Previous Article | Next Article 
Journal of Virology, January 1999, p. 260-269, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Adeno-Associated Virus Type 2 Regulatory
Proteins Rep78 and Rep68 Interact with the Transcriptional
Coactivator PC4
Stefan
Weger,1,2
Meike
Wendland,2
Jürgen A.
Kleinschmidt,3 and
Regine
Heilbronn1,2,*
Institut für Infektionsmedizin,
Abteilung Virologie, Freie Universität Berlin, D-12203
Berlin,1
Max-Planck-Institut
für Biochemie, D-82152 Martinsried,2 and
Deutsches Krebsforschungszentrum, Forschungsschwerpunkt
Angewandte Tumorvirologie, D-69120 Heidelberg,3
Germany
Received 22 July 1998/Accepted 12 October 1998
 |
ABSTRACT |
The adeno-associated virus type 2 (AAV-2) Rep78/Rep68 regulatory
proteins are pleiotropic effectors of viral and cellular DNA
replication, of cellular transformation by viral and cellular oncogenes, and of homologous and heterologous gene expression. To
search for cellular proteins involved in mediating these functions, we
used Rep68 as bait in the yeast two-hybrid system and identified the
transcriptional coactivator PC4 as a Rep interaction partner. PC4 has
been shown to mediate transcriptional activation by a variety of
sequence-specific transcription factors in vitro. Rep amino acids 172 to 530 were sufficient and amino acids 172 to 224 were absolutely
necessary for the interaction with PC4. The PC4 domains required for
interaction were mapped to the C-terminal single-stranded DNA-binding
domain of PC4. In glutathione S-transferase (GST) pull-down
assays, in vitro-transcribed and -translated Rep78 or Rep68 proteins
were bound specifically by GST-PC4 fusion proteins. Similarly, PC4
expressed in Escherichia coli was bound by GST-Rep fusion
proteins, confirming the direct interaction between Rep and PC4 in
vitro. Rep was found to have a higher affinity for the
nonphosphorylated, transcriptionally active form of PC4 than for
the phosphorylated, transcriptionally inactive form. The latter is
predominant in nuclear extracts of HeLa or 293 cells. In the yeast
system, but not in vitro, Rep-PC4 interaction was disrupted by a point
mutation in the putative nucleotide-binding site of Rep68, suggesting
that a stable interaction between Rep and PC4 in vivo is ATP dependent.
This mutation has also been shown to impair Rep function in AAV-2 DNA
replication and in inhibition of gene expression and inducible DNA
amplification. Cytomegalovirus promoter-driven overexpression of PC4
led to transient accumulation of nonphosphorylated PC4 with concomitant
downregulation of all three AAV-2 promoters in the absence of helper
virus. In the presence of adenovirus, this effect was relieved. These
results imply an involvement of the transcriptional coactivator PC4 in
the regulation of AAV-2 gene expression in the absence of helper virus.
 |
INTRODUCTION |
Adeno-associated virus type 2 (AAV-2) is a human parvovirus that requires coinfection with a helper
virus, for example, adenovirus (3) or herpesvirus
(10), for efficient DNA replication (8) and gene
expression (11). However, a low level of helper-independent replication can also be detected in cells exposed to genotoxic agents
(63-65). AAV-2 contains a linear single-stranded DNA genome of 4.7 kb (11, 55) with two open reading frames (ORFs)
flanked by two 145-bp inverted terminal repeats (ITRs). The ORF in the right half of the AAV genome encodes the three structural proteins VP1,
VP2, and VP3, while the ORF in the left half of the genome encodes four
overlapping nonstructural proteins, termed Rep proteins. Rep78 and
Rep68, a C-terminally spliced version of Rep78, regulate many steps in
the AAV-2 life cycle, including DNA replication (23, 56),
gene expression (41, 57), and site-specific integration
(4, 53, 60). Rep78 and Rep68 possess the following activities: DNA-binding, site- and strand-specific endonuclease, helicase, and ATPase activities, all of which are required for AAV-2
DNA replication (32, 33, 62). The ITR DNA contains a Rep78
and a Rep68 binding site (ITR-RBS) in addition to the so-called
terminal resolution site, which is nicked in a site- and
strand-specific manner by Rep78 and/or Rep68 (32) in the course of AAV-2 DNA replication. Rep52 and Rep40 are N-terminally truncated forms of Rep78 and Rep68, respectively, that so far have only
been implicated in the accumulation of single-stranded AAV-2 DNA
(12). In analogy to Rep78 and Rep68, ATPase and helicase activities have recently also been demonstrated for Rep52
(54).
The role of Rep78 and Rep68 in the regulation of AAV-2 gene expression
is strongly dependent on the presence or absence of a helper virus. In
the absence of helper virus, AAV-2 efficiently integrates into the host
chromosomal DNA to establish a latent infection. The low level of AAV-2
gene expression during latency (44) can be explained by the
ability of Rep78 and/or Rep68 to negatively regulate the three AAV-2
promoters, p5, p19, and p40, in the absence of helper virus (7,
31, 39, 58). The downregulation of the p5 promoter is mediated by
the Rep binding site (p5RBS) in the p5 promoter (40, 49). In
the presence of helper virus, both the p19 and p40 promoters are
activated by Rep78 and/or Rep68, a process which is dependent upon the
ITR-RBS (49, 59), the p5RBS, and additional elements in the
p19 and p40 promoters (46, 50, 51). Among these additional
elements are binding sites for the cellular transcription factor Sp1
(50, 51), which has been shown to interact directly with
Rep78 and Rep68 (29, 50). The p5 promoter is both activated
by Rep78 and Rep68 in the presence of adenovirus mediated by the
ITR-RBS and repressed by Rep78 and Rep68 mediated by the p5RBS
(49).
The Rep proteins have a variety of activities outside the AAV-2 life
cycle. The Rep78 and Rep68 proteins have been shown to repress viral
and cellular promoters (2, 5, 25, 27, 28, 31, 42), including
the H-ras, c-fos, c-myc oncogene promoters, the human immunodeficiency virus (HIV) type 1 long terminal
repeat (LTR), and the human papillomavirus type 16 and 18 (HPV18)
upstream regulatory regions (URRs). The Rep78 and Rep68 proteins
inhibit cellular DNA replication (68), herpes simplex virus
(HSV)-induced amplification of chromosomally integrated simian virus 40 (SV40) DNA (22), and bovine papillomavirus DNA amplification
(26). Furthermore, the Rep78 and Rep68 proteins suppress
cellular transformation by bovine papillomavirus DNA (24),
adenovirus (17), or the E1A/EJras oncogene combination (35). An inhibition of cell proliferation leading to the
accumulation of cells in the G1/S phase of the cell cycle
has been reported upon infection with purified AAV-2 virions
(61) and upon induction of Rep78 expression (67).
To date, relevant targets for these diverse activities of
Rep78/Rep68 have been identified only partially. The inhibition of cellular transformation by E1A/EJras correlates with the inhibition of the corresponding oncogene promoters (20, 25). Specific cis-regulatory elements binding the AAV-2 Rep78 and Rep68
proteins have been described for the AAV-2 p5 promoter, the HIV LTR,
and the H-ras promoter (5, 6, 40, 47). In
addition, Rep78 interacts with transcription factor Sp1 to exert its
inhibitory effect on the H-ras promoter (29). In
contrast, mutational analysis of the HPV18 URR revealed that the
cis elements involved in Rep-mediated inhibition are
redundant, which suggests that Rep interacts with either some general
mediator of sequence-specific transcription factors or a component of
the basal transcription machinery (31).
In this report, we identify the transcriptional coactivator PC4 as an
interaction partner of the large Rep proteins Rep78 and Rep68. PC4 was
identified by virtue of its ability to activate transcription in the
presence of a variety of sequence-specific transcription factors in a
reconstituted transcription system (18, 37). The interaction
of Rep with PC4 establishes a link between the transcriptional effects
of Rep78/Rep68 and the general transcription machinery. Furthermore,
concurrence of Rep domains needed for interaction with PC4 in vivo with
those described to be important for Rep-mediated inhibition of
HSV-induced SV40 DNA amplification and inhibition of cellular
transformation by E1A/EJras suggests a direct involvement of Rep-PC4
interaction in these inhibitory processes.
 |
MATERIALS AND METHODS |
Yeast two-hybrid screen.
A yeast two-hybrid screening system
was used to isolate cDNAs encoding proteins that are able to interact
with the AAV-2 regulatory protein Rep68. Yeast strain HF7c (Clontech)
was transformed sequentially by using the lithium acetate method with
the bait plasmid pGBT-Rep68, which encodes the Gal4 DNA-binding domain
fused in frame to Rep68 and a cDNA library from noninfected HeLa cells
fused to the Gal4 transactivation domain in plasmid pGAD424 (Clontech).
The cDNA had been generated by the method of Gubler and Hoffman
(21) (Stratagene cDNA synthesis kit) and had been ligated to
EcoRI/SalI-digested pGAD424 plasmid via
EcoRI/XhoI linkers (Stratagene cDNA synthesis kit). Double transformants were selected on SD medium (described by
Clontech in the manual for the Matchmaker two-hybrid system) lacking
tryptophan, leucine, and histidine and assayed for
-galactosidase activity by filter assays (as described by Clontech). Positive colonies
were restreaked on the same medium and assayed again for
-galactosidase activity. Colonies confirmed positive were grown in
SD medium lacking leucine, and library plasmids were isolated and
transformed into electrocompetent Escherichia coli HB101.
Bacterial transformants were selected on M9 minimal medium (2 mM
MgSO4, 0.1 mM CaCl2, 12.8 g of
Na2HPO4 · 7H2O per liter, 3 g of KH2PO4 per liter, 0.5 g of
NaCl per liter, 1.0 g of NH4Cl per liter) containing
ampicillin (100 µg/ml), proline (40 µg/ml), 1 mM thiamine, 0.4%
glucose, and an amino acid mixture medium (described by Clontech in the
manual for the matchmaker two-hybrid system) lacking leucine. Library
plasmids were repurified from bacterial transformants and retransformed
into HF7c yeast cells together with pGBT9, pGBT9-Rep68, and pLAM5
encoding a human lamin C (Clontech). Yeast transformants were tested
for growth on SD medium lacking histidine and for
-galactosidase
activity to eliminate false positives.
Production and purification of GST fusion proteins.
Cultures
of E. coli M15 transformed with the plasmids encoding
glutathione S-transferase (GST) fusion proteins were grown at 30°C to an optical density at 600 nm of 0.6 to 0.8. Production of
GST fusion proteins was induced with 0.2 mM IPTG
(isopropyl-
-D-thiogalactopyranoside) for 3 h at
30°C. Cells were harvested by centrifugation and lysed by sonication
in lysis buffer (50 mM phosphate [pH 7.8], 300 mM NaCl, 1%
[vol/vol] Triton X-100, 0.1 mM phenylmethylsulfonyl fluoride). Cell
debris was removed by centrifugation, and the supernatant was adsorbed
to glutathione-Sepharose beads (Pharmacia). Glutathione-Sepharose beads
with bound GST fusion proteins were collected by centrifugation and
washed four times with lysis buffer.
GST pull-down assays.
35S-labeled Rep78 and
Rep52 were obtained by coupled in vitro transcription-translation
(Promega) of pBS-Rep78 and pBS-Rep52 in rabbit reticulocyte lysates
with T7 RNA polymerase in the presence of
[35S]methionine. Equal amounts of labeled proteins
were incubated with 5 µg of either GST alone or GST-PC4 fusion
proteins bound to 20 µl of glutathione-Sepharose beads
(Pharmacia) for 1 h at 4°C in 1 ml of buffer A20 (20 mM HEPES
NaOH [pH 7.9], 10% glycerol, 1 mM EDTA, 10 mM MgCl2, 4 mM dithiothreitol, 0.1 mM phenylmethylsulfonyl fluoride, 20 mM KCl)
containing 1% Triton X-100. The beads were washed five times in 1 ml
of buffer A20 containing 1% Triton X-100, boiled in sodium dodecyl
sulfate (SDS) sample buffer (43), and loaded on a 15%
polyacrylamide gel (SDS-polyacrylamide gel electrophoresis [PAGE]).
35S-labeled Rep78 and Rep52 were visualized by autoradiography.
Recombinant PC4 proteins used in the GST pull-down assays were purified
from the corresponding GST-PC4 fusion proteins. One hundred micrograms
of GST-PC4 fusion proteins bound to glutathione-Sepharose beads were
incubated for 16 h with 10 U of thrombin protease (Pharmacia) in
50 mM KCl-10 mM MgCl2-20 mM Tris-HCl (pH 7.5). The PC4
released into the supernatant was separated from the glutathione-bound GST moiety by centrifugation and bound to 10 mg of single-stranded DNA-cellulose (Sigma) for 2 h at 4°C. Single-stranded DNA
cellulose-bound PC4 was recovered by centrifugation, washed three times
with buffer A100 (buffer A containing 100 mM KCl), and eluted in 200 µl of buffer A1000 (buffer A containing 1,000 mM KCl). To generate
the phosphorylated form of PC4, 15 µg of PC4 was incubated after
thrombin cleavage with 500 U of recombinant casein kinase II
(Calbiochem) prior to incubation with single-stranded DNA-cellulose.
For the GST pull-down assays, 1 µg of purified PC4 proteins was
incubated for 1 h at 4°C with 10 µg of purified GST alone or
GST-Rep fusion proteins bound to 40 µl of glutathione beads in a
total of 1 ml of buffer A20. The beads were washed five times with
buffer A20 and boiled in 60 µl of SDS sample buffer. Ten microliters
of each binding assay mixture was then analyzed for PC4 content by
SDS-15% PAGE and immunoblotting.
Generation of polyclonal PC4 antiserum.
His-tagged PC4
(pQE31-PC4) was expressed in E. coli and purified over an
Ni-nitrilotriacetic acid column under denaturing conditions in the
presence of 8 M urea as described elsewhere (Qiagen manual). Purified
PC4 was precipitated with acetone and resuspended in phosphate-buffered
saline at a concentration of 1 mg/ml. A rabbit was immunized with 200 µg of PC4 mixed 1:1 with complete Freund's adjuvant followed by two
boosts after 3 and 6 weeks with 200 µg of PC4 mixed 1:1 with
incomplete Freund's adjuvant.
Western blot analysis.
Nuclear extracts were essentially
prepared as described previously (1). Protein samples were
analyzed on SDS-15% PAGE gels (43). Proteins were
electrophoretically transferred to nitrocellulose membranes (transfer
buffer containing 20% methanol, 25 mM Tris-Cl, and 192 mM glycine).
PC4 proteins were detected with the polyclonal rabbit anti-PC4
antiserum (1:500 dilution) and a peroxidase-coupled secondary antibody
and by using enhanced chemoluminescence detection (Amersham) as
described by the supplier.
Cell culture, virus infection, and transfection.
HeLa cells
were propagated in Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10% fetal calf serum, 100 µg of penicillin and
streptomycin per ml, and 2 mM glutamine at 37°C under 5%
CO2. Transfection of noninfected and adenovirus type 2-infected HeLa cells were performed by the protocol of Chen and Okayama (13, 14) in a slightly modified form. Briefly, the day before infection or transfection, 6 × 105 HeLa
cells in 10 ml of medium were seeded into 10-cm-diameter culture dishes
and incubated at 37°C under 5% CO2. For adenovirus type
2 infection, the medium was removed and the cells were incubated for
2 h with adenovirus type 2 (multiplicity of infection, 10) in a
total volume of 1,000 µl. After the 2-h incubation period, 9 ml of
DMEM was added and the cells were incubated for an additional 1 h
prior to transfection. For transfection, 12 µg of DNA was mixed with
450 µl of 280 mM CaCl2 and 450 µl of 2× BES and
incubated for 15 min at room temperature. The transfection mixture was
added to the cells, and cells were incubated for 16 h at 37°C
under 5% CO2. After removal of the supernatant, the cells
were washed once with serum-free medium and then incubated in medium
containing 10% fetal calf serum for 8 h at 37°C under 5%
CO2.
Northern blot analysis.
RNA from 3 × 106
cells was isolated in accordance with published protocols
(15) by guanidine isothiocyanate lysis. Equal amounts of
RNA, based on the measurement of optical density at 260 nm, were
electrophoresed on a 1% agarose-formaldehyde gel (50 mM HEPES [pH
7.8], 1 mM EDTA, 6% formaldehyde) and transferred to a nylon membrane
(GeneScreen; Du Pont NEN) by capillary blotting in 25 mM phosphate
buffer (pH 6.8) overnight. For detection of AAV-2 transcripts, a 1.6-kb
HindII fragment of pTAV2-0 (22) was labeled
by random priming. The filters were hybridized in hybridization
solution (7% SDS [wt/vol], 0.125 M sodium phosphate buffer [pH
7.2], 0.25 M NaCl, 1 mM EDTA, 45% [vol/vol] formamide) at 42°C
for 16 to 30 h. The filters were washed four times in 2×
SSC-0.1% SDS at 42°C for 5 min and subsequently two times with 0.1× SSC-0.1% SDS at 65°C for 30 min (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). Filters were air dried and autoradiographed at
room temperature on Fuji RX films.
Plasmids.
The Gal4 DNA-binding domain-Rep fusion plasmids
were cloned as follows. Plasmid pGBT9 (Clontech) encoding the Gal4
DNA-binding domain was cut with SalI and PstI and
ligated to a SalI/PstI fragment from
pHIV-LTR-OVEC (31) containing an EcoRV site
derived from Bluescript SK2 adjacent to the PstI site. The
resulting plasmid was digested with SalI and partially
digested with EcoRV to excise only the pHIV
LTR-OVEC-derived insert. The resulting vector was ligated
with a Rep78 encoding a XhoI/SmaI fragment from
pKEXRep78 (31) to obtain pGBT9-Rep78. pGBT9-Rep78 was cut
with NotI and partially cut with XbaI and ligated
to the Rep encoding NotI/XbaI fragments from
pKEXRep68, pKEXRep52, pKEXRep40, and pKEXStop531 (31) to
generate the corresponding pGBT9-Rep fusion constructs. pGBT9-M172/530
was constructed by replacing the N-terminal
NotI/SalI fragment from pGBT9-Stop531 with the
corresponding fragment from pKEXM172 (36).
pGBT9-M172/243 was generated by complete BamHI digestion of pGBT-M172/530 with BamHI and religation
of the 250-bp insert encoding Rep amino acids 172 to 243 with the
BamHI vector fragment. pGBT9-Rep68K340H was constructed by
replacing the amino-terminal NotI/SalI Rep
fragment of pGBT-Rep68 with the corresponding fragment from
pKEXRep78K340H (31). pGBT9-M172/530K340H was constructed by
replacing the internal BamHI/SalI Rep fragment
from pGBT9-M172/530 with the corresponding fragment from pKEXRep78K340H.
The pGAD424-PC4 C-terminal deletion mutants were all derived from one
of the original pGAD424-PC4 clones obtained in the initial
two-hybrid
screen with pGBT9-Rep68 as a bait plasmid. pGAD424-PC4
was
digested with
EcoRI/
HindII,
EcoRI/
DraI, or
EcoRI/
BamHI,
and
the corresponding N-terminal PC4 fragments were ligated to an
EcoRI/
SmaI- or
EcoRI/
BamHI-digested pGAD424 vector to obtain
pGBT9-PC4(1-22),
pGBT9-PC4(1-77), and pGBT9-PC4(1-91), respectively.
pGAD424-PC4(62-127)
and pGAD424-PC4(82-127) were generated through PCR
amplification
of the corresponding sequences from pGAD424-PC4 with the
N-terminal
primer TAACATGTTTCAGATT or GCTAATTGATATTAGA, respectively,
and
the C-terminal primer CAACTAGAACAGTACA, which binds in the 3'
nontranslated region of PC4, and ligation of the PCR products
to a
SmaI-digested pGAD424
vector.
pGEX-PC4 was constructed by PCR amplification of the PC4 coding region
from pGAD424-PC4 with the primer pair
CATGCCTAAATCAAAG-CAACTAGAACAGTACA
and blunt end ligation to
a
BamHI-blunted/
SmaI pGEX-4T3 vector
(Pharmacia).
For pGEX-PC4(62-127) and pGEX-PC4(82-127), the corresponding
pGAD424-PC4
EcoRI/
PstI fragments were subcloned
first into Bluescript
SK2, excised from Bluescript with
SalI/
NotI, and subcloned into
pGEX-4T3.
The N-terminal part of Rep68 in pGEX-Rep68 was amplified from
pKEXRep68 with the primers GGCGGAATTCCATGCCGGGGTTTTAC, generating
an
EcoRI site at the N terminus of Rep, and
AGTCGCGCTGCAGCTTCTC,
binding at the first internal
PstI site of Rep68. The PCR product
was cloned into
Bluescript SK2 through
EcoRI/
PstI digestion,
excised
from Bluescript with
EcoRI/
NotI, and
subcloned into pGEX-4T3 to
generate pGEX-RepN. pGEX-RepN was digested
with
XbaI, partially
digested with
PstI, and
ligated to a
PstI/
XbaI fragment derived
from
pKEXRep68 containing the rest of the Rep68 coding frame.
pGEX-M172/530 and pGEXRep40 were constructed from the
corresponding
pKEX plasmids by ligation of the
NcoI-blunted/
XbaI Rep fragments
to
BamHI-blunted/
XbaI-digested pGEX-RepN. To
generate pGEX-Rep68K340H
and pGEX-M172/530K340H the
NcoI/
XbaI Rep sequences from
pGBT9-Rep68K340H
and pGBT9-M172/530K340H, respectively, were
subcloned into
NcoI/
XbaI-digested
pGEX-M172/530.
For construction of the bacterial His-tagged PC4 expression vector
pQE31-PC4, PC4 sequences were amplified from pGAD424-PC4
with the
primers GCGCGGATCCTAAATCAAAGGAACTT, generating a
BamHI
site,
and CGCGCTGCAGGAATTTTACAGTTTTCTT, generating a
PstI
site.
The PCR product was cut with
PstI, partially cut with
BamHI, and
ligated to a
BamHI/
PstI-digested vector, pQE31
(Qiagen).
pBS-Rep78 and pBS-Rep52 were constructed by subcloning the
corresponding
XhoI/
XbaI fragments of pKEXRep78
and pKEXRep52, respectively,
into Bluescript SK2
(Stratagene).
For generation of pKEX-PC4, an
EcoRI/
PstI PC4
fragment of pGAD424-PC4 was subcloned into Bluescript SK2, excised with
XhoI/
XbaI,
and subcloned into pKEX-XL
(
52).
 |
RESULTS |
Rep68 interacts with transcriptional coactivator PC4 in a yeast
two-hybrid system.
To select suitable Rep bait proteins for the
yeast two-hybrid screening of an HeLa cDNA library for Rep-interacting
proteins, we first determined which Rep domains (Fig.
1) activate transcription in yeast on
their own when fused to the Gal4 DNA-binding domain. The authentic Rep
proteins Rep78 and Rep52 and all mutant Rep proteins containing Rep
amino acids 531 to 621 encoded by the major intron of AAV-2 (Fig. 1)
showed intrinsic transactivation effects of reporter gene expression
and hence were not suitable as bait proteins (data not shown). For this
reason, and because Rep68 and Rep78 share most of their biological and
enzymatic activities, initial two-hybrid screens were performed with a
Gal4 DNA-binding domain-Rep68 fusion construct (pGBT9-Rep68). Yeast
strain HF7c, which contains two Gal4-inducible reporter genes,
HIS3 and lacZ, was sequentially cotransformed
with pGBT9-Rep68 and an HeLa cDNA library (106 independent
clones) fused to the Gal4 transactivation domain in plasmid pGAD424. In
two independent screens with 2 × 106 and 1 × 107 transformants, respectively, a total of 24 clones
capable of growing on plates lacking histidine and staining positive
for
-galactosidase expression were obtained. The coding region of nine of these clones was found to correspond to the transcriptional coactivator PC4 (Fig. 2A) recently
described independently by Ge and Roeder (18) and
Kretzschmar et al. (37). PC4 enhances transcriptional
activation by different sequence-specific transcription factors in a
reconstituted system with purified general transcription factors
(18, 37). Compared to the published sequence (18, 37), three nucleotide exchanges in the very 3' part of PC4, neither of which affected the predicted amino acid sequence of PC4,
were found in all clones (Fig. 2B). In the 3' nontranslated region of
PC4, two polyadenylation signals spaced 200 nucleotides apart were
identified (Fig. 2B). As a specificity control, the pGAD424-PC4 clones
were separately retransformed into yeast strain HF7c together with
pGBT9, pGBT9-Rep68, or a pGBT9-lamin fusion plasmid. Only
cotransformation of pGAD424-PC4 and pGBT9-Rep68 gave rise to colonies
capable of growing on plates lacking histidine and staining positive
for
-galactosidase expression, confirming PC4 as a true positive Rep
interaction partner in the two-hybrid system.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Genome organization, transcripts, and protein products
of AAV-2. The viral genome is shown in the upper part of the figure.
The ITRs are represented by hatched boxes; the three promoters at map
units 5, 19, and 40 are indicated by right-angled arrows; and the
common polyadenylation (polyA) site for all transcripts at map position
96 is indicated by a vertical arrow. The transcripts encoding the
regulatory (Rep) proteins and the structural (VP) proteins of AAV-2 are
shown in the lower part of the figure together with the corresponding
protein products. Untranslated regions of the transcripts are indicated
by solid lines, introns are shown as carats, while the coding regions
are represented by boxes. Open, closed, and different shaded boxes
indicate various domains of Rep: the N-terminal domain (amino acids 1 to 172) involved in sequence-specific DNA binding, the amino acids 172 to 225 important for Rep-mediated inhibition of cell transformation and
DNA amplification, the central domain (amino acids 225 to 530) common
to all four Rep proteins, the major intron of AAV-2 (amino acids 531 to
621), and the 7 C-terminal amino acids specific for Rep68/Rep40.
Characteristic amino acid positions are given above the boxes.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Schematic representation of the transcriptional
coactivator PC4. The two SEAC domains are indicated by hatched boxes,
while the C-terminal ssDBD is represented by a solid box. Amino acid
(AA) positions are given above the boxes. (B) Nucleotide sequence of
the 3' translated and untranslated region of PC4 with the deduced
C-terminal amino acid sequence. The numbering of nucleotides is in
accordance with that described in reference 18. The
three nucleotide exchanges found in comparison to the published
sequence which have no effect on the amino acid sequence are marked by
asterisks. In the region of the nucleotide exchanges, the published
sequence (18, 37) contains the C-terminal PCR primers
corresponding to the sequence of the mouse homolog of human PC4, which
were used for the amplification and cloning of the human PC4 sequence.
The two polyadenylation signals (sequence AATAAA) are
underlined.
|
|
Rep-PC4 interaction in yeast requires Rep amino acids 172 to 224 and the region comprising the putative Rep nucleotide-binding
site.
To identify Rep domains involved in Rep-PC4 interaction, a
series of pGBT9-Rep fusion plasmids with deletions within the Rep68 coding region were tested in cotransformations with full-length pGAD424-PC4 in the yeast two-hybrid system. Simultaneous deletion of
the 7 C-terminal and 171 N-terminal amino acids of Rep68 (M172/530) (Fig. 3) did not abolish interaction with
PC4 in yeast (Fig. 3). In contrast, the
-galactosidase activity of
M172/530 cotransformants was higher than that of Rep68 cotransformants.
This result was confirmed in additional two-hybrid screens with
pGBT9-M172/530 as a bait plasmid, where 196 of 200 selected positives
were found to correspond to PC4 by colony hybridization (data not
shown). Further deletion of 53 N-terminal amino acids in Rep40,
however, totally abolished interaction with PC4 in the yeast two-hybrid system (Fig. 3). Apparently, Rep amino acids 172 to 224 are necessary for Rep-PC4 interaction but they are not sufficient for interaction if
expressed as a Gal4 DNA-binding domain fusion protein (M172/243) (Fig.
3). This result can be explained either by the incorrect folding of
this small polypeptide sequence in the context of the Gal4 DNA-binding
domain or by the participation of additional Rep domains located within
the Rep40 coding region in PC4 interaction. This region common to all
four Rep proteins contains a putative nucleotide-binding site
implicated in the enzymatic and biological activities of the large Rep
proteins Rep78/Rep68. A well-characterized point mutation in this
nucleotide-binding site changing lysine 340 to histidine abolished
binding to PC4 both for Rep68 and M172/530 in the two-hybrid system
(Fig. 3). This same point mutation abolishes the inhibitory effects of
Rep on gene expression (31), on SV40 DNA amplification
(36), and on cell transformation (35). Though suggestive, it has not yet been demonstrated whether this region actually binds ATP.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Interaction of different Rep constructs with full-length
PC4 in the two-hybrid system. Different parts of the Rep coding region
were fused in frame to the Gal4 DNA-binding domain in pGBT9 and
cotransformed into yeast HF7c cells together with full-length PC4 fused
to the Gal4 transactivation domain in pGAD424. The Rep sequences fused
to the Gal4 DNA-binding domain are shown schematically on the left. On
the right, growth of double transformants on SD plates lacking leucine,
tryptophan, and histidine (his plates) is indicated in the first
column and -galactosidase ( -gal) activity assayed with
transformants selected on SD plates lacking leucine and tryptophan is
indicated in the second column. Symbols: ++, blue-green color observed
within 0.5 to 1 h; +, blue-green color observed within 2 to 4 h; , no evidence for color change after an overnight incubation at
30°C.
|
|
Rep interacts with the single-stranded DNA-binding domain of
PC4.
For the characterization of PC4 domains involved in Rep-PC4
interaction, a series of C-terminal and N-terminal deletion mutants of
PC4 were fused in frame to the Gal4 transactivation domain in pGAD424
and examined for interaction with M172/530 in yeast. This Rep version
was chosen because it showed the strongest reporter gene activation of
all tested Rep constructs in cotransformations with full-length PC4
(Fig. 3). The protein sequence of PC4 displays two so-called SEAC
(37) domains (Fig. 2A), stretches of consecutive serine
residues followed by a stretch of acidic residues. These SEAC domains
are located between amino acids 2 and 22 and between amino acids 50 and
61 (Fig. 2A and 4) and have homology to
similar domains present in several transcriptional regulators of the
alphaherpesvirus family, i.e., IE62 of varicella-zoster virus, ICP4 of
HSV type 1, and IE180 of pseudorabies virus. However, neither a
pGAD424-PC4 C-terminal deletion mutant retaining the first SEAC domain,
PC4(1-22), nor a construct retaining both SEAC domains, PC4(1-77), was
positive for interaction with M172/530 (Fig. 4). Furthermore,
PC4(1-91), a PC4 deletion mutant in which only the 36 carboxy-terminal
amino acids were deleted, was also completely negative. This mutant has
been shown to retain almost full coactivator function in
transcriptional activation (37), demonstrating that PC4
domains involved in Rep interaction do not correspond to those needed
for transcriptional activation. In agreement with these results, the
carboxy-terminal region of PC4, PC4(62-127), was positive for
interaction with M172/530. This region contains a dimeric
single-stranded DNA-binding domain (ssDBD) (9, 34). The
further deletion of 20 N-terminal amino acids in PC4(82-127) abolished
interaction. Taken together, these results demonstrate that amino acid
residues in the N-terminal part of the ssDBD as well as the C-terminal
part of the ssDBD are important for Rep-PC4 interaction.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Interaction of different PC4 constructs with M172/530
(Rep amino acids 172 to 530) in the two-hybrid system. Full-length PC4
and different truncated versions of PC4, shown schematically on the
left, were fused in frame to the Gal4 transactivation domain in pGAD424
and cotransformed into yeast HF7c cells together with M172/530 fused to
the Gal4 DNA-binding domain in pGBT9. On the right, growth of double
transformants on SD plates lacking leucine, tryptophan, and histidine
(his ) is shown in the first column, while -galactosidase
( -gal) activity assayed with transformants selected on SD plates
lacking leucine and tryptophane is shown in the second column. Symbols:
++, blue-green color observed within 0.5 to 1 h; +, blue-green
color observed within 2 to 4 h; , no evidence for color change
after an overnight incubation at 30°C.
|
|
35S-labeled Rep78 interacts directly with GST-PC4
fusion proteins in vitro.
To confirm the data obtained by the
yeast two-hybrid system and to demonstrate a direct interaction between
Rep and PC4, GST-PC4 fusion proteins containing either full-length PC4
or truncated PC4 polypeptides were expressed in E. coli. The
GST-PC4 fusion proteins, or GST alone, were bound to
glutathione-Sepharose beads, purified, and subsequently incubated with
in vitro-transcribed and -translated Rep78, Rep68, or Rep52. Both Rep78
(Fig. 5A) and Rep68 (data not shown) were
specifically pulled down by GST fusions of full-length PC4 or the ssDBD
of PC4 [Fig. 5A, GST-PC4(1-127) or GST-PC4(62-127), respectively],
whereas Rep52 was not (Fig. 5B). Controls with GST alone showed only a
very weak unspecific retention of Rep78 (Fig. 5). This unspecific
retention was also seen with empty beads alone (data not shown) and is
probably due to precipitation of Rep78 during the incubation. A weak
signal only marginally higher than that with the GST-negative control was obtained with the GST-PC4 fusion in which the first 20 amino acids
of the ssDBD had been deleted [Fig. 5A, GST-PC4(82-127)]. These
experiments demonstrate a direct binding of PC4 to Rep and extend the
yeast two-hybrid system results, which were obtained with Rep68, to
Rep78. Due to its intrinsic transactivatory properties, Rep78 could not
be tested separately in the two-hybrid system (see above).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Interaction of 35S-labeled Rep78 with
GST-PC4 fusion proteins in vitro. Rep78 (A) and Rep52 (B) were
transcribed and translated in vitro in the presence of
[35S]methionine. Equal amounts of labeled proteins were
incubated with glutathione-Sepharose-bound GST protein alone or the
following GST-PC4 fusion proteins: PC4(1-127) expression full-length
PC4, PC4(62-127) expressing the ssDBD of PC4, and PC4(82-127)
expressing the 46 C-terminal amino acids of PC4. Bound proteins were
collected by centrifugation, washed, boiled in SDS sample buffer, and
analyzed by SDS-PAGE with subsequent autoradiography. The lane labeled
"input" depicts the amount of labeled Rep proteins used in the
pull-down assay.
|
|
Rep binds both the nonphosphorylated and the phosphorylated form of
PC4 in vitro.
In HeLa nuclear extracts, most of PC4 is present in
a phosphorylated form, most likely generated by casein kinase II
through phosphorylation at serine residues within SEAC domain I
(19). In the GST-PC4 fusion proteins used in the pull-down
experiments, PC4 supposedly is present in the nonphosphorylated form.
To examine whether Rep also interacts with phosphorylated PC4,
pull-down assays with GST-Rep fusion proteins and purified bacterially
expressed PC4, in both the nonphosphorylated and phosphorylated forms,
were performed. PC4 was purified from GST-PC4 fusion protein by
thrombin cleavage and further purification on single-stranded DNA
cellulose (Fig. 6A, lane 4).
Phosphorylated PC4 was obtained by treatment with casein kinase II. It
can be clearly differentiated from nonphosphorylated PC4 by virtue of
its reduced mobility in SDS-PAGE analysis (Fig. 6A, lanes 4 and 5).
Additionally, the ssDBD of PC4 was similarly purified from the
corresponding GST fusion protein (Fig. 6A, lanes 6 to 8). Purified PC4
proteins were incubated with GST-Rep fusion proteins or GST alone bound
to glutathione-Sepharose beads, and after extensive washing, the bound
fractions were subjected to immunoblot analysis with a polyclonal
rabbit anti-PC4 serum. Both the nonphosphorylated and phosphorylated
forms of PC4 (Fig. 6B, upper and middle panels) were retained
specifically by GST-Rep68 and GST-M172/530 fusion proteins. It is
important to note that in several independent experiments, the
nonphosphorylated form of PC4 (Fig. 6B, upper panel) was bound with
significantly higher affinity than the phosphorylated form of PC4 was
(Fig. 6B, middle panel). In contrast to the results obtained with the
two-hybrid system, a weak but specific binding was also observed with
the GST-Rep40 fusion protein. The isolated ssDBD of PC4 was also bound by GST-Rep68 and GST-M172/530 fusion proteins (Fig. 6B, lower panel)
with an affinity similar to that of the phosphorylated form of
full-length PC4.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 6.
Interaction of different forms of bacterially expressed
PC4 proteins with GST-Rep fusion proteins in vitro. (A) Purification of
PC4 proteins. GST-PC4 (lane 2) and GST-PC4(62-127) (lane 6) were
cleaved with thrombin protease while bound to glutathione-Sepharose
beads. Beads were pelleted by centrifugation with the PC4 moieties of
the fusion proteins released into the supernatant. The GST moiety bound
to the glutathione-Sepharose beads is also shown (lanes 3 and 7). The
PC4 proteins were further purified on single-stranded DNA-cellulose and
eluted with high-salt buffer [lane 4, PC4; lane 8, PC4(62-127)]. For
phosphorylation, PC4 was incubated with casein kinase II prior to
purification on single-stranded DNA-cellulose (lane 5). The positions
of the purified PC4 proteins are indicated by arrows. (B and C) GST
pull-down assays of purified PC4 proteins. (B) One microgram of either
PC4 (upper panel), PC4 treated with casein kinase II (middle panel), or
PC4(62-127) (lower panel) was incubated with 10 µg of either the GST
protein alone or different GST-Rep fusion proteins bound to
glutathione-Sepharose beads. Bound proteins were collected by
centrifugation, washed, boiled in SDS sample buffer, and analyzed by
SDS-PAGE and Western blotting with a polyclonal rabbit anti-PC4 serum.
The lane labeled "input" depicts the amount of purified proteins
used in the pull-down assay. (C) One microgram of PC4 was incubated
with 10 µg of either the GST protein alone or different GST-Rep
fusion proteins and analyzed as described for panel B.
|
|
Binding of purified PC4 to GST-Rep fusion proteins is not affected
by mutation of the Rep nucleotide-binding site.
Since a point
mutation in the Rep nucleotide-binding site abolished Rep-PC4
interaction in the two-hybrid system, we also examined the influence of
the same mutation on binding of purified PC4 to GST-Rep fusion
proteins. Unexpectedly, mutated GST-Rep68 and GST-M172/530 bound
nonphosphorylated PC4 with an affinity similar to that of the
nonmutated proteins (Fig. 6C). Possibly, the point mutation in the
nucleotide-binding site does not lead to a change in the overall
conformation of the Rep proteins and the basic affinity for PC4 in
vitro but rather affects some secondary ATP-dependent transition, which
leads to the stabilization of a primary Rep-PC4 complex in vivo.
Influence of PC4 overexpression of AAV-2 gene expression.
PC4,
for which we could demonstrate an interaction with the large Rep
proteins Rep78 or Rep68 in vivo and in vitro, was originally described
as a coactivator needed for transcriptional activation by
different sequence-specific transcription factors in vitro. We
therefore reasoned that PC4 alone or together with Rep78 and Rep68
might be involved in the regulation of AAV-2 gene expression from its
three promoters, p5, p19, and p40. PC4 was overexpressed by
transfection of a plasmid expressing PC4 under the control of
the cytomegalovirus (CMV) promoter (CMV-PC4). Plasmids spanning the
full-length genome of AAV-2 (pTAV2-0) or a rep-negative
plasmid (pTAV2-3) were cotransfected into noninfected or
adenovirus-infected HeLa cells. As a control, the empty expression
vector was transfected instead of CMV-PC4. AAV-2 mRNA steady-state
levels were monitored 24 h posttransfection. The PC4 expression
pattern was examined in parallel by Western blotting whole-cell
extracts. In the absence of the CMV-PC4 expression construct, we were
not able to detect the nonphosphorylated form of PC4 (Fig.
7B, control) in whole-cell extracts.
Neither nuclear extracts of noninfected HeLa or 293 cells nor nuclear
extracts of adenovirus- or AAV-2-adenovirus-infected cells showed a
shift to the nonphosphorylated form of PC4. The latter showed only a
rise in the absolute level of the phosphorylated form of PC4 in
comparison to noninfected HeLa cells (Fig. 7D). In contrast,
transfection of CMV-PC4 led to the accumulation of nonphosphorylated
PC4 with a parallel rise in the amount of phosphorylated PC4 (Fig. 7B).
Based on consideration of the transfection efficiency and further
transfection experiments with tagged PC4 expression constructs, which
differ from the authentic PC4 in their migration behavior (data not
shown), we estimate that expression of PC4 under control of the CMV
promoter led to an approximately 5- to 10-fold overexpression of
phosphorylated PC4 per transfected cell. In the absence of helper
virus, overexpression of PC4 and/or accumulation of nonphosphorylated
PC4 downregulated all three AAV-2 promoters, p5, p19, and p40, both in
the presence (Fig. 7A, wt-AAV) and in the absence (Fig. 7A, rep-neg.
AAV) of Rep. In the presence of Rep, the inhibition was most pronounced
for the 2.3-kb spliced mRNA(s) encoding the AAV-2 structural proteins
(Fig. 7A, p40, lower arrow). With the rep-negative AAV-2
genome, downregulation of the AAV-2 promoters was similar to that
observed after overexpression of Rep68, which is also under control of
the CMV promoter. In the presence of adenovirus, inhibition of the AAV
promoters by overexpression of PC4 was relieved (Fig. 7C). Only some
minor inhibition of the p5 promoter could be observed.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of PC4 overexpression on AAV-2 gene expression.
(A and C) Noninfected (A) or adenovirus type 2 (multiplicity of
infection, 10)-infected (C) HeLa cells were cotransfected with equal
amounts (6 µg) of pTAV2-0 (wt-AAV; left panel) or pTAV2-3 (rep-neg.;
right panel) and either the empty CMV expression vector (control) or
the vector expressing PC4 or Rep68 as indicated. In the rep-neg. AAV
lanes of panel C, 3 µg of CMV-Rep68 was added for cotransfection. At
24 h posttransfection, the cells were assayed for AAV-2 mRNA
levels by Northern blot analysis. AAV-2 mRNAs transcribed from the p5,
p19, and p40 promoters are indicated by arrows. In the experiment
illustrated in panel A, about 10- to 20-fold-longer exposure times were
used relative to those in panel C to account for the reduced AAV gene
expression in the absence of helper virus. (B) Parallel PC4 Western
blot analysis of whole-cell extracts of cells cotransfected with
pTAV2-0 and either the empty vector or CMV-PC4. Arrows indicate the
positions of nonphosphorylated PC4 (PC4) and phosphorylated PC4
(PC4-P). (D) PC4 Western blot analysis of nuclear extracts from
noninfected 293 cells (293), noninfected HeLa cells (HeLa), and HeLa
cells infected for 24 h with adenovirus type 2 (Ad) or coinfected
with AAV-2 and adenovirus type 2 (AAV/Ad). The arrow indicates the
position of phosphorylated PC4 (PC4-P).
|
|
 |
DISCUSSION |
The AAV-2 Rep78/Rep68 proteins are essential regulators of AAV-2
DNA replication and gene expression (8, 11). They are also
pleiotropic effectors of viral and cellular DNA replication (22,
26, 68), of heterologous gene expression (2, 25, 27, 31,
42), and of cell transformation by oncogenic viruses (17) or by transfected oncogenes (35). An
inhibition of cell proliferation upon induction of Rep78 expression has
been demonstrated (67), and the growth-inhibitory effects of
AAV-2 on primary cells in the absence of apparent viral gene expression
(61) might be due to functional Rep78 associated with the
incoming AAV-2 virion (38). The aim of this study was to
identify cellular proteins involved in mediating the pleiotropic
effects of the Rep proteins by direct protein-protein interactions.
With a yeast-based two-hybrid screen, one predominant Rep68-interacting
protein was detected and identified to be the recently described
transcriptional coactivator PC4 (18, 37). PC4 has been
studied mostly in vitro, where it enhances activation of the basal
transcription complex by a variety of sequence-specific transcription
factors. Transcriptional activation by PC4 encompasses different types
of activation domains, like the acidic domains of Gal4-AH or VP16, the
proline-rich activation domain of CTF, and the glutamine-rich
activation domain of Sp1 (18). A direct physical interaction
between PC4 and these different activation domains was demonstrated by
electrophoretic mobility shift assays (18) or by GST
pull-down assays. PC4 also interacts with components of the general
transcription machinery, namely, with TFIIA or with the TATA
box-binding protein (TBP) in a manner dependent upon the presence
of TFIIA (18). It is assumed that PC4 acts initially during
TFIIA-TFIID-promoter (DA) complex formation (34) and its
function is dependent both on TBP-associated factors and on TFIIH
(45).
Expression of the reporter genes in the yeast two-hybrid system was not
due to the transactivatory properties of PC4 since (i) interaction with
Rep68 was not detected with a C-terminal deletion mutant of PC4
[PC4(1-91)] that has been shown to retain full transactivation in the
in vitro system (37) and (ii) cotransformation of PC4 with
other proteins fused to the Gal4 DNA-binding domain did not stimulate
reporter gene expression. The significance of the detected Rep-PC4
interaction is further confirmed by the fact that PC4 was almost
exclusively pulled out of an HeLa cDNA library with the central part of
the Rep coding region (M172/530) as bait; of 200 transformants that
screened positive, 196 corresponded to PC4 or at least a very closely
related protein.
We have demonstrated that the large Rep proteins Rep78 and Rep68 but
not the small Rep proteins Rep52 and Rep40 are capable of interacting
with PC4 in vivo. While the amino-terminal domain (amino acids 1 to
171) of Rep78/Rep68 was dispensable for interaction with PC4,
interaction in the yeast two-hybrid system was completely lost upon
further deletion of Rep amino acids 172 to 224 (corresponds to
Rep52/Rep40). Some weak residual binding of purified PC4, however, was
observed with the GST-Rep40 fusion protein in the pull-down assays in
vitro, suggesting an involvement of Rep amino acids 225 to 530 in the
Rep-PC4 interaction. Further evidence that these amino acids contribute
to the binding of PC4 was obtained from the lack of interaction seen
with the Rep fragment comprising amino acids 172 to 234 and from the
abrogating effect of a point mutation at amino acid position 340 within
the putative Rep nucleotide-binding site on the Rep-PC4 interaction in
vivo. Thus, amino acids 172 to 224 are essential but not sufficient for
the Rep-PC4 interaction. We observed that M172/530 consistently led to
a higher reporter gene expression in the two-hybrid system, in
comparison to Rep68, which contains 171 additional amino-terminal amino
acids. Possible explanations for this observation are the following:
(i) the conformation of the Rep moiety of the fusion proteins may
differ between the in vivo and the in vitro system or (ii) the
Gal4-Rep68 fusion protein might downregulate its own expression or the
expression of yeast genes indirectly involved in reporter gene
expression. Since we were unable to obtain any yeast transformants when
we expressed the Gal4 DNA-binding domain Rep68 fusion protien under a
stronger promoter as opposed to what was found for the Gal4 DNA-binding
domain M172/530 fusion protein (data not shown), we would favor the
latter explanation. A point mutation in the Rep nucleotide-binding site
changing amino acid 340 from lysine to histidine completely abolished
the interaction of both Rep68 and M172/530 with PC4 in the two-hybrid
system but had no effect on PC4 binding in GST pull-down assays.
Binding data obtained in GST pull-down assays clearly reflect specific
binding of Rep and PC4. However, this may not be sufficient for
formation of a functional complex in vivo, where a secondary
ATP-dependent transition may be required. Both Rep and PC4 have
DNA-binding activity, so stabilization of the Rep-PC4 complex may be
achieved by DNA binding in vivo. This assumption is in line with our
inability to detect an association between Rep and PC4 in
coimmunoprecipitation experiments, where nucleic acids are lost during
extract preparation.
The PC4 domains involved in Rep-PC4 interaction do not correspond to
those required for transcriptional activation in vitro. Transcriptional
activity of PC4 mostly involves an amino-terminal domain of 61 amino
acids containing two so-called SEAC domains (consecutive serine
residues followed by an acidic stretch) which display homology to
several transcriptional regulators of the alphaherpesvirus family such
as IE62, ICP4, and IE180 of varicella-zoster virus, HSV type 1, and
pseudorabies virus, respectively (37). A C-terminal deletion
mutant of PC4 comprising roughly two-thirds (amino acids 1 to 91) of
the coding region, including both SEAC domains, retains full
transactivation activity but was completely negative for
interaction with Rep. The interaction with Rep was mapped
to the carboxy-terminal ssDBD (34) of PC4
(amino acids 62 to 127). Amino-terminal (amino acids 62 to 81) as well
as carboxy-terminal (amino acids 92 to 127) residues of the ssDBD were
absolutely required for Rep binding. Phosphorylation of serine residues
mainly at SEAC domain I negatively regulates the transcriptional
activity of PC4 (19, 37), and in nuclear extracts of HeLa
cells, PC4 was found predominantly in this phosphorylated
transcriptionally inactive form, which in vivo is most probably
generated by casein kinase II (19). In vitro, we found a
stronger affinity of Rep for nonphosphorylated PC4, the form which we
could barely detect in nuclear extracts of HeLa or 293 cells. In vivo,
however, Rep-PC4 interaction does not seem to be limited exclusively to
this nonphosphorylated form of PC4, since Rep also binds to the
isolated ssDBD of PC4, which more closely mimics the phosphorylated
form of PC4 (34).
Several lines of evidence support an involvement of the Rep-PC4
interaction in Rep-mediated regulation of cellular and viral gene
expression, DNA amplification, and cell transformation. The Rep domains
involved in Rep-PC4 interaction correspond to those that are needed for
Rep-mediated inhibition of HSV-induced SV40 DNA amplification
(36) and overlap those involved in Rep-mediated inhibition
of cellular transformation by E1A/EJras (35, 66). A
well-characterized point mutation in the putative nucleotide-binding site of Rep, which does not affect the DNA-binding properties of
Rep78/Rep68, abolishes both the interaction with PC4 in vivo and the
inhibition of DNA amplification (36). This point mutation also abolishes Rep78-mediated inhibition of the HPV18 URR and the HIV
LTR (31). An involvement of direct Rep-PC4 interaction in
the downregulation of heterologous promoters is further suggested by
the redundancy of cis elements in the HPV18 URR required for inhibition (31), since PC4 mediates transcriptional
activation by a variety of unrelated activation domains of
sequence-specific transcription factors. In contrast to other
Rep-responsive promoters like the AAV-2 p5 and p19 promoters and the
H-ras promoter (5), the HPV18 URR does not
contain a consensus Rep binding site (31). Therefore, at
least three mechanisms of Rep-mediated inhibition of homologous and
heterologous promoters, which are not mutually exclusive, may exist.
The first mechanism involves direct binding of Rep to sequence elements
within the promoter, depends on the amino-terminal DNA-binding domain
of Rep78 and Rep68 but not on a functional nucleotide-binding site, and
could account for inhibition of the AAV-2 p5 promoter (31,
40) and the H-ras promoter (20), which
exhibit strong binding by Rep78/Rep68. The second mechanism does not
involve sequence-specific DNA binding of Rep, but rather protein-protein interactions of Rep with coactivators like PC4, depends
upon a functional nucleotide-binding site, and largely accounts for
inhibition of promoters like the HPV18 URR and the HIV LTR. PC4
has been suggested to play a similar role in the formation of the
transcriptional preinitiation complex as HMG1 (45), which
has been demonstrated to also bind directly to Rep78 and Rep68 and
enhance Rep-mediated inhibition of the p5 promoter (16).
Very recently, the interaction of Rep78 with a central component of the
basal transcription apparatus, the TBP, has also been reported
(30). A third mechanism involved in Rep-mediated transcriptional regulation would be protein-protein interactions with
sequence-specific transcription factors like Sp1 (29, 50) which have been implicated both in the transactivation of the AAV-2 p19
promoter (50) and inhibition of the H-ras
promoter (29). Since both Sp1 and Rep are capable of binding
to PC4, there may also exist trimeric complexes of Sp1, Rep, and PC4
with various functions in transcriptional activation and inhibition.
Rep-mediated inhibition of the AAV-2 p5 promoter appears to involve
sequence-specific binding of Rep to its recognition site (p5RBS) as
well as mechanisms dependent on a functional Rep nucleotide-binding site (40). We could demonstrate that overexpression of PC4
also leads to an inhibition of the AAV-2 promoters with
concomitant accumulation of the nonphosphorylated,
transcriptionally active form of PC4. This may suggest that the
nonphosphorylated active form of PC4 leads to downregulation of
AAV gene expression. This repression was mostly relieved in the
presence of helper virus. However, interpretation remains speculative
in view of the high background of phosphorylated PC4 in HeLa cells and
the lack of data regarding PC4 function in vivo.
As stated above, the mutational analysis points to a possible role of
Rep-PC4 interactions in the inhibition of HSV-induced SV40 DNA
amplification. A function for PC4 in SV40 DNA replication was suggested
due to the existence of common complexes of PC4 with RPA (replication
protein A) on single-stranded DNA (48). Although not similar
at the level of primary amino acid sequence, the dimeric
single-stranded binding sites (ssDBDs) of PC4 and RPA show a clear
structural homology (9). PC4 stimulates as well as inhibits
SV40 DNA replication in vitro, depending upon the relative
concentrations of PC4 and RPA (48). By binding to the ssDBD
of PC4, Rep might alter the single-stranded DNA-binding properties of
PC4 and thus inhibit SV40 DNA replication. When we addressed the issue
of a functional role of PC4 in AAV DNA replication in the presence of
adenovirus, we obtained controversial data (data not shown). Both
stimulatory and inhibitory effects of PC4 overexpression on AAV
replication were observed, depending on the concentration of the large
Rep proteins Rep78 and Rep68. A detailed elucidation of the role of PC4
in Rep-mediated regulation of DNA replication, gene expression, and
cell transformation will require a more profound knowledge of the
function of PC4, especially the phosphorylated form of PC4, in vivo.
 |
ACKNOWLEDGMENT |
S. Weger was supported by a grant from the FORGEN program of the
Bayerische Forschungsstiftung.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Infektionsmedizin, Abteilung Virologie, Freie
Universität Berlin, Hindenburgdamm 27, 12203 Berlin, Germany.
Phone: (49) 30 8445 3696. Fax: (49) 30 8445 4485. E-mail:
heilbronn{at}ukbf.fu-berlin.de.
 |
REFERENCES |
| 1.
|
Andrews, N. A., and D. V. Fuller.
1991.
A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells.
Nucleic Acids Res.
19:249[Abstract/Free Full Text].
|
| 2.
|
Antoni, B. A.,
A. B. Rabson,
I. L. Miller,
J. P. Trempe,
N. Chejanovsky, and B. J. Carter.
1991.
Adeno-associated virus Rep protein inhibits human immunodeficiency virus type 1 production in human cells.
J. Virol.
65:396-404[Abstract/Free Full Text].
|
| 3.
|
Atchison, R. W.,
B. C. Casto, and W. M. Hammond.
1965.
Adenovirus-associated defective virus particles.
Science
149:754-756[Abstract/Free Full Text].
|
| 4.
|
Balague, C.,
M. Kalla, and W. W. Zhang.
1997.
Adeno-associated virus Rep78 protein and terminal repeats enhance integration of DNA sequences into the cellular genome.
J. Virol.
71:3299-3306[Abstract].
|
| 5.
|
Batchu, R. B.,
R. M. Kotin, and P. L. Hermonat.
1994.
The regulatory rep protein of adeno-associated virus binds to sequences within the c-H-ras promoter.
Cancer Lett.
86:23-31[Medline].
|
| 6.
|
Batchu, R. B., and P. L. Hermonat.
1995.
The trans-inhibitory Rep78 protein of adeno-associated virus binds to TAR region DNA of the human immunodeficiencey virus type 1 long terminal repeat.
FEBS Lett.
367:267-271[Medline].
|
| 7.
|
Beaton, A.,
P. Palumbo, and K. I. Berns.
1989.
Expression from the adeno-associated virus p5 and p19 promoters is negatively regulated in trans by the rep protein.
J. Virol.
63:4450-4454[Abstract/Free Full Text].
|
| 8.
|
Berns, K. I.
1990.
Parvoviridae and their replication, p. 1743-1763.
In
B. N. Fields, and D. M. Knipe (ed.), Virology, 2nd ed., vol. 2. Raven Press, New York, N.Y.
|
| 9.
|
Brandsen, J.,
S. Werten,
P. C. van der Vliet,
M. Meisterernst,
J. Kroon, and P. Gros.
1997.
C-terminal domain of transcription factor PC4 reveals dimeric ssDNA-binding site.
Nat. Struct. Biol.
4:900-903[Medline].
|
| 10.
|
Buller, R. M.,
J. E. Janik,
E. D. Sebring, and J. A. Rose.
1981.
Herpes simplex virus types 1 and 2 completely help adeno-associated virus replication.
J. Virol.
40:241-247[Abstract/Free Full Text].
|
| 11.
|
Carter, B. J.,
J. P. Trempe, and E. Mendelson.
1990.
Adeno-associated virus gene expression and regulation, p. 227-254.
In
P. Tijssen (ed.), Handbook of parvoviruses, vol. I. CRC Press, Inc., Boca Raton, Fla.
|
| 12.
|
Chejanovsky, N., and B. J. Carter.
1989.
Mutagenesis of an AUG codon in the adeno-associated virus rep gene: effects on viral DNA replication.
Virology
173:120-128[Medline].
|
| 13.
|
Chen, A., and H. Okayama.
1988.
Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA.
BioTechniques
6:632-638[Medline].
|
| 14.
|
Chen, A., and H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:2745-2752[Abstract/Free Full Text].
|
| 15.
|
Chomzynski, P., and N. Sacchi.
1987.
Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 16.
|
Costello, E.,
P. Saudan,
E. Winocour,
L. Pizer, and P. Beard.
1997.
High mobility group chromosomal protein 1 binds to the adeno-associated virus replication protein (Rep) and promotes Rep-mediated site-specific cleavage of DNA, ATPase activity and transcriptional repression.
EMBO J.
16:5943-5954[Medline].
|
| 17.
|
De la Maza, L. M., and B. J. Carter.
1981.
Inhibition of adenovirus oncogenicity in hamsters by adeno-associated virus DNA.
J. Natl. Cancer Inst.
67:1323-1326.
|
| 18.
|
Ge, H., and R. G. Roeder.
1994.
Purification, cloning and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes.
Cell
78:513-523[Medline].
|
| 19.
|
Ge, H.,
Y. Zhao,
B. T. Chait, and R. G. Roeder.
1994.
Phosphorylation negatively regulates the function of coactivator PC4.
Proc. Natl. Acad. Sci. USA
91:12691-12695[Abstract/Free Full Text].
|
| 20.
| Geiger, C., and R. Heilbronn. Unpublished data.
|
| 21.
|
Gubler, U., and B. J. Hoffman.
1983.
A simple and very efficient method for generating cDNA libraries.
Gene
25:263-269[Medline].
|
| 22.
|
Heilbronn, R.,
A. Bürkle,
S. Stephan, and H. zur Hausen.
1990.
The adeno-associated virus rep gene suppresses herpes simplex virus-induced DNA amplification.
J. Virol.
64:3012-3018[Abstract/Free Full Text].
|
| 23.
|
Hermonat, P. L.,
M. A. Labow,
R. Wright,
K. I. Berns, and N. Muzyczka.
1984.
Genetics of adeno-associated virus: isolation and preliminary characterization of adeno-associated virus type 2 mutants.
J. Virol.
51:329-339[Abstract/Free Full Text].
|
| 24.
|
Hermonat, P. L.
1989.
The adeno-associated virus Rep78 gene inhibits cellular transformation induced by bovine papillomavirus.
Virology
172:253-261[Medline].
|
| 25.
|
Hermonat, P. L.
1991.
Inhibition of H-ras expression by the adeno-associated virus Rep78 transformation suppressor gene product.
Cancer Res.
51:3373-3377[Abstract/Free Full Text].
|
| 26.
|
Hermonat, P. L.
1992.
Inhibition of bovine papillomavirus plasmid DNA replication by adeno-associated virus.
Virology
189:329-333[Medline].
|
| 27.
|
Hermonat, P. L.
1994.
Downregulation of the human c-fos and c-myc proto-oncogene promoters by adeno-associated virus Rep78.
Cancer Lett.
81:129-136[Medline].
|
| 28.
|
Hermonat, P. L.
1994.
Adeno-associated virus inhibits human papillomavirus type 16: a viral interaction implicated in cervical cancer.
Cancer Res.
54:2278-2281[Abstract/Free Full Text].
|
| 29.
|
Hermonat, P. L.,
A. D. Santin, and R. B. Batchu.
1996.
The adeno-associated virus Rep78 major regulatory/transformation suppressor protein binds cellular Sp1 in vitro and evidence of a biological effect.
Cancer Res.
56:5299-5304[Abstract/Free Full Text].
|
| 30.
|
Hermonat, P. L.,
A. D. Santin,
R. B. Batchu, and D. Zhan.
1998.
The adeno-associated virus Rep78 major regulatory protein binds the cellular TATA-binding protein in vitro and in vivo.
Virology
245:120-127[Medline].
|
| 31.
|
Hörer, H.,
S. Weger,
K. Butz,
F. Hoppe-Seyler,
C. Geisen, and J. A. Kleinschmidt.
1995.
Mutational analysis of adeno-associated virus Rep protein-mediated inhibition of heterologous and homologous promoters.
J. Virol.
69:5485-5496[Abstract].
|
| 32.
|
Im, D.-S., and N. Muzyczka.
1990.
The AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity.
Cell
61:447-457[Medline].
|
| 33.
|
Im, D.-S., and N. Muzyczka.
1992.
Partial purification of adeno-associated virus Rep78, Rep52, and Rep40 and their biochemical characterization.
J. Virol.
66:1119-1128[Abstract/Free Full Text].
|
| 34.
|
Kaiser, K.,
G. Stelzer, and M. Meisterernst.
1995.
The coactivator p15 (PC4) initiates transcriptional activation during TFIIA-TFIID-promoter complex formation.
EMBO J.
14:3520-3527[Medline].
|
| 35.
|
Khleif, S. N.,
T. Myers,
B. J. Carter, and J. P. Trempe.
1991.
Inhibition of cellular transformation by the adeno-associated virus rep gene.
Virology
181:738-741[Medline].
|
| 36.
|
Kleinschmidt, J. A.,
M. Möhler,
F. W. Weindler, and R. Heilbronn.
1995.
Sequence elements of the adeno-associated virus rep gene required for suppression of herpes-simplex-virus induced DNA amplification.
Virology
206:254-262[Medline].
|
| 37.
|
Kretzschmar, M.,
K. Kaiser,
F. Lottspeich, and M. Meisterernst.
1994.
A novel mediator of class II gene transcription with homology to viral immediate-early transcriptional regulators.
Cell
78:525-534[Medline].
|
| 38.
|
Kube, D. M.,
S. Ponnazhagan, and A. Srivastava.
1997.
Encapsidation of adeno-associated virus type 2 Rep proteins in wild-type and recombinant progeny virions: Rep-mediated growth inhibition of primary human cells.
J. Virol.
71:7361-7371[Abstract].
|
| 39.
|
Kyöstiö, S. R. M.,
R. A. Owens,
M. D. Weitzman,
B. A. Antoni,
N. Chejanovsky, and B. J. Carter.
1994.
Analysis of adeno-associated virus (AAV) wild-type and mutant Rep proteins for their abilities to negatively regulate AAV p5 and p19 mRNA levels.
J. Virol.
68:2947-2957[Abstract/Free Full Text].
|
| 40.
|
Kyöstiö, S. R. M.,
R. S. Wonderling, and R. A. Owens.
1995.
Negative regulation of the adeno-associated virus (AAV) p5 promoter involves both the p5 rep binding site and the consensus ATP-binding motif of the AAV Rep68 protein.
J. Virol.
69:6787-6796[Abstract].
|
| 41.
|
Labow, M. A.,
P. L. Hermonat, and K. I. Berns.
1986.
Positive and negative autoregulation of the adeno-associated virus type 2 genome.
J. Virol.
60:251-258[Abstract/Free Full Text].
|
| 42.
|
Labow, M. A.,
L. H. Graf, Jr., and K. I. Berns.
1987.
Adeno-associated virus gene expression inhibits cellular transformation by heterologous genes.
Mol. Cell. Biol.
7:1320-1325[Abstract/Free Full Text].
|
| 43.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 44.
|
Laughlin, C. A.,
C. B. Cardellichio, and H. C. Coon.
1986.
Latent infection of KB cells with adeno-associated virus type 2.
J. Virol.
60:515-524[Abstract/Free Full Text].
|
| 45.
|
Malik, S.,
M. Guermah, and R. G. Roeder.
1998.
A dynamic model for PC4 coactivator function in RNA polymerase II transcription.
Proc. Natl. Acad. Sci. USA
95:2192-2197[Abstract/Free Full Text].
|
| 46.
|
McCarty, D. M.,
M. Christensen, and N. Muzyczka.
1991.
Sequences required for coordinate induction of adeno-associated virus p19 and p40 promoters by Rep protein.
J. Virol.
65:2936-2945[Abstract/Free Full Text].
|
| 47.
|
Oelze, I.,
K. Rittner, and G. Sczakiel.
1994.
Adeno-associated virus type 2 rep gene-mediated inhibition of basal gene expression of human immunodeficiency virus type 1 involves its negative regulatory functions.
J. Virol.
68:1229-1233[Abstract/Free Full Text].
|
| 48.
|
Pan, Z.-Q.,
H. Ge,
A. A. Amin, and J. Hurwitz.
1996.
Transcrition-positive cofactor PC4 forms complexes with HSSB (RPA) on single-stranded DNA and influences HSSB-dependent enzymatic synthesis of simian virus 40 DNA.
J. Biol. Chem.
271:22111-22116[Abstract/Free Full Text].
|
| 49.
|
Pereira, D. J.,
D. M. McCarty, and N. Muzyczka.
1997.
The adeno-associated virus (AAV) Rep protein acts as both a repressor and an activator to regulate AAV transcription during productive infection.
J. Virol.
71:1079-1088[Abstract].
|
| 50.
|
Pereira, D. J., and N. Muzyczka.
1997.
The cellular transcription factor SP1 and an unknown cellular protein are required to mediate Rep protein activation of the adeno-associated virus p19 promoter.
J. Virol.
71:1747-1756[Abstract].
|
| 51.
|
Pereira, D. J., and N. Muzyczka.
1997.
The adeno-associated virus type 2 p40 promoter requires a proximal SP1 interaction and a p19 CArG-like element to facilate Rep transactivation.
J. Virol.
71:4300-4309[Abstract].
|
| 52.
|
Rittner, K.,
H. Stöppler,
M. Pawlita, and G. Sczakiel.
1991.
Versatile eucaryotic vectors for strong and constitutive transient and stable gene expression.
Methods Mol. Cell. Biol.
2:176-181.
|
| 53.
|
Samulski, R. J.
1993.
Adeno-associated virus: integration at a specific chromosomal locus.
Curr. Opin. Genet. Dev.
3:74-80[Medline].
|
| 54.
|
Smith, R. H., and R. M. Kotin.
1998.
The Rep52 gene product of adeno-associated virus is a DNA helicase with 3'-to-5' polarity.
J. Virol.
72:4874-4881[Abstract/Free Full Text].
|
| 55.
|
Srivastava, A.,
E. W. Lusby, and K. I. Berns.
1983.
Nucleotide sequence and organization of the adeno-associated virus 2 genome.
J. Virol.
45:555-564[Abstract/Free Full Text].
|
| 56.
|
Tratschin, J.-D.,
I. L. Miller, and B. J. Carter.
1984.
Genetic analysis of adeno-associated virus: properties of deletion mutants constructed in vitro and evidence for an adeno-associated virus replication function.
J. Virol.
51:611-619[Abstract/Free Full Text].
|
| 57.
|
Tratschin, J.-D.,
J. Tal, and B. J. Carter.
1986.
Negative and positive regulation in trans of gene expression from adeno-associated virus vectors in mammalian cells by a viral rep gene product.
Mol. Cell. Biol.
6:2884-2894[Abstract/Free Full Text].
|
| 58.
|
Trempe, J. P., and B. J. Carter.
1988.
Regulation of adeno-associated virus gene expression in 293 cells: control of mRNA abundance and translation.
J. Virol.
62:68-74[Abstract/Free Full Text].
|
| 59.
|
Weger, S.,
A. Wistuba,
D. Grimm, and J. A. Kleinschmidt.
1997.
Control of adeno-associated virus type 2 cap gene expression: relative influence of helper virus, terminal repeats, and Rep proteins.
J. Virol.
71:8437-8447[Abstract].
|
| 60.
|
Weitzman, M. D.,
S. R. M. Kyöstiö,
R. M. Kotin, and R. A. Owens.
1994.
Adeno-associated (AAV) Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA.
Proc. Natl. Acad. Sci. USA
91:5808-5812[Abstract/Free Full Text].
|
| 61.
|
Winocour, E.,
M. F. Callahan, and E. Huberman.
1988.
Perturbation of the cell cycle by adeno-associated virus.
Virology
167:393-399[Medline].
|
| 62.
|
Wonderling, R. S.,
S. R. M. Kyöstiö, and R. A. Owens.
1995.
A maltose-binding protein/adeno-associated virus Rep68 fusion protein has DNA-RNA helicase and ATPase activities.
J. Virol.
69:3542-3548[Abstract].
|
| 63.
|
Yakobson, B.,
T. Koch, and E. Winocour.
1987.
Replication of adeno-associated virus in synchronized cells without the addition of a helper virus.
J. Virol.
61:972-981[Abstract/Free Full Text].
|
| 64.
|
Yakobson, B.,
T. A. Hrynko,
M. J. Peak, and E. Winocour.
1989.
Replication of adeno-associated virus in cells irradiated with UV light at 254 nm.
J. Virol.
63:1023-1030[Abstract/Free Full Text].
|
| 65.
|
Yalkinoglu, A. Ö.,
R. Heilbronn,
A. Bürkle,
J. R. Schlehofer, and H. zur Hausen.
1988.
DNA amplification of adeno-associated virus as a response to cellular genotoxic stress.
Cancer Res.
48:3123-3129[Abstract/Free Full Text].
|
| 66.
|
Yang, Q.,
A. Kadam, and J. P. Trempe.
1992.
Mutational analysis of the adeno-associated virus rep gene.
J. Virol.
66:6058-6069[Abstract/Free Full Text].
|
| 67.
|
Yang, Q.,
F. Chen, and J. P. Trempe.
1994.
Characterization of cell lines that inducibly express the adeno-associated virus Rep proteins.
J. Virol.
68:4847-4856[Abstract/Free Full Text].
|
| 68.
|
Yang, Q.,
F. Chen,
J. Ross, and J. P. Trempe.
1995.
Inhibition of cellular and SV40 DNA replication by the adeno-associated virus Rep proteins.
Virology
207:246-250[Medline].
|
Journal of Virology, January 1999, p. 260-269, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nash, K., Chen, W., Salganik, M., Muzyczka, N.
(2009). Identification of Cellular Proteins That Interact with the Adeno-Associated Virus Rep Protein. J. Virol.
83: 454-469
[Abstract]
[Full Text]
-
Murphy, M., Gomos-Klein, J., Stankic, M., Falck-Pedersen, E.
(2007). Adeno-Associated Virus Type 2 p5 Promoter: a Rep-Regulated DNA Switch Element Functioning in Transcription, Replication, and Site-Specific Integration. J. Virol.
81: 3721-3730
[Abstract]
[Full Text]
-
Timpe, J. M., Verrill, K. C., Trempe, J. P.
(2006). Effects of Adeno-Associated Virus on Adenovirus Replication and Gene Expression during Coinfection.. J. Virol.
80: 7807-7815
[Abstract]
[Full Text]
-
Pegoraro, G., Marcello, A., Myers, M. P., Giacca, M.
(2006). Regulation of Adeno-Associated Virus DNA Replication by the Cellular TAF-I/Set Complex. J. Virol.
80: 6855-6864
[Abstract]
[Full Text]
-
Needham, P. G., Casper, J. M., Kalman-Maltese, V., Verrill, K., Dignam, J. D., Trempe, J. P.
(2006). Adeno-associated virus rep protein-mediated inhibition of transcription of the adenovirus major late promoter in vitro.. J. Virol.
80: 6207-6217
[Abstract]
[Full Text]
-
Berthet, C., Raj, K., Saudan, P., Beard, P.
(2005). How adeno-associated virus Rep78 protein arrests cells completely in S phase. Proc. Natl. Acad. Sci. USA
102: 13634-13639
[Abstract]
[Full Text]
-
Casper, J. M., Timpe, J. M., Dignam, J. D., Trempe, J. P.
(2005). Identification of an Adeno-Associated Virus Rep Protein Binding Site in the Adenovirus E2a Promoter. J. Virol.
79: 28-38
[Abstract]
[Full Text]
-
Heilbronn, R., Engstler, M., Weger, S., Krahn, A., Schetter, C., Boshart, M.
(2003). ssDNA-dependent colocalization of adeno-associated virus Rep and herpes simplex virus ICP8 in nuclear replication domains. Nucleic Acids Res
31: 6206-6213
[Abstract]
[Full Text]
-
Lackner, D. F., Muzyczka, N.
(2002). Studies of the Mechanism of Transactivation of the Adeno-Associated Virus p19 Promoter by Rep Protein. J. Virol.
76: 8225-8235
[Abstract]
[Full Text]
-
Dhepakson, P., Mori, Y., Jiang, Y. B., Huang, H. L., Akkapaiboon, P., Okuno, T., Yamanishi, K.
(2002). Human herpesvirus-6 rep/U94 gene product has single-stranded DNA-binding activity. J. Gen. Virol.
83: 847-854
[Abstract]
[Full Text]
-
Weger, S., Hammer, E., Heilbronn, R.
(2002). Topors, a p53 and topoisomerase I binding protein, interacts with the adeno-associated virus (AAV-2) Rep78/68 proteins and enhances AAV-2 gene expression. J. Gen. Virol.
83: 511-516
[Abstract]
[Full Text]
-
Schmidt, M., Chiorini, J. A., Afione, S., Kotin, R.
(2002). Adeno-Associated Virus Type 2 Rep78 Inhibition of PKA and PRKX: Fine Mapping and Analysis of Mechanism. J. Virol.
76: 1033-1042
[Abstract]
[Full Text]
-
Schmidt, M., Afione, S., Kotin, R. M.
(2000). Adeno-Associated Virus Type 2 Rep78 Induces Apoptosis through Caspase Activation Independently of p53. J. Virol.
74: 9441-9450
[Abstract]
[Full Text]
-
Wu, P., Xiao, W., Conlon, T., Hughes, J., Agbandje-McKenna, M., Ferkol, T., Flotte, T., Muzyczka, N.
(2000). Mutational Analysis of the Adeno-Associated Virus Type 2 (AAV2) Capsid Gene and Construction of AAV2 Vectors with Altered Tropism. J. Virol.
74: 8635-8647
[Abstract]
[Full Text]
-
Mori, Y., Dhepakson, P., Shimamoto, T., Ueda, K., Gomi, Y., Tani, H., Matsuura, Y., Yamanishi, K.
(2000). Expression of Human Herpesvirus 6B rep within Infected Cells and Binding of Its Gene Product to the TATA-Binding Protein In Vitro and In Vivo. J. Virol.
74: 6096-6104
[Abstract]
[Full Text]
-
Cathomen, T., Collete, D., Weitzman, M. D.
(2000). A Chimeric Protein Containing the N Terminus of the Adeno-Associated Virus Rep Protein Recognizes Its Target Site in an In Vivo Assay. J. Virol.
74: 2372-2382
[Abstract]
[Full Text]
-
Wang, D., Parrish, C. R.
(1999). A Heterogeneous Nuclear Ribonucleoprotein A/B-Related Protein Binds to Single-Stranded DNA near the 5' End or within the Genome of Feline Parvovirus and Can Modify Virus Replication. J. Virol.
73: 7761-7768
[Abstract]
[Full Text]