)U1102, HHV-6(B)Z29 (14, 32), and vaccinia virus recombinant expressing the T7 RNA polymerase (VacT7) (19) were described elsewhere. Infection of CBMCs with HHV-6 was monitored routinely by immunofluorescence with monoclonal antibody (MAb) 2D10 to glycoprotein B (gB), as described elsewhere (18).

Antibodies. Commercially available antibodies were antihemagglutinin (anti-HA) antibody (AntiXpress) (Invitrogen), anti-CC-chemokine receptor 5 (anti-CCR5) MAb LS100/2D7 (R&D Systems, Abingdon, United Kingdom), fluorescein isothiocyanate (FITC)-conjugated anti-mouse antibody (Jackson), FITC-conjugated anti-rabbit antibody (Dako), biotinylated anti-rabbit antibody and avidin-biotin-peroxidase (Vector Laboratories), and FITC-conjugated goat F(ab')2 anti-mouse antibody (Becton Dickinson). MAb no. 30 to herpes simplex virus (HSV) gD was described elsewhere (5). Rabbit polyclonal anticalnexin antibody was a gift of A. Helenius, University of Zurich.

cDNA synthesis and reverse transcription-PCR (RT-PCR). Total RNA was extracted with RNA-ZoldB (Tel-Test, Friendswood, Tex.) from 5 × 106 uninfected or HHV-6(B)Z29-infected Molt-3 cells maintained in the presence or absence of phosphonoacetic acid (PAA) (500 µg/ml) from the time of infection, as described elsewhere (35). RNA was precipitated with isopropanol and resuspended in 100 µl of 100 mM sodium acetate-5 mM magnesium sulfate containing 20 U of RNase inhibitor (Ambion, Inc., Austin, Tex.), and traces of DNA were removed by three cycles of digestion with 40 U of DNase H (Boehringer, Mannheim, Germany), each of 1 h at room temperature. RNA was purified by acid phenol-chloroform (1:1) extraction and ethanol precipitation and resuspended in 50 µl of diethylpyrocarbonate-water containing 10 U of RNase inhibitor. One microgram of RNA was reverse transcribed with 10 U of avian myeloblastosis virus reverse transcriptase (cDNA Cycle Kit; Invitrogen, Leek, The Netherlands) and hexamer random primers at 42°C for 1 h and extracted with phenol-chloroform. One-tenth of total cDNA was amplified with primers U51/5X (GAATCATTACCTCGAGTATTCAGGATGGAG) and U51/3 (TAAGAACGCGAGAAAACACT), able to amplify both HHV-6(A) and -6(B) DNA, with 0.15 U of thermostable DNA polymerase (Società Italiana Chimici, Rome, Italy)-20 pmol of each primer-3 mM MgCl2-200 µM (each) dNTP. Amplification was carried out with 35 cycles of 1 min at 94°C, 30 s at 55°C, and 1 min at 72°C, preceded by 5 min at 94°C and supplemented with 5 min at 72°C. To exclude the possibility that positive amplification might result from viral DNA contamination of RNA samples, 200 ng of total RNA was directly subjected to PCR amplification. Specificity of the primers U51/5X and U51/3 for viral sequences was assessed by lack of amplification of uninfected CBMC DNA (10 ng) and the corresponding cDNA. For beta -actin amplification, primers were as described elsewhere (45), and the conditions differed from those above with respect to MgCl2 (2 mM) and amount of primers (40 pmol). Thirty-five cycles were performed at 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s (increase of 1 s at each new cycle) preceded by 5 min at 94°C. U31 primers were described elsewhere (35). For U12 amplification, specific primers were GACAAGCGACGGGATCCACACTGTCATTGAGC and GAACAGACTGCATGATAGATG, and the PCR conditions were the same as those for U51.

Plasmids. U51 ORF (map coordinates 82,574 to 83,479 [AGMN GenBank locus]) (23) was cloned by PCR technology under the immediate-early CMV and T7 promoters in two versions. p51-HA contained the U51 ORF cloned in pcDNA3.1-His vector (Invitrogen) with the heterologous HA epitope and six-histidine tag at the N terminus. p51 contained the entire U51 ORF inserted in pcDNA3.1(-) Myc His vector, which is designed for insertion of Myc-His tag at the C terminus of the engineered proteins. In p51, the natural stop codon of the protein was maintained, thus preventing the addition of the Myc-His tag. For p51-HA cloning, U51 was amplified from 20 ng of HHV-6(A)U1102-infected J-Jhan cell DNA with 1 U of AmpliTaq Gold (Perkin-Elmer) in 3 mM MgCl2-200 µM (each) dNTP, with 10 cycles of 1 min at 94°C, 30 s at 50°C, and 1 min at 72°C, followed by 25 cycles of 1 min at 94°C, 30 s at 60°C, and 1 min (increase of 3 s at each new cycle) at 72°C. Primers U51/5B (GTTTATTCAGGATCCAGAAAGAAACGAAGTC) and U51/3X (CCATATTTGACCCTCGAGGAATCAGCGCC) inserted a BamHI and an XhoI restriction site at 5' and 3' regions, respectively. The U51 ORF in p51-HA contained two substitutions at the 5' end, which resulted in replacement of the first methionine (M) and of glutamate (E) with isoleucine (I) and glutamine (Q), respectively. For p51 cloning, primers 51N5 (GAATCATTACTTCGGCTAGCCAGGATGGAGAAAG) and 51H3ST (GAATCAGCGCCGAAGCTTTATTCTCTTATG) inserted NheI and HindIII restriction sites at the 5' and 3' ends of amplified fragments, respectively. HSV gD gene was cloned in pcDNA3.1 vector to yield pgD, by PCR amplification with primers TATCCTTAAGGGATCCTTTGTGTGGTGCG and TAAGGTCCCAAGCTTACCCCGCAGACC, which introduced BamHI and HindIII restriction sites at 5' and 3' ends of the amplification product, respectively. gD was amplified from 2 ng of HSV-1(F)-infected Vero cell DNA and 1 U of AmpliTaq Gold (Perkin-Elmer) in 2 mM MgCl2-200 µM (each) dNTP, with 15 cycles of 1 min at 94°C, 30 s at 55°C, and 1 min at 72°C, followed by 25 cycles of 1 min at 94°C, 30 s at 60°C, and 1 min (increase of 3 s at each new cycle) at 72°C. pCCR5 was described elsewhere (2).

Production of polyclonal antibodies. Two synthetic peptides spanning the region from residues 142 to 168 and from residues 218 to 235, second and third predicted extracellular domains, respectively, were coupled to polybranched polylysine carrier (Biopolymer Core Facility, Department of Microbiology and Immunology, University of Maryland, Baltimore, Md.). New Zealand White female rabbits were immunized with six subcutaneous injections of 400 µg each, emulsified in Freund adjuvant (Difco Laboratories). When specified, the rabbit sera were cleared of antibodies binding specifically to uninfected cell proteins by preabsorption to acetone-fixed uninfected CBMCs for 2 h at 4°C followed by centrifugation at 4 × g for 15 min.

Synthesis of U51 by in vitro transcription-translation. The U51-HA fusion protein was synthesized by in vitro transcription-translation performed with the TNT T7 quick-coupled transcription-translation system (Promega). One microgram of p51-HA DNA was incubated with TNT Master Mix in the presence of 15 to 30 µCi of [35S]methionine and [35S]cysteine (specific activity, 1,000 Ci/mmol; the Radiochemical Centre, Amersham, England) in a final volume of 50 µl for 90 min at 30°C. For immunoprecipitations, aliquots of the reaction product were reacted with either anti-HA MAb or with the rabbit preimmune and immune sera, and the immunocomplexes were harvested on protein A-Sepharose beads, as detailed below. Aliquots of the reaction mixtures or the immunocomplexes were solubilized in solubilizing solution (2% sodium dodecyl sulfate, 5% beta -mercaptoethanol, 2.75% sucrose, 50 mM Tris HCl [pH 7], bromophenol blue), and separated on 10% polyacrylamide gels cross-linked with N,N'-diallytartardiamide. Fixed gels were soaked in Amplify (the Radiochemical Centre), dried, and analyzed in a Bio-Rad molecular imager.

Immunoprecipitations. Uninfected or HHV-6(A)U1102- or HHV-6(B)Z29-infected CBMCs were labeled for 18 h with a [35S]methionine and [35S]cysteine mixture, 40 to 50 µCi of medium containing 1/10 the usual concentration of unlabeled methionine and cysteine per ml, and 1% fetal bovine serum. HEK-293, Vero, and 143tk- cells were infected with VacT7 (10 PFU/cell) and immediately thereafter transfected with p51-HA. Cells were incubated in medium containing 10 mM hydroxyurea and labeled with 40 to 50 µCi of [35S]methionine and [35S]cysteine per culture from 4 h after beginning of transfection till harvesting at 18 h. Cells were solubilized in PBS* (phosphate-buffered saline [PBS], 1% sodium deoxycholate, 1% Nonidet P-40, 0.1 mg each of TLCK [Nalpha -p-tosyl-L-lysine chloromethyl ketone] and TPCK [N-tosyl-L-phenylalanine chloromethyl ketone] per ml) (Sigma) and centrifuged at 55,000 × g for 75 min. The supernatants were incubated with anti-HA monoclonal or rabbit serum for 3 h on ice; immunocomplexes were harvested on protein A-Sepharose. Immunoprecipitations with rabbit sera were carried out by first reacting the lysates (100 µl) with the corresponding preimmune sera and harvesting the immunocomplexes on protein A-Sepharose beads. The clear supernatants, devoid of proteins reacting aspecifically with preimmune sera, were then reacted with the immune sera.

Cell surface labeling by biotinylation. Uninfected or HHV-6(A)U1102- or HHV-6(B)Z29-infected CBMCs and 143tk- cells infected with VacT7 and transfected with p51-HA and pgD were labeled with [35S]methionine and [35S]cysteine mixture. Immediately prior to harvesting, cells were washed with PBS and incubated in a solution of 75 µg of ImmunoPure Sulfo-NHS-LC-Biotin (Pierce) per ml in 50 mM NaHCO3-100 mM NaCl (pH 8.5) for 30 min at room temperature. Cells were rinsed with 50 mM NaCl in 100 mM Tris (pH 8), lysed with PBS*, and then subjected to immunoprecipitation with polyclonal serum no. 6 or anti-HA MAb, as detailed below. The immunoprecipitated proteins were separated by electrophoresis in a 10% polyacrylamide gel and transferred to a nitrocellulose sheet. The biotinylated proteins were detected by incubation with avidin-biotin-conjugated peroxidase (Vector Laboratories) for 30 min and diaminobenzidine as substrate. The radiolabeled proteins were detected by autoradiography in a Bio-Rad molecular imager.

Immunofluorescence analysis. Monolayer cells were grown on glass coverslips, and suspension cells were allowed to deposit on Dynatech slides (PBI, Milan, Italy). Cells were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature and permeabilized with 0.1% Triton X-100 in PBS, or with cold acetone for 10 min, as specified in the figure legends. The cells were blocked with 20% newborn calf serum for 30 min at 37°C and reacted with primary antibodies diluted in 20% newborn calf serum in PBS. Incubation was for 1 h at room temperature for monolayer cells and for 30 min at 37°C for suspension cells. For enhanced immunofluorescence, binding of primary antibody was detected with a biotinylated anti-rabbit secondary antibody (Vectastain Kit; Vector Laboratories), 30 min at 37°C, followed by incubation with Extravidin-tetramethyl rhodamine isothiocyanate (TRITC) (Sigma) diluted 1:100 in PBS for 30 min at 37°C.

Fluorescence-activated flow cytometry. Transfected, VacT7-infected cells were harvested 14 h postinfection and resuspended in PBS at 5 × 105/ml. When required, cells in 2-ml aliquots were permeabilized by 3 min of incubation at 4°C with 2.5 µl of phosphatidylcholine (20 mg/ml) in methanol and being washed with a large volume of 1% fetal bovine serum in PBS. Both intact and permeabilized cells were then washed and resuspended in ice-cold fluorescence-activated cell sorting (FACS) buffer (Hanks balanced salt solution, 1% fetal bovine serum, 0.02% NaN3) at 107/ml. Fifty microliters of cell suspensions was mixed with 50 µl of appropriate primary antibody diluted in FACS buffer and incubated for 30 min at 4°C. Cells were washed twice with 50 µl of ice-cold FACS buffer, resuspended in 100 µl of appropriate secondary antibody [FITC-conjugated goat F(a,b')2 anti-mouse], diluted 1:50 in FACS buffer, and incubated for 30 min at 4°C. After 20 min, 10 µl of 25-µg/ml propidium iodide in PBS was added. At the end of incubation, cells were washed twice and resuspended in 500 µl of ice-cold FACS buffer. Samples were analyzed in a FACStar fluorimeter (Becton Dickinson, Irvine, Calif.).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Construction of U51 expression vectors. The U51 ORF of HHV-6(A)U1102 (map coordinates 82,574 to 83,479) predicts a protein of 301 amino acid residues, 34.714 kDa in molecular mass, with no predicted N-glycosylation site. Hydrophobicity profiles, carried out with PHDhtm and Profile network prediction of topology (PHDtopology) (40, 41), and studies of well-characterized seven-transmembrane proteins predict that the N terminus is located extracellularly and that the C terminus is located intracellularly (Fig. 1A). The U51 ORF was cloned in pcDNA3.1 vectors, under the control of the T7 and the immediate-early CMV promoters, suitable for both in vitro transcription-translation and eukaryotic expression systems. p51-HA carried the U51 coding sequence fused at the N terminus with a heterologous epitope derived from influenza virus HA and a polyhistidine tract. p51 carried the U51 ORF with no heterologous epitope and no polyhistidine tract. In vitro transcription-translation reaction of p51-HA in the presence of [35S]methionine and [35S]cysteine yielded a protein with an apparent molecular mass of 28 kDa immunoprecipitated with the MAb to HA (Fig. 1B, lanes a and f). The observed Mr is slightly lower than that expected for the protein encoded by the U51 ORF. Addition of microsomes to the reaction did not result in a decrease in the electrophoretic mobility of U51 protein, suggesting that it is not subjected to extensive posttranslational processing, at least in the in vitro system.


View larger version (58K):
[in this window]
[in a new window]
 
FIG. 1.   (A) Hydrophobicity profile of U51 (Kyte-Doolittle) and localization of peptides 1 and 2, employed as antigens to derive immune sera 8 and 6, respectively. (B) U51 expression by in vitro transcription-translation (IVTT) (lane a). In vitro transcription-translation-produced U51 (arrowhead) was immunoprecipitated with preimmune (PI) and immune (I) sera 6 (lanes b and c) and 8 (lanes d and e) and anti-HA (alpha -HA) antibody (lane f). aa, amino acid; TM, transmembrane; N-ter and C-ter, N and C termini, respectively. Number at left show molecular mass (in kilodaltons).

Production of antipeptide antibodies. Peptides 1 and 2, spanning residues 142 to 168 and 218 to 235, respectively, are predicted to be located in the second and third extracellular domains, respectively (Fig. 1A). They were coupled to polybranched polylysine carrier and served as immunogens to derive polyclonal sera 8 and 6, respectively. Both sera immunoprecipitated U51 synthesized in vitro in the presence of [35S]methionine (Fig. 1B, lanes c and e) and were even more effective than anti-HA MAb (lane f), particularly serum 6. Preimmune sera (lanes b and d) did not immunoprecipitate the U51 protein, demonstrating the specificity of the immune sera.

Transient expression of U51 gene. To establish a eukaryotic expression system, HEK-293, 143tk-, and Vero cells were transfected with p51-HA DNA and labeled with [35S]methionine and [35S]cysteine from 4 h after transfection till harvesting at 18 h. Figure 2 shows that, in cells infected immediately prior to transfection with a recombinant vaccinia virus carrying the T7 RNA polymerase (VacT7), U51 expression was readily detected in all three cell lines by immunoprecipitation with serum 6 and with anti-HA MAb (black arrowhead). Extent of expression was higher at 18 than at 8 h after transfection (data shown for 18 h). Serum 8, but not serum 6, immunoprecipitated in addition a 33-kDa M protein visible in VacT7-infected cells and not in uninfected cells, suggesting a possible cross-reactivity of the serum with VacT7-encoded proteins. Cells transfected with plasmid alone showed no expression of U51 protein in any of the cells tested (lane b for HEK-293 cells). The reason for this is unclear, as, generally, pcDNA3 vectors allow strong constitutive expression in the cell lines employed in this study. Whether this reflects a specific instability of U51 mRNA is not known. In all subsequent transient expression experiments, U51 synthesis was induced with VacT7 infection.


View larger version (62K):
[in this window]
[in a new window]
 
FIG. 2.   Transient expression of U51 in human monolayer HEK-293, 143tk-, and Vero cells infected with VacT7 and transfected with p51-HA (p51-HA) or mock transfected (no). Cells were labeled with [35S]methionine from 4 h after transfection till harvesting at 18 h. U51 (black arrowhead) was immunoprecipitated by immune sera 6 and 8 and by anti-HA-tag MAb. Numbers at right show molecular mass in kilodaltons.

U51 is not expressed at the plasma membrane and accumulates in the ER of transfected human monolayer cells. The cell surface localization of U51 protein in HEK-293 and 143tk- cells transfected with p51-HA, or p51 (no heterologous tag), was investigated by immunofluorescence microscopy. As a control for cell surface localization, replicate cultures were transfected with plasmid pgD, carrying the gene for the HSV membrane protein gD gene, or plasmid pCCR5, carrying the gene for CCR5, a seven-transmembrane protein, cloned in pcDNA3.1 and pcDNA3 vector, respectively. In all cultures, expression was induced by preinfection with VacT7. As shown in Fig. 3, in 143tk- cells U51 was located to the cytoplasm with a diffuse reticulum-like pattern. Surprisingly, in nonpermeabilized cells U51 was not detectable, suggesting either a very low expression or its absence from the plasma membrane. This was not the consequence of impaired transport of U51 due to the heterologous HA epitope, since the untagged version of U51 (p51) also failed to be detected at the cell surface (Fig. 3c). As expected, HSV gD and CCR5 were readily detected at the plasma membrane of transfected 143tk- cells (Fig. 3e to h). The results with HEK-293 cells (data not shown) were essentially similar to those obtained in 143tk- cells. A large portion of U51 in transfected 143tk- cells accumulated in the ER, as it colocalized with the ER-resident calnexin (25) in a double immunofluorescence assay (Fig. 3i and j).


View larger version (55K):
[in this window]
[in a new window]
 
FIG. 3.   Immunofluorescence localization of U51 (a to d and i) and, for comparison, of HSV gD (e and f), CCR5 (g and h), and calnexin (j) in transiently expressing 143tk- cells. Cells were preinfected with VacT7 (7 PFU/cell) and immediately thereafter transfected with p51-HA (a, b, i, and j), p51 (c and d), pgD (e and f), and pCCR5 (g and h). Cells were fixed at 14 h after transfection and stained with anti-HA MAb (a, b, and i), immune serum 6 (c and d), MAb 30 to gD (e and f), MAb to CCR5 (g and h), and rabbit polyclonal serum to calnexin (j). Cells were paraformaldehyde fixed and permeabilized (b, d, f, h, i, and j) or not permeabilized (a, c, e, and g) with Triton X-100 prior to reaction with appropriate primary antibodies. (i and j) Double immunofluorescence of the same cells transfected with pU51-HA and stained with anti-HA antibody (i) or anticalnexin antibody (j).

As availability of an expression system is a key prerequisite to study the properties of U51 and its role in the HHV-6 infectious cycle, we checked for the presence of U51 at the plasma membrane of transfected cells with higher-sensitivity assays, specifically with fluorescence-activated flow cytometry and with immunoprecipitation of biotinylated proteins.

By fluorescence-activated flow cytometry, expression of U51 in p51-HA-transfected HEK-293 and 143tk- cells was analyzed with anti-HA MAb prior to and after cell permeabilization. Positive controls consisted of intact and permeabilized pCCR5-transfected cells reacted with anti-CCR5 MAb. Even by this assay, U51 could be detected in permeabilized cells (Fig. 4d) but not in intact cells (Fig. 4b). CCR5 was readily detected both in intact cells (Fig. 4f) and in permeabilized cells (Fig. 4h). Figure 4 shows results with HEK-293 cells; results with 143tk- cells were very similar.


View larger version (34K):
[in this window]
[in a new window]
 
FIG. 4.   Profile of fluorescence-activated flow cytometry of HEK-293 cells transiently expressing U51 protein (p51-HA) and stained with anti-HA antibody (alpha HA) (b and d) or transiently expressing CCR5 (pCCR5) and stained with anti-CCR5 antibody (alpha CCR5) (f and h). The cutoff values were defined in cells transfected with pCCR5 and stained with anti-HA (a and c) or in cells transfected with p51-HA and stained with the heterologous anti-CCR5 antibody (e and g). Cutoff values were defined separately for permeabilized cells (c and g) and intact cells (a and e). (a, b, e, and f) Intact cells; (c, d, g, and h) permeabilized cells.

In a further series of experiments, cells cotransfected with p51 and pgD were metabolically labeled with a mixture of [35S]methionine and [35S]cysteine, to detect the bulk of proteins made in the cells, and with biotin immediately prior to harvesting, to detect cell-surface-located proteins. U51 and gD were then immunoprecipitated from the cell lysates, separated by denaturing electrophoresis, transferred to nitrocellulose sheets, and detected by autoradiography and avidin-peroxidase staining. U51 was detectable only as radioactive protein and not as biotinylated species (Fig. 5, compare lane b, panel A, with lane e, panel B) while the control membrane protein HSV gD was detectable both as radiolabeled and as biotinylated species (Fig. 5, compare lane c, panel A, with lane f, panel B). The observation that U51 could not be detected at the plasma membrane of transfected monolayer cells even by sensitive assays like biotinylation and fluorescence-activated flow cytometry argues against a low-level cell surface expression and is rather consistent with the lack of cell-surface-located U51 in these cells. Accumulation of a large portion in the ER indicates a block in transport in early compartments of the exocytic pathway.


View larger version (47K):
[in this window]
[in a new window]
 
FIG. 5.   Lack of cell surface expression of U51 in transfected 143tk- cells detected by biotinylation. VacT7-preinfected 143tk- cells were transfected with p51-HA (lanes b and e), cotransfected with p51-HA and pgD (lanes c and f), or mock transfected (lanes a and d). Cells were metabolically labeled with [35S]methionine and [35S]cysteine and surface labeled with biotin immediately prior to harvesting. U51 and gD were immunoprecipitated, separated by electrophoresis, and transferred to a nitrocellulose sheet. (A) Autoradiographic image. (B) Avidin-peroxidase staining of biotinylated proteins. Note that U51 is detectable only as radiolabeled species (black arrowhead). gD is detectable both as radiolabeled and as biotinylated species (white arrowheads). Numbers at left show molecular mass in kilodaltons.

U51 is expressed at the cell surface of transfected T-lymphocytic lines. We investigated the possibility that expression of U51 at the cell surface requires a cell-specific function present in T lymphocytes. J-Jhan, Molt-3, and Jurkat cells, preinfected with VacT7, were transfected with the two plasmids carrying the untagged or tagged version of U51 gene and analyzed by fluorescence microscopy with immune serum 6 or anti-HA-tag MAb. In contrast with the results obtained with human monolayer cells, in all three T-lymphocytic lines U51 could be detected also in nonpermeabilized cells at the cell surface, with a characteristic peripheral distribution pattern almost indistinguishable from that of CCR5 transfected in replicate cultures (typical examples are shown in Fig. 6b, d, and f). The immunofluorescence staining was specific, as p51-HA- or p51-transfected cells did not stain with preimmune serum 6, anti-CCR5 MAb, or secondary antibodies alone, and conversely, cells transfected with pCCR5 did not stain with serum 6, nor with anti-HA MAb (Fig. 6g and h). The overall efficiency of transfection and extent of expression were rather low, a characteristic observed in transfections of T-lymphocytic lines. The results indicate that in T-cell lines U51 is transported to the cell surface and accumulates in this compartment at a level detectable by immunofluorescence. A comparison of the degree of U51 expression in transfected monolayer cells with that in T-lymphocytic lines revealed a brighter staining in the monolayer cells, indicative of an overall higher level of expression (compare permeabilized cells in Fig. 3b and d with those in Fig. 6a and c). This rules out the possibility that lack of detection of U51 at the plasma membrane of transfected monolayer cells was simply the consequence of an overall low level of expression.


View larger version (57K):
[in this window]
[in a new window]
 
FIG. 6.   Cell surface localization of U51 and, for comparison, of CCR5, in VacT7-preinfected T lymphocytes transfected with p51 or p51-HA. (a and b) J-Jhan cells transfected with p51 and stained with immune serum 6. (c and d) Molt-3 cells transfected with p51-HA and stained with anti-HA MAb. (e and f) Jurkat cells transfected with pCCR5 and stained with anti-CCR5 MAb. (g and h) Jurkat cells transfected with pCCR5 and stained with serum 6 and anti-HA MAb. Cells were fixed with 4% paraformaldehyde. (a, c, e, g, and h) Triton X-100-permeabilized cells. (b, d, and f) Unpermeabilized cells.

U51 protein is transported to the cell surface in HHV-6-infected CBMCs. As a preliminary assay to ascertain if U51 is made in HHV-6-infected CBMCs, indirect immunofluorescence of HHV-6(A)U1102- and HHV-6(B)Z29-infected CBMCs or T-cell lines was performed with serum 6 by standard methods. As only very low levels of specific fluorescence were detected, an enhanced immunofluorescence assay was developed, in which binding of primary antibody is revealed by biotinylated secondary antibody followed by Extravidin coupled to TRITC. By this assay, U51 could be detected in HHV-6(A)- and HHV-6(B)-infected CBMCs and localized mainly to round cytoplasmic structures (Fig. 7). However, cell surface expression could not be analyzed due to the overall low level of expression. To address this latter question, we employed the cell surface biotinylation-immunoprecipitation assay used previously for transfected monolayer cells. HHV-6(A)U1102- and HHV-6(B)Z29-infected CBMCs were labeled with [35S]methionine and [35S]cysteine for 12 h and with biotin immediately prior to harvesting. A 28-kDa protein could be immunoprecipitated specifically from HHV-6(A)U1102-infected and HHV-6(B)Z29-infected CBMCs by immune serum 6 (Fig. 8A and B, lanes d and h). The protein was not precipitated by the preimmune serum (lanes b and f) and was absent from uninfected cells (lanes c and g), accounting for the specificity of the precipitated protein. The apparent Mr was slightly lower than that of the in vitro transcription-translation U51 product, as expected, given that the in vitro-made protein carried the HA heterologous epitope and the polyhistidine stretch. Panel C shows that U51 was detectable also as a biotinylated species (lane l), demonstrating that in HHV-6-infected CBMCs it is expressed at the cell surface [results shown for HHV-6(B)Z29].


View larger version (128K):
[in this window]
[in a new window]
 
FIG. 7.   Immunofluorescence staining of U51 in HHV-6(B)Z29-infected CBMCs. Cells fixed with acetone were reacted with immune serum 6, followed by biotinylated anti-mouse antibodies and Extravidin coupled to TRITC.


View larger version (39K):
[in this window]
[in a new window]
 
FIG. 8.   Synthesis of U51 in CBMCs infected with HHV-6(A)U1102 (A) or HHV-6(B)Z29 (B and C). (A and B) Detection of U51 by metabolic labeling with [35S]methionine and [35S]cysteine (35S-met). (C) Detection of cell surface expression by labeling with biotin prior to harvesting (biotin). Immunoprecipitations were performed on lysates of infected (+) or uninfected (-) CBMCs with immune serum 6 (Immune) or with preimmune serum (Pre). Note that U51 (black arrowheads) was detectable as radiolabeled protein in lanes d and h and as biotinylated species in lane l. Numbers at left show molecular mass in kilodaltons.

HHV-6(A)- and HHV-6(B)-infected CBMCs express U51 mRNA as an early gene. As this work reports the first identification of U51 in HHV-6-infected CBMCs, it was of interest to determine the temporal regulation of U51 gene transcription. We checked whether U51 mRNA is expressed as an early or a late gene by RT-PCR of RNA extracted from Molt-3 cells infected with HHV-6(B)Z29 and maintained in the presence or absence of PAA (a specific inhibitor of herpesvirus DNA replication) for 24 h. U51 temporal regulation of expression was compared to that of U31, a beta -early gene (35), and that of U12, a late gamma -gene (27). The results in Fig. 9 show that U51 mRNA was expressed in both PAA-treated and untreated cells, demonstrating that it is regulated either as an immediate-early gene or as an early gene. U31 and U12 were expressed as early or late genes, respectively, as described elsewhere (27, 35). beta -Actin gene expression was not affected by PAA exposure, as expected. All specific amplification products were detectable when the infected-cell DNA was used as template and were not detectable when the RNA before RT was used as template, ruling out contamination of the RNA preparations with DNA.


View larger version (73K):
[in this window]
[in a new window]
 
FIG. 9.   Comparative analysis of U51, U31, U12, and beta -actin temporal regulation of transcription by RT-PCR in HHV-6(B)Z29-infected Molt-3 cells. In all panels, amplification of the indicated specific fragment from RNA (lanes 3 and 4), cDNA (lanes 5 to 7), and cellular DNA (lanes 1) is shown. Lanes 2, negative control of reaction lacking template (Mock). Lanes 5, amplification from cDNA retrotranscribed from the viral inoculum (i) shows that the inoculum was free of RNA. Lanes 4 and 7, nucleic acids from PAA-treated cells (+). Lanes 3 and 6, nucleic acids from cells not PAA treated (-). MW, molecular weight markers. Arrows point to the specific amplification products: U51, 515 bp; U31, 831 bp; U12, 442 and 365 bp for the unspliced and spliced forms, respectively; beta -actin, 654 bp.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

U51 ORF of HHV-6 predicts a protein of 301 amino acid residues with seven transmembrane domains (23). There are at least three examples of seven-transmembrane proteins encoded by different members of the Herpesviridae family. They contribute to the lifestyle of the specific viruses with varied mechanisms: HHV-8 ORF74 contributes to the oncogenic potential of the virus (3, 9), and HCMV US28 acts as coreceptor for human immunodeficiency virus (42). Herpesvirus saimiri encodes a chemokine receptor homolog, ECRF3 (37), that is functional in signaling (1).

Here we report on the first identification of the protein encoded by HHV-6 U51 gene and on a peculiar requirement for a cell-specific function present in T lymphocytes for expression at the cell surface. This property was not observed previously for seven-transmembrane proteins encoded by other herpesviruses and, to our knowledge, by other viruses.

Both variant A and variant B HHV-6 express U51 in activated CBMCs and in T-lymphocytic lines. The temporal regulation of U51 mRNA expression differs from that of U12, as U51 is expressed as an immediate-early or an early gene, whereas U12 is expressed as a late gene (27). Thus, the two seven-transmembrane proteins encoded by HHV-6 appear to be subjected to different temporal regulations of expression. In CBMCs, the U51 protein accumulates in fairly low amounts and localizes mainly to cytoplasmic round structures and, to a limited extent, to the plasma membrane.

When transiently expressed in human monolayer HEK-293 and 143tk- cells, the U51 protein could not be detected at the plasma membrane, despite the fact that it was made in relatively high amounts. The protein accumulated predominantly in the ER, as it colocalized with the ER-resident protein calnexin (25), indicative of a block in early compartments of the exocytic pathway. Lack of cell surface expression could be due either to failure of the protein to reach the plasma membrane or to transport to the plasma membrane followed by a very rapid recycling to other compartments. Recycling is expected to result in a low-level steady-state expression rather than in an absence of protein. The sensitivity of the assays employed argues for absence from the plasma membrane. Retention in ER also argues for a defect in transport along the exocytic pathway. In contrast with the monolayer cells, in transfected T-cell lines U51 reached the cell surface. The results provide evidence that intracellular trafficking of U51 is subject to a cell-type-specific modulation and that expression at the plasma membrane requires a function provided specifically by activated primary T lymphocytes and by T-lymphocytic lines.

Among herpesvirus-encoded proteins, gH represents a well-known example of a membrane protein whose intracellular trafficking to the plasma membrane requires a cooperation with another protein. gH is conserved among all the known members of the Herpesviridae family and plays a role in virion infectivity and cell-to-cell spread of the viruses (16, 21, 22). gH accumulates intracellularly in cells transfected with the single gene but is readily transported to the plasma membrane in infected cells or in cells cotransfected with gH and gL genes. Heterodimer formation with gL allows gH to assume the proper folding in the ER and to exit this compartment (26, 39). The notable difference between gH and HHV-6 U51 is that in the case of U51 a cellular function, rather than a viral protein, cooperates in its intracellular trafficking. The cellular protein which accomplishes this function for U51 protein, as well as its mode and site of action, remains to be determined. An interesting model is provided by the HCMV gB, whose accumulation at the cell surface, rather than its transport to this compartment, appears to be regulated in a cell-type-dependent manner. Thus, in human fibroblasts, HCMV gB is readily detected at the cell surface, whereas in the human astrocytoma cell line U373 it accumulates intracellularly. In this case, the differential steady-state plasma membrane expression was shown to be dependent on the state of phosphorylation of a serine residue located in the cytoplasmic tail of the glycoprotein (15). Also the trafficking of HHV-6 gB appears to be peculiar, in that in HHV-6-infected lymphocytes HHV-6 gB is present in intracellular vesicles and vacuoles and in intracellular and extracellular virions but is absent from the plasma membrane (11). As an expression system was not developed in that case, influence of the cell type in HHV-6 gB trafficking was not investigated.

Current data indicate that the peculiar trafficking properties of U51 may result in modulation of surface expression in cells from different lineages. As HHV-6 infection in the human host does not appear to be restricted to T lymphocytes and monocytes but extends to a number of cell types as yet unidentified (for a review, see reference 7), it is conceivable that even in vivo the trafficking properties of U51 may result in differential plasma membrane exposures in different cell types. Thus, in productively infected T lymphocytes, and possibly monocytes, U51 may be present at the plasma membrane, whereas in other cell types it may be absent from the plasma membranes. It is tempting to speculate that differential displays at the cell surface may represent a way by which U51 activity and function are regulated in vivo in a cell-type-dependent manner.

    ACKNOWLEDGMENTS

We thank T. Baechi, University of Zurich, for confocal microscopy analysis of transfected cells; Elisabetta Romagnoli and Giada Frascaroli for assistance in viral and cell cultivation and immunofluorescence detection of U51; and A. Helenius, University of Zurich, for the gift of anticalnexin rabbit antibody.

The work was supported by grants from the AIDS Project from Istituto Superiore di Sanità contract no. 40A.0.22 to Department of Experimental Pathology-Section on Microbiology and Virology and contract no. 30A.0.72 to Institute of Pharmacological Research "Mario Negri;" BIOMED2 BMH4 CT95 1016 grant from UE; Target Project in Biotechnology; MURST (40%), University of Bologna (60%); and pluriannual plan. M.L. was a recipient of a fellowship from the Italian Federation for Cancer Research.

    FOOTNOTES

* Corresponding author. Mailing address: Dipartimento di Patologia Sperimentale, Sezione di Microbiologia e Virologia, Via San Giacomo, 12, 40126 Bologna, Italy. Phone: 39 051 354733/34. Fax: 39 051 354747. E-mail: campadel{at}kaiser.alma.unibo.it.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Ahuja, S. K., and P. M. Murphy. 1993. Molecular piracy of mammalian interleukin-8 receptor type B by herpesvirus saimiri. J. Biol. Chem. 268:20691-20694[Abstract/Free Full Text].
2. Alkhatib, G., M. Locati, P. E. Kennedy, P. M. Murphy, and E. A. Berger. 1997. HIV-1 coreceptor activity of CCR5 and its inhibition by chemokines: independence from G protein signaling and importance of coreceptor downmodulation. Virology 234:340-348[Medline].
3. Arvanitakis, L., E. Geras Raaka, A. Varma, M. C. Gershengorn, and E. Cesarman. 1997. Human herpesvirus KSHV encodes a constitutively active G-protein-coupled receptor linked to cell proliferation. Nature 385:347-350[Medline].
4. Bankier, A. T., S. Beck, R. Bohni, C. M. Brown, R. Cerny, M. S. Chee, C. A. D. Hutchison, T. Kouzarides, J. A. Martignetti, E. Preddie, et al. 1991. The DNA sequence of the human cytomegalovirus genome. DNA Seq. 2:1-12[Medline].
5. Brandimarti, R., T. Huang, B. Roizman, and G. Campadelli Fiume. 1994. Mapping of herpes simplex virus 1 genes with mutations which overcome host restrictions to infection. Proc. Natl. Acad. Sci. USA 91:5406-5410[Abstract/Free Full Text].
6. Braun, D. K., G. Dominguez, and P. E. Pellett. 1997. Human herpesvirus 6. Clin. Microbiol. Rev. 10:521-567[Abstract].
7. Campadelli-Fiume, G., P. Mirandola, and L. Menotti. Human herpesvirus 6: an emerging pathogen. Emerg. Infect. Dis., in press.
8. Carrigan, D. R., W. R. Drobyski, S. K. Russler, M. A. Tapper, K. K. Knox, and R. C. Ash. 1991. Interstitial pneumonitis associated with human herpesvirus-6 infection after marrow transplantation. Lancet 338:147-149[Medline].
9. Cesarman, E., R. G. Nador, F. Bai, R. A. Bohenzky, J. J. Russo, P. S. Moore, Y. Chang, and D. M. Knowles. 1996. Kaposi's sarcoma-associated herpesvirus contains G protein-coupled receptor and cyclin D homologs which are expressed in Kaposi's sarcoma and malignant lymphoma. J. Virol. 70:8218-8223[Abstract].
10. Challoner, P. B., K. T. Smith, J. D. Parker, D. L. MacLeod, S. N. Coulter, T. M. Rose, E. R. Schultz, J. L. Bennett, R. L. Garber, M. Chang, et al. 1995. Plaque-associated expression of human herpesvirus 6 in multiple sclerosis. Proc. Natl. Acad. Sci. USA 92:7440-7444[Abstract/Free Full Text].
11. Cirone, M., G. Campadelli Fiume, L. Foà-Tomasi, M. R. Torrisi, and A. Faggioni. 1994. Human herpesvirus 6 envelope glycoproteins B and H-L complex are undetectable on the plasma membrane of infected lymphocytes. AIDS Res. Hum. Retroviruses 10:175-179[Medline].
12. Davis Poynter, N. J., D. M. Lynch, H. Vally, G. R. Shellam, W. D. Rawlinson, B. G. Barrell, and H. E. Farrell. 1997. Identification and characterization of a G protein-coupled receptor homolog encoded by murine cytomegalovirus. J. Virol. 71:1521-1529[Abstract].
13. Di Luca, D., P. Mirandola, T. Ravaioli, B. Bigoni, and E. Cassai. 1996. Distribution of HHV-6 variants in human tissues. Infect. Agents Dis. 5:203-214[Medline].
14. Downing, R. G., N. Sewankambo, D. Serwadda, R. Honess, D. Crawford, R. Jarrett, and B. E. Griffin. 1987. Isolation of human lymphotropic herpesviruses from Uganda. Lancet ii:390.
15. Fish, K. N., C. Soderberg-Naucler, and J. A. Nelson. 1998. Steady-state plasma membrane expression of human cytomegalovirus gB is determined by the phosphorylation state of Ser900. J. Virol. 72:6657-6664[Abstract/Free Full Text].
16. Foà-Tomasi, L., E. Avitabile, A. Boscaro, R. Brandimarti, R. Gualandri, R. Manservigi, F. Dall'Olio, F. Serafini Cessi, and G. C. Fiume. 1991. Herpes simplex virus (HSV) glycoprotein H is partially processed in a cell line that expresses the glycoprotein and fully processed in cells infected with deletion or ts mutants in the known HSV glycoproteins. Virology 180:474-482[Medline].
17. Foà-Tomasi, L., A. Boscaro, S. di Gaeta, and G. Campadelli Fiume. 1991. Monoclonal antibodies to gp100 inhibit penetration of human herpesvirus 6 and polykaryocyte formation in susceptible cells. J. Virol. 65:4124-4129[Abstract/Free Full Text].
18. Foà-Tomasi, L., S. Guerrini, T. Huang, and G. Campadelli-Fiume. 1992. Characterization of human herpesvirus-6(U1102) and (GS) gp112 and identification of the Z29-specified homolog. Virology 191:511-516[Medline].
19. Fuerst, T. R., E. G. Niles, F. W. Studier, and B. Moss. 1986. Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 83:8122-8126[Abstract/Free Full Text].
20. Gao, J. L., and P. M. Murphy. 1994. Human cytomegalovirus open reading frame US28 encodes a functional beta chemokine receptor. J. Biol. Chem. 269:28539-28542[Abstract/Free Full Text].
21. Gompels, U., and A. Minson. 1986. The properties and sequence of glycoprotein H of herpes simplex virus type 1. Virology 153:230-247[Medline].
22. Gompels, U. A., and A. C. Minson. 1989. Antigenic properties and cellular localization of herpes simplex virus glycoprotein H synthesized in a mammalian cell expression system. J. Virol. 63:4744-4755[Abstract/Free Full Text].
23. Gompels, U. A., J. Nicholas, G. Lawrence, M. Jones, B. J. Thomson, M. E. Martin, S. Efstathiou, M. Craxton, and H. A. Macaulay. 1995. The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology 209:29-51[Medline].
24. Graham, K. A., A. S. Lalani, J. L. Macen, T. L. Ness, M. Barry, L. Y. Liu, A. Lucas, I. Clark Lewis, R. W. Moyer, and G. McFadden. 1997. The T1/35kDa family of poxvirus-secreted proteins bind chemokines and modulate leukocyte influx into virus-infected tissues. Virology 229:12-24[Medline].
25. Hammond, C., I. Braakman, and A. Helenius. 1994. Role of N-linked oligosaccharide recognition, glucose trimming, and calnexin in glycoprotein folding and quality control. Proc. Natl. Acad. Sci. USA 91:913-917[Abstract/Free Full Text].
26. Hutchinson, L., H. Browne, V. Wargent, N. Davis Poynter, S. Primorac, K. Goldsmith, A. C. Minson, and D. C. Johnson. 1992. A novel herpes simplex virus glycoprotein, gL, forms a complex with glycoprotein H (gH) and affects normal folding and surface expression of gH. J. Virol. 66:2240-2250[Abstract/Free Full Text].
27. Isegawa, Y., Z. Ping, K. Nakano, N. Sugimoto, and K. Yamanishi. 1998. Human herpesvirus 6 open reading frame U12 encodes a functional beta-chemokine receptor. J. Virol. 72:6104-6112[Abstract/Free Full Text].
28. Kempf, W., V. Adams, N. Wey, R. Moos, M. Schmid, E. Avitabile, and G. Campadelli Fiume. 1997. CD68+ cells of monocyte/macrophage lineage in the environment of AIDS-associated and classic-sporadic Kaposi sarcoma are singly or doubly infected with human herpesviruses 7 and 6B. Proc. Natl. Acad. Sci. USA 94:7600-7605[Abstract/Free Full Text].
29. Kolakowski, L. F., Jr. 1994. GCRDb: a G-protein-coupled receptor database. Receptors Channels 2:1-7[Medline].
30. Kondo, K., T. Kondo, T. Okuno, M. Takahashi, and K. Yamanishi. 1991. Latent human herpesvirus 6 infection of human monocytes/macrophages. J. Gen. Virol. 72:1401-1408[Abstract/Free Full Text].
31. Lindquester, G. J., N. Inoue, R. D. Allen, J. W. Castelli, F. R. Stamey, T. R. Dambaugh, J. J. O'Brian, R. M. Danovich, N. Frenkel, and P. E. Pellett. 1996. Restriction endonuclease mapping and molecular cloning of the human herpesvirus 6 variant B strain Z29 genome. Arch. Virol. 141:367-379[Medline].
32. Lopez, C., P. Pellett, J. Stewart, C. Goldsmith, K. Sanderlin, J. Black, D. Warfield, and P. Feorino. 1988. Characteristics of human herpesvirus-6. J. Infect. Dis. 157:1271-1273[Medline].
33. Lusso, P., M. S. Malnati, A. Garzino Demo, R. W. Crowley, E. O. Long, and R. C. Gallo. 1993. Infection of natural killer cells by human herpesvirus 6. Nature 362:458-462[Medline].
34. Margulies, B. J., H. Browne, and W. Gibson. 1996. Identification of the human cytomegalovirus G protein-coupled receptor homologue encoded by UL33 in infected cells and enveloped virus particles. Virology 225:111-125[Medline].
35. Mirandola, P., P. Menegazzi, S. Merighi, T. Ravaioli, E. Cassai, and D. Di Luca. 1998. Temporal mapping of transcripts in herpesvirus 6 variants. J. Virol. 72:3837-3844[Abstract/Free Full Text].
36. Neote, K., D. DiGregorio, J. Y. Mak, R. Horuk, and T. J. Schall. 1993. Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor. Cell 72:415-425[Medline].
37. Nicholas, J., K. R. Cameron, and R. W. Honess. 1992. Herpesvirus saimiri encodes homologues of G protein-coupled receptors and cyclins. Nature 355:362-365[Medline].
38. Rawlinson, W. D., H. E. Farrell, and B. G. Barrell. 1996. Analysis of the complete DNA sequence of murine cytomegalovirus. J. Virol. 70:8833-8849[Abstract].
39. Roberts, S. R., M. Ponce de Leon, G. H. Cohen, and R. J. Eisenberg. 1991. Analysis of the intracellular maturation of the herpes simplex virus type 1 glycoprotein gH in infected and transfected cells. Virology 184:609-624[Medline].
40. Rost, B., R. Casadio, P. Fariselli, and C. Sander. 1995. Transmembrane helices predicted at 95% accuracy. Protein Sci. 4:521-533[Abstract].
41. Rost, B., P. Fariselli, and R. Casadio. 1996. Topology prediction for helical transmembrane proteins at 86% accuracy. Protein Sci. 5:1704-1718[Abstract].
42. Rucker, J., A. L. Edinger, M. Sharron, M. Samson, B. Lee, J. F. Berson, Y. Yi, B. Margulies, R. G. Collman, B. J. Doranz, M. Parmentier, and R. W. Doms. 1997. Utilization of chemokine receptors, orphan receptors, and herpesvirus-encoded receptors by diverse human and simian immunodeficiency viruses. J. Virol. 71:8999-9007[Abstract].
43. Smith, C. A., T. D. Smith, P. J. Smolak, D. Friend, H. Hagen, M. Gerhart, L. Park, D. J. Pickup, D. Torrance, K. Mohler, K. Schooley, and R. G. Goodwin. 1997. Poxvirus genomes encode a secreted, soluble protein that preferentially inhibits beta chemokine activity yet lacks sequence homology to known chemokine receptors. Virology 236:316-327[Medline].
44. Smith, G. L., J. A. Symons, A. Khanna, A. Vanderplasschen, and A. Alcami. 1997. Vaccinia virus immune evasion. Immunol. Rev. 159:137-154[Medline].
45. Walther, W., U. Stein, and C. Eder. 1994. RNA analysis using miniprep RNA in reverse transcription PCR. BioTechniques 17:674-675[Medline].
46. Wu, C. A., and J. D. Shanley. 1998. Chronic infection of human umbilical vein endothelial cells by human herpesvirus-6. J. Gen. Virol. 79:1247-1256[Abstract].
47. Yamanishi, K., T. Okuno, K. Shiraki, M. Takahashi, T. Kondo, Y. Asano, and T. Kurata. 1988. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet ii:1065-1067.


Journal of Virology, January 1999, p. 325-333, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Menotti, L.
Right arrow Articles by Campadelli-Fiume, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Menotti, L.
Right arrow Articles by Campadelli-Fiume, G.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Mol. Cell. Biol. Microbiol. Mol. Biol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS